ID: 948881644

View in Genome Browser
Species Human (GRCh38)
Location 2:240860798-240860820
Sequence CAGAACAAGGACAAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948881638_948881644 -5 Left 948881638 2:240860780-240860802 CCCAACAAGGGGGTCCTGCAGAA No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881636_948881644 3 Left 948881636 2:240860772-240860794 CCAACCTACCCAACAAGGGGGTC No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881639_948881644 -6 Left 948881639 2:240860781-240860803 CCAACAAGGGGGTCCTGCAGAAC No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881630_948881644 14 Left 948881630 2:240860761-240860783 CCACAACCTTGCCAACCTACCCA No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881637_948881644 -1 Left 948881637 2:240860776-240860798 CCTACCCAACAAGGGGGTCCTGC No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881631_948881644 8 Left 948881631 2:240860767-240860789 CCTTGCCAACCTACCCAACAAGG No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data
948881629_948881644 23 Left 948881629 2:240860752-240860774 CCATCACAGCCACAACCTTGCCA No data
Right 948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948881644 Original CRISPR CAGAACAAGGACAAGGATGA GGG Intergenic
No off target data available for this crispr