ID: 948878001

View in Genome Browser
Species Human (GRCh38)
Location 2:240840504-240840526
Sequence GGGGCAGTCGTGACCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948877999_948878001 -10 Left 948877999 2:240840491-240840513 CCTGGCAACAGCAGGGGCAGTCG No data
Right 948878001 2:240840504-240840526 GGGGCAGTCGTGACCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948878001 Original CRISPR GGGGCAGTCGTGACCCATGG AGG Intergenic
No off target data available for this crispr