ID: 948882389

View in Genome Browser
Species Human (GRCh38)
Location 2:240866568-240866590
Sequence ATTCCCTTCTAGAAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 372}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948882386_948882389 13 Left 948882386 2:240866532-240866554 CCAAATCACTGTCTTAAACATCA 0: 1
1: 1
2: 5
3: 30
4: 261
Right 948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 28
4: 372
948882385_948882389 14 Left 948882385 2:240866531-240866553 CCCAAATCACTGTCTTAAACATC 0: 1
1: 1
2: 5
3: 23
4: 333
Right 948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 28
4: 372
948882384_948882389 17 Left 948882384 2:240866528-240866550 CCACCCAAATCACTGTCTTAAAC 0: 1
1: 1
2: 6
3: 29
4: 211
Right 948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 28
4: 372
948882383_948882389 18 Left 948882383 2:240866527-240866549 CCCACCCAAATCACTGTCTTAAA 0: 1
1: 2
2: 4
3: 25
4: 331
Right 948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 28
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948882389 Original CRISPR ATTCCCTTCTAGAAGGAAAA GGG Intergenic
903746674 1:25591680-25591702 CTTCCCCTCTAGAATGAAGAGGG - Intergenic
905096762 1:35478888-35478910 ATTCCCTTTTAGAGGAAAGAAGG - Intronic
905206341 1:36344712-36344734 CTTCCCTTCTAGAGGGGAGACGG - Intronic
905979165 1:42208023-42208045 CTTCCCTTCTGGTAGGAAAAGGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908287671 1:62625391-62625413 ATTCTTTTGTAGAACGAAAAGGG - Exonic
908713297 1:67042694-67042716 ATTCAGTTCTAGAAAGAGAATGG - Intronic
909246813 1:73297019-73297041 ATTCCATTCTAGCAGCAGAACGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909916682 1:81328145-81328167 AGTCTCTTCTGAAAGGAAAAAGG - Intronic
910196203 1:84642142-84642164 ACTCAGTTTTAGAAGGAAAACGG - Intergenic
913356647 1:117929669-117929691 ATTTCCTCCTAGAAGGCAAAGGG + Intergenic
913359115 1:117959716-117959738 ATTCCCTGCTAGAATATAAAGGG - Exonic
913544174 1:119851017-119851039 ATTCCTTTCTAGCAACAAAAAGG - Intergenic
915444506 1:155967053-155967075 ATTTCCTGCTTGAAGGAAGAGGG - Intronic
915610794 1:156990884-156990906 ATTTCCTGCTAAAAGGAACAGGG - Intronic
916675153 1:167059257-167059279 AGTCCCTTTCCGAAGGAAAAGGG - Intronic
917256204 1:173119242-173119264 ATTCCCTTCTTGGAGGCCAAAGG - Intergenic
918089108 1:181272621-181272643 TTTCTCTTCAAGAAGTAAAATGG + Intergenic
919676437 1:200388114-200388136 TGTCCCTTCTAGAGGGGAAAGGG - Intergenic
920092511 1:203464541-203464563 ATTCCACTCAAGATGGAAAAGGG + Intergenic
920854058 1:209649246-209649268 ATTCCCTTGTTCAAGCAAAATGG + Intronic
921188963 1:212693199-212693221 ATGCCCTCCTGGAAGGAACAGGG + Intronic
921368064 1:214393573-214393595 ATTAGCTTCTACAAGGAACAAGG + Intronic
923234644 1:232020861-232020883 ATCCCCTGGTAGGAGGAAAAGGG - Intronic
923731357 1:236553891-236553913 ATTGCCTTCTAGAACTCAAATGG + Intronic
1062826536 10:573055-573077 TTTCCCTCCGAGAATGAAAATGG - Intronic
1063643655 10:7856650-7856672 ATTTCCCTCTAAAAGGAACAAGG + Intronic
1063803850 10:9614641-9614663 ATTCACTTGTACAAGGTAAAAGG - Intergenic
1064619386 10:17199722-17199744 GCTGCCTGCTAGAAGGAAAACGG + Intronic
1064839692 10:19577333-19577355 TATCCCTTCTAGGAGCAAAAAGG - Intronic
1065591425 10:27266061-27266083 ATTGCCTTGAAGAAGGCAAAGGG + Intergenic
1065720535 10:28624691-28624713 ATACCCATCTTAAAGGAAAAAGG + Intergenic
1065739288 10:28782432-28782454 ATTCTATTTTAAAAGGAAAAAGG - Intergenic
1065739619 10:28785075-28785097 CTTCCCTTCTTGTGGGAAAAGGG + Intergenic
1066687457 10:37994325-37994347 AATTCCTTGTAGGAGGAAAAAGG - Intergenic
1067327568 10:45284425-45284447 AATCCCTGGAAGAAGGAAAATGG + Intergenic
1069168143 10:65189894-65189916 ATTTCCCACTAAAAGGAAAAAGG - Intergenic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1071302211 10:84264415-84264437 ATTCCCTGTTAAAGGGAAAAGGG + Intergenic
1071494319 10:86157375-86157397 ATGCCCTCCAAGCAGGAAAAGGG + Intronic
1071574925 10:86718257-86718279 ATTCCCTTTTAGGATAAAAATGG - Intronic
1072267014 10:93740559-93740581 ATTCCATTCCAGAAGATAAAGGG + Intergenic
1072711455 10:97718264-97718286 TTTCCCTCCTAGAAGGAAAGAGG - Intergenic
1073153370 10:101327422-101327444 ATTCCATTTTAAAAGGGAAATGG + Intergenic
1073597196 10:104812858-104812880 ATCCCCTTCAAGAAGGACATGGG - Intronic
1074577165 10:114681134-114681156 ATTACCTTATATATGGAAAATGG + Intronic
1074672110 10:115803184-115803206 AATGCTTTCTAGAAGTAAAAGGG + Intronic
1074875406 10:117609675-117609697 ATCCCCATTTGGAAGGAAAATGG + Intergenic
1074923328 10:118041921-118041943 AATCCCTTATATAAGGCAAATGG + Intronic
1075929733 10:126285648-126285670 CTTCCCTCCTAGGAGGAAAGAGG - Intronic
1076031579 10:127163593-127163615 TTTCCCTTTCAGAAGCAAAAGGG - Intronic
1076604764 10:131682302-131682324 AGTTCCTTCTAGAAGTAAGATGG + Intergenic
1078320180 11:10327415-10327437 ATTCTTATCTAGCAGGAAAAAGG - Intronic
1078346908 11:10557917-10557939 AGTCCCTTCTTGTTGGAAAAAGG + Exonic
1080072343 11:28104904-28104926 TTTCCCTTCTATAGGGAAAGTGG - Intronic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1080401479 11:31940414-31940436 ATCCAGTTCTAGAAGGAATAAGG + Intronic
1080876404 11:36278898-36278920 ATTCTCATGCAGAAGGAAAAGGG - Intronic
1081200191 11:40205879-40205901 ATACCTTTTTAGAAAGAAAAAGG - Intronic
1084055134 11:66627038-66627060 CTTCCCATCTAAAAAGAAAAAGG - Exonic
1086610196 11:88746347-88746369 ATTGCCCAGTAGAAGGAAAAAGG - Intronic
1087557092 11:99734722-99734744 ATTCCCTTCCAGTAGGAAGCAGG - Intronic
1088664715 11:112083141-112083163 ATTCCCTTTTAACAAGAAAAGGG - Exonic
1088953776 11:114598095-114598117 TTTCCCTTTTAGAATGTAAAAGG - Intergenic
1091014323 11:132036481-132036503 ATTCCTTTTTATAATGAAAAAGG + Intronic
1091231899 11:133993465-133993487 AGACCCTTCCAGAAGGACAAAGG - Intergenic
1091935782 12:4433513-4433535 GTTCCCTTCTTGGAGGAAAGGGG - Intronic
1092080657 12:5713441-5713463 ATTCCCTTCCAGAAAGCAGAGGG + Intronic
1093885720 12:24457943-24457965 ATTTCCTTATAGAATAAAAATGG - Intergenic
1094270514 12:28609310-28609332 AATCCCTTCTGGAAGGAGACAGG + Intergenic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1096758257 12:53818002-53818024 ATTTCCTTGTAGCAGCAAAAGGG + Intergenic
1096809331 12:54159591-54159613 ATTCATTTTTAAAAGGAAAATGG + Intergenic
1097463228 12:59889622-59889644 ATTCCCTTCTATGAAGAAAAAGG - Intergenic
1097891765 12:64783809-64783831 TTTTCCTTCTAGAAATAAAAGGG - Intronic
1098407100 12:70138380-70138402 ATTCCATTCTACAAAAAAAAAGG - Intergenic
1098677087 12:73303356-73303378 ATTTCCTCCTAGAAGGAAAATGG + Intergenic
1099508970 12:83509925-83509947 TTTTGCTTCTAGAAGGCAAAGGG + Intergenic
1099642080 12:85303106-85303128 ATTCTCTTCTAAAACCAAAAAGG - Intergenic
1099854580 12:88147709-88147731 ATTCCCTTCCAAAATAAAAAAGG - Intronic
1101512534 12:105406051-105406073 ATCCCCTTCCAGGAGGAAACAGG + Intergenic
1103102301 12:118189017-118189039 ATGCCCTTGTAGTAGCAAAAGGG - Intronic
1103118194 12:118356157-118356179 ATTCCATTCCTGAAGGAGAATGG + Intronic
1103319204 12:120080818-120080840 TTTCCCTCCAAGAGGGAAAAAGG - Intronic
1105971029 13:25429461-25429483 ATTCTCCCCAAGAAGGAAAATGG + Intronic
1106084945 13:26533415-26533437 ATTTCTTAATAGAAGGAAAATGG + Intergenic
1107209541 13:37836668-37836690 ATTCAGTTTTAAAAGGAAAATGG + Intronic
1107212443 13:37873594-37873616 ATTTCCTACTTGAAAGAAAATGG + Intergenic
1107276436 13:38685814-38685836 AATCCCTTGGAGCAGGAAAAGGG + Intergenic
1108972181 13:56391752-56391774 ATTGCCGTCTAGAAGTCAAAGGG + Intergenic
1109078067 13:57864086-57864108 TTTTCATTCAAGAAGGAAAATGG + Intergenic
1110297826 13:73889125-73889147 ATCCCCTTCTAAAAGGAGAGAGG - Intronic
1110343795 13:74423042-74423064 ATTTACTGCTAGATGGAAAATGG + Intergenic
1110343931 13:74424436-74424458 TTTGACTGCTAGAAGGAAAATGG + Intergenic
1110644265 13:77863582-77863604 ATTCAATTTTAGAAGCAAAAAGG + Intergenic
1111856947 13:93650010-93650032 ATTGTCTTATAGAAAGAAAATGG + Intronic
1111867296 13:93785091-93785113 ATTCATTTCAAGAAGAAAAAGGG + Intronic
1111887542 13:94041411-94041433 ATTGCCTTCTAGAAGGCATTAGG + Intronic
1112790919 13:103001444-103001466 ATTCCCTACTGGCAGGAAACAGG - Intergenic
1113105695 13:106769704-106769726 ACTCCCTTATAAAAAGAAAAGGG + Intergenic
1113214251 13:108019891-108019913 ATTCAGTTCAAGAAGAAAAATGG + Intergenic
1113870082 13:113553946-113553968 AATCCCTTCCAGAAGGAAGGAGG + Intronic
1113951367 13:114073174-114073196 ATTCCCTACACGCAGGAAAACGG + Intronic
1113951411 13:114073504-114073526 ATTCCCTACACGCAGGAAAACGG + Intronic
1114414518 14:22532159-22532181 ATCCCTCTCTAGAAGGAACAAGG + Intergenic
1114492674 14:23113189-23113211 CTTCCCTTTTAGAAGAAACAGGG - Intergenic
1116341020 14:43723199-43723221 ATTTCCTTATGGAAGGAACAGGG - Intergenic
1116430254 14:44838242-44838264 TTCCCTTTCTAGAAGGCAAAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116654337 14:47632223-47632245 ATTCATTTCTATAGGGAAAATGG - Intronic
1116781481 14:49241844-49241866 ATTTAATTCAAGAAGGAAAATGG - Intergenic
1118357017 14:65022715-65022737 ATTCCCTTTGAGGTGGAAAATGG + Intronic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1202870591 14_GL000225v1_random:159487-159509 ATTCCCTAACAGAATGAAAAAGG - Intergenic
1124674183 15:31669572-31669594 CTTCCCAGCTAGAAAGAAAAGGG + Intronic
1125121379 15:36162528-36162550 ATTCCCATTCAGAAGCAAAAAGG - Intergenic
1125793088 15:42384612-42384634 ATCCCCTTCCAGGAGGTAAAGGG + Intronic
1126874119 15:53020299-53020321 CTTTACTTCAAGAAGGAAAATGG - Intergenic
1127029201 15:54843009-54843031 ATTCCCTTATAAAAGTAAGAAGG - Intergenic
1127289989 15:57561681-57561703 CTTCCCTTCTTGAAGGAAGTAGG - Intergenic
1127516951 15:59705071-59705093 ATTCATTTATAGAAGAAAAAAGG + Intergenic
1128921130 15:71611342-71611364 ATCTCTTTCTAGAAGGAAAATGG - Intronic
1128963086 15:72029043-72029065 ATTCAATCCAAGAAGGAAAAAGG + Intronic
1129036904 15:72655515-72655537 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129212983 15:74081710-74081732 ATTTCCAGCTAGAAGGGAAATGG - Intronic
1129397419 15:75259376-75259398 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129401028 15:75283653-75283675 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129730120 15:77926026-77926048 ATTTCCAGCTAGAAGGGAAATGG - Intergenic
1130426303 15:83804304-83804326 ATTCTTTTCTATAATGAAAAGGG - Intronic
1130725368 15:86433377-86433399 AGCCCCTTCTAGAAGGAGGAAGG + Intronic
1130741335 15:86603531-86603553 ATGCCCATCTAGAAAGTAAAAGG - Intronic
1131373315 15:91902746-91902768 TTTCCTCTCTAGAAGGAAAAAGG - Intronic
1131580507 15:93638358-93638380 TGTCCCTTCTAGAATGAAAGAGG + Intergenic
1133354044 16:5123076-5123098 ATTCCCTTCGAGGGGGACAAGGG - Intergenic
1133696686 16:8270764-8270786 ATTCCTTTCTAGAATGAAGAAGG - Intergenic
1134142696 16:11735448-11735470 ATTCCTTTTTAGGAAGAAAAAGG + Intronic
1134516281 16:14889737-14889759 ATTCCCTTTGAGGAGGAAACTGG + Intronic
1134703953 16:16288389-16288411 ATTCCCTTTGAGGAGGAAACTGG + Intronic
1134963590 16:18423725-18423747 ATTCCCTTTGAGGAGGAAACTGG - Intronic
1134967885 16:18506324-18506346 ATTCCCTTTGAGGAGGAAACTGG - Intronic
1135144223 16:19947682-19947704 ATCCCCTTGCAGAGGGAAAAAGG - Intergenic
1135866484 16:26107119-26107141 ATTACCTTCTAGCATGAAAAGGG + Intronic
1136296478 16:29306823-29306845 ATTCCCTACTGGGGGGAAAAAGG - Intergenic
1138869645 16:60866896-60866918 CATACCTTCTAAAAGGAAAACGG - Intergenic
1141496028 16:84410198-84410220 ATTCCATTTCAGAAGAAAAAAGG + Intronic
1142245310 16:88967615-88967637 ATTCCTTTCTATAAAGAAGAGGG + Intronic
1143464545 17:7127263-7127285 GGTCCCTACAAGAAGGAAAAAGG + Intergenic
1144110202 17:12023052-12023074 AACCCATTTTAGAAGGAAAAAGG + Intronic
1144365098 17:14536158-14536180 ATTACCTTTTATAAGAAAAAGGG - Intergenic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1146326540 17:31891037-31891059 TTTCCCATGTAGAAGGACAAAGG - Intronic
1146398158 17:32484960-32484982 CTTTCCTTTGAGAAGGAAAAGGG + Intergenic
1148486914 17:47996502-47996524 CTTCTCCTCCAGAAGGAAAATGG - Intergenic
1150630449 17:66876891-66876913 TTTCCCATCTAGAAGAACAAAGG - Intronic
1152731474 17:81973656-81973678 AATCCCTTTTACAAGGAAATGGG - Intergenic
1153886599 18:9473701-9473723 TTCCCCTTATAGGAGGAAAACGG + Intergenic
1155988016 18:32251322-32251344 ATTCCCCTCTAGAAGGTGAATGG - Intronic
1156927390 18:42597838-42597860 CTTTACTTCAAGAAGGAAAATGG - Intergenic
1156937546 18:42728995-42729017 ATTAGCTTCTAGAAGGTAGAAGG + Intergenic
1158220893 18:55149712-55149734 TGTCCCATCTAGTAGGAAAAAGG + Intergenic
1158249690 18:55473824-55473846 ATTCCCTTGTAATTGGAAAAAGG + Intronic
1158877946 18:61751316-61751338 ATTTCCTTTTTGAAGGAATACGG + Intergenic
1159206792 18:65264006-65264028 TTTCACTTGTAGAAGGAAATTGG + Intergenic
1159391522 18:67799289-67799311 ATTGACTTCTATCAGGAAAAAGG - Intergenic
1159966083 18:74597602-74597624 CTTCCCTTAGAGAAGGAAAACGG - Intergenic
1160145851 18:76363777-76363799 AATACATTCTGGAAGGAAAATGG + Intronic
1160259468 18:77278830-77278852 TTTCCCTTAGATAAGGAAAAAGG + Intergenic
1160456059 18:79001511-79001533 ATTTCCTTCTTAAATGAAAAAGG - Intronic
1161611810 19:5247486-5247508 AAATCCTTCTAGCAGGAAAAGGG + Intronic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
925107369 2:1304052-1304074 AATATCTTCTAGAAGAAAAAAGG + Intronic
928224223 2:29433755-29433777 AGTCAATTCTGGAAGGAAAATGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930267632 2:49218473-49218495 CTTCCCTTTCTGAAGGAAAATGG + Intergenic
931061805 2:58537771-58537793 TTTCCCTCCTAGAAGCCAAAAGG + Intergenic
931418942 2:62107959-62107981 ATTCCTTTTGAGAAGGAATAGGG - Intronic
932027976 2:68155183-68155205 ATTCCTTTTTCGAAGAAAAATGG - Intronic
932476381 2:72008912-72008934 GTTAACTTCTAGAAGGAAATAGG - Intergenic
932584461 2:73017858-73017880 ATTTCCCTCTAAAAGGAAATAGG + Intronic
932821410 2:74904735-74904757 ATTCCCTTTAAGATTGAAAATGG - Intergenic
933873475 2:86594047-86594069 ATTCCCTTATAAAAGGTTAATGG - Intronic
934049840 2:88200823-88200845 TTTCCCTTGGAGAAGGAAAGAGG - Intergenic
934483216 2:94673308-94673330 AATCCCCTCTAAAAAGAAAATGG + Intergenic
934616022 2:95771606-95771628 ACCCCCTTCAAGAAGGAAATCGG - Intergenic
934644876 2:96052956-96052978 ACCCCCTTCAAGAAGGAAATCGG + Intergenic
934838285 2:97609045-97609067 AGCCCCTTCAAGAAGGAAATCGG + Intergenic
935069093 2:99677738-99677760 TTTCCCTTTCAGAAAGAAAAAGG - Intronic
935692379 2:105743768-105743790 CTTCCCTTCTGGAAGGAAGCAGG + Intergenic
936501706 2:113072084-113072106 ATTCTGTTCCAGATGGAAAATGG - Intronic
936784792 2:116081603-116081625 ATTCCATGATAGAAGGAACATGG + Intergenic
937177936 2:119960792-119960814 ATTTCCATCTAAAAAGAAAAGGG - Exonic
938670256 2:133579769-133579791 ATTTCCTTATTTAAGGAAAAAGG - Intergenic
938930548 2:136082892-136082914 ATTCCATTTTCCAAGGAAAAAGG - Intergenic
942422702 2:175824302-175824324 ACTCCATTCTAGAAAGCAAAGGG + Intergenic
942683940 2:178511073-178511095 ATTCTCTTCTAGAGGGGAAGTGG + Exonic
942795252 2:179810826-179810848 CTTTCATTCAAGAAGGAAAATGG + Intronic
943037698 2:182767080-182767102 ATTCCCTTCTATGGGGAATAAGG - Intronic
943618051 2:190116315-190116337 ATTCCCTGCCAGAAAGCAAAGGG + Intronic
943678338 2:190740293-190740315 ACTTCCTACTAGAAGTAAAATGG - Intergenic
943744704 2:191449518-191449540 ATTCCCTACTTGAAGGAACCAGG - Intergenic
943833930 2:192495106-192495128 ATTTCCATCTAGAAGGGGAAAGG - Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944376331 2:199048050-199048072 ATTCCCTGTTAGAAGGATACTGG + Intergenic
944538275 2:200732570-200732592 ATTCCCCTTTAGAATGGAAAAGG + Intergenic
945483080 2:210364853-210364875 ATTTAATTCAAGAAGGAAAATGG - Intergenic
945557804 2:211300856-211300878 ATCCCATTCTAAAAGAAAAAGGG - Intergenic
945718402 2:213387113-213387135 TTTCCCTTCTACAACAAAAAAGG - Intronic
945767215 2:213995926-213995948 ATTCCCTTGGAGTAGGAAAGGGG - Intronic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1169466554 20:5846233-5846255 AATCTCCTCTTGAAGGAAAAAGG + Intronic
1169527697 20:6448084-6448106 ATTGACTTCTAAAGGGAAAATGG + Intergenic
1170734289 20:19000636-19000658 ATTCTTTTCCAGATGGAAAATGG + Intergenic
1171429848 20:25076061-25076083 ATTTCATTCTAGAATGGAAACGG - Exonic
1172597938 20:36163229-36163251 CTTCCCTTGGAGAAGGAAATAGG - Intronic
1173283969 20:41654115-41654137 ATTCCATTGTAGAGGCAAAATGG - Intergenic
1174174795 20:48637745-48637767 CTTCCCATCTGGAAGGAGAAGGG + Exonic
1174432162 20:50478361-50478383 ATGCCCTTCGAGGAGGATAAGGG - Intergenic
1176581747 21:8535741-8535763 ATTCAATAGTAGAAGGAAAACGG + Intergenic
1177577695 21:22980245-22980267 ATAACCATCTAGAAAGAAAAAGG + Intergenic
1177607787 21:23404398-23404420 ATTCCCTCCAAAAAGGAAAAGGG + Intergenic
1177842131 21:26246394-26246416 ATTCCCTTTTAGCATGTAAAAGG - Intergenic
1178096355 21:29219803-29219825 ATAATCTTCAAGAAGGAAAAAGG - Intronic
1178473987 21:32920349-32920371 AGTCCTTTCTAGAATGGAAAAGG - Intergenic
1179027993 21:37695784-37695806 ATTCCCTAGTAAAAGGAACAAGG + Intronic
1179536639 21:42057059-42057081 TTTCCATCCCAGAAGGAAAAAGG - Intergenic
1180264582 22:10512813-10512835 ATTCAATAGTAGAAGGAAAACGG + Intergenic
1184500346 22:44867848-44867870 CCTCTCTCCTAGAAGGAAAATGG - Intergenic
1185363752 22:50424939-50424961 ATTCTTTTGAAGAAGGAAAAGGG - Intronic
1203335798 22_KI270739v1_random:71422-71444 ATTCCCTTTTCCAAGGAAATCGG - Intergenic
949542527 3:5044897-5044919 ATTCTCCTCCAGAAGGAACACGG + Intergenic
949752219 3:7367152-7367174 ATTCCCATCTAGAAAGAATATGG - Intronic
949805479 3:7951134-7951156 ACGCCCTTCCAGAGGGAAAAGGG - Intergenic
951112750 3:18824088-18824110 TTTCCCTTTTAGAATGGAAATGG - Intergenic
951165152 3:19476747-19476769 ATATCATTCTAGAAGGAAAAAGG - Intronic
952596861 3:35028508-35028530 ATTCCATTTTAAAAGGGAAATGG - Intergenic
953585923 3:44201019-44201041 AATCCCCTCTTGGAGGAAAAAGG - Intergenic
953597835 3:44335047-44335069 ATCCCATTCTAGATGAAAAAGGG - Intergenic
953846388 3:46430397-46430419 AATCCCTGGAAGAAGGAAAATGG + Intergenic
954934798 3:54316818-54316840 ATTCCCTTCTAGAAGTCTATTGG + Intronic
955238209 3:57158455-57158477 ATTCTCTTCTAAAACGGAAATGG - Intronic
956891811 3:73621455-73621477 ATTCTCTTCTAAAAGGCAGAAGG - Intronic
957038187 3:75314195-75314217 GTTCCCTGCTACAAGTAAAAGGG - Intergenic
959453504 3:106531903-106531925 ATTCAGTTTTAAAAGGAAAACGG + Intergenic
960114574 3:113880257-113880279 ATTTGCCTCTAGAAAGAAAATGG - Intronic
962684989 3:137838650-137838672 ATTCCCTTCTAGAGGCAATTTGG + Intergenic
963622490 3:147629091-147629113 ATGGCCTTCTAGATGGAAGAGGG - Intergenic
963633914 3:147769100-147769122 ATTCCCTTGTAGAAGTAGAAAGG - Intergenic
963922453 3:150918910-150918932 ATTTCCTTCTATAACCAAAAAGG - Intronic
964086562 3:152826340-152826362 CTTTCCTTCTACAAGGAAAATGG + Intergenic
964517128 3:157523507-157523529 ATTCTTTTCCAGAACGAAAAAGG - Intronic
964630513 3:158804915-158804937 CTTTCATTCTAGAATGAAAAGGG - Intronic
964697702 3:159528409-159528431 CTTCCCTTCGTGAAGGAAAAAGG + Intronic
965354843 3:167661247-167661269 ACTCTATTCTAGAAGGAAAGTGG + Intergenic
966921072 3:184611728-184611750 ATTCTGTCCTAGAAGGAAATTGG + Intronic
967025495 3:185560800-185560822 ATTCCCTTCTATGGGGAATAAGG + Intergenic
967287439 3:187886975-187886997 AATCTCTTCTAGAAGATAAAAGG - Intergenic
968556263 4:1247900-1247922 ATTCCCTTCCAGTGGGGAAAAGG - Intronic
969216734 4:5729140-5729162 CTTCCTTGCCAGAAGGAAAATGG - Intronic
969624897 4:8297458-8297480 TCTCCCTGCTAGAAGGAAAGCGG - Intronic
970336998 4:15058275-15058297 GTTCTCTTGTAGAAGGTAAATGG + Intronic
970367307 4:15372912-15372934 ATACACTCCTAAAAGGAAAAGGG + Intronic
970387224 4:15567954-15567976 ACTCCCTTCAAGAATAAAAATGG + Intronic
972702532 4:41507975-41507997 ATTCTCTTCTACCAGGAAAGAGG + Intronic
973307823 4:48672842-48672864 GTTCCCTTCTAAAAAGAAAGTGG + Intronic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG + Intergenic
974922965 4:68265011-68265033 ATTCCCTTGTAAAAGGGAAGGGG + Intergenic
975132455 4:70842621-70842643 CTCCCTTTCAAGAAGGAAAATGG + Intergenic
975469741 4:74751979-74752001 AATCCTTTCTTAAAGGAAAATGG - Intronic
975630567 4:76397857-76397879 ATTCCCTCCTAAAAGGAACAAGG + Intronic
975754022 4:77553705-77553727 CTTCATTTCAAGAAGGAAAATGG - Intronic
975891245 4:79030697-79030719 AGTATCTTCTAGAAAGAAAAGGG - Intergenic
977832193 4:101607758-101607780 ATTCCATTTTAAAAGGCAAATGG + Intronic
978260374 4:106749806-106749828 GTTCTTTTCTAGAAGGAAACAGG - Intergenic
978425843 4:108581446-108581468 ATTGCCTTCGAGAAAGGAAATGG - Intergenic
978488295 4:109281586-109281608 AGTCCCTTCTAGAAGGCACCTGG + Intronic
979293478 4:119003832-119003854 ATACCTTTCTAGGAGGAGAATGG - Intronic
979773836 4:124562769-124562791 GTTCCCTTATAAAAGGAAAAGGG + Intergenic
979997470 4:127448942-127448964 AGTTCTTTCTAGAAGCAAAAAGG - Intergenic
980330722 4:131408215-131408237 ATGCCCTGCTAGAGGGACAAGGG - Intergenic
980566771 4:134552635-134552657 ATTCCCTTCTGAAATGAAAGGGG + Intergenic
983931172 4:173454727-173454749 ATACCCTTCTGGCAGGATAAGGG + Intergenic
984184128 4:176521570-176521592 ATACCTTCCTAGAGGGAAAAGGG + Intergenic
984219998 4:176963290-176963312 ATTGCCAGCTGGAAGGAAAATGG + Intergenic
984230508 4:177092357-177092379 ATACCTTTCTAGGAAGAAAAAGG + Intergenic
986582619 5:9281216-9281238 ATTCTGTGCTAGAGGGAAAATGG - Intronic
988173015 5:27683348-27683370 ATTCAGTTCTAAAAGGGAAATGG - Intergenic
988374081 5:30410644-30410666 ATTCCCTATTAGAAGGAATGCGG + Intergenic
988899146 5:35712833-35712855 AATCTCTTCAGGAAGGAAAAGGG + Exonic
991290877 5:65032955-65032977 ACTCCCTTCTGGAAGTAAACAGG + Intergenic
992419413 5:76587175-76587197 ATTCTCATATAAAAGGAAAAAGG + Intronic
993480536 5:88419002-88419024 ATTCCCATCTCTAAGGGAAAAGG - Intergenic
993651507 5:90528708-90528730 ATTCTCTTAGAGCAGGAAAAAGG + Intronic
994028216 5:95109865-95109887 TATCCCTTCTAAAAGGAAATGGG - Intronic
994301851 5:98157114-98157136 ATTCCCTGCTAGGGGGACAAGGG - Intergenic
995044611 5:107631735-107631757 ATTTTCTCCTAGAAAGAAAATGG + Intronic
996739664 5:126787334-126787356 ATTTGCTTCTAAATGGAAAATGG + Intronic
996740492 5:126794308-126794330 CTTCCCTTCCAAAGGGAAAAAGG - Intronic
997007670 5:129837943-129837965 AATCCCTTCTGGATGGCAAAAGG - Intergenic
997285972 5:132678893-132678915 ATTCCCTTCTCTAAGGCTAAGGG + Intronic
998248978 5:140536603-140536625 ATTTCCTTATAGAAACAAAAAGG + Intronic
998425611 5:142025692-142025714 ATGCCCTTCCAGAAAGACAAAGG - Intergenic
1000147729 5:158469537-158469559 ATCCTCTTCTATAAGGACAAGGG - Intergenic
1000285504 5:159823004-159823026 GTTCCCTACTAGAAGGTAAGTGG - Intergenic
1000492219 5:161927688-161927710 ATTAACCTGTAGAAGGAAAAAGG + Intergenic
1000953680 5:167516436-167516458 ATTCCATTAGAGATGGAAAAAGG - Intronic
1001117449 5:168951704-168951726 GTTCCCTTCTAGAAGGAGTAGGG - Intronic
1003713021 6:8614544-8614566 ATTCCCTTCTAGAAGGTGTAGGG - Intergenic
1003736163 6:8879804-8879826 ATCCCCTTCTTGAGGGAACAGGG + Intergenic
1004509468 6:16273600-16273622 ATTCCCATCTAGACAGGAAAGGG - Intronic
1005188441 6:23190133-23190155 ATTCCTTTGTGTAAGGAAAAAGG - Intergenic
1005426629 6:25709805-25709827 ATTCCCTGCGAGAAAGACAAGGG - Intergenic
1005669242 6:28088195-28088217 ATACATTTCTAGAGGGAAAATGG - Intronic
1006273411 6:32981722-32981744 ATTGCCTTTTAAAAGGAAATTGG + Intergenic
1007898978 6:45392530-45392552 TTTCCCTTTAAGAAGTAAAAGGG - Intronic
1008018899 6:46553429-46553451 ATTCCTTTCTAGAAAAATAAGGG + Intronic
1008651400 6:53567080-53567102 ATGCCCTACTCGAAGGGAAATGG - Intronic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1009830274 6:68921199-68921221 ATTCCCTATTAAAAGGAAGAGGG + Intronic
1009935578 6:70231002-70231024 ATTCCCTTTCAGTAGGAAAATGG + Intronic
1010132544 6:72511634-72511656 ATTCCATGATGGAAGGAAAAGGG - Intergenic
1010974051 6:82293167-82293189 AGAACCTTCAAGAAGGAAAAGGG + Intergenic
1011014839 6:82743500-82743522 AATCCCTCCTATATGGAAAAAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014323868 6:119966747-119966769 ATGCCCTGCAAGAAGGACAAGGG + Intergenic
1015117763 6:129668261-129668283 ATACCCTTCTTCAATGAAAAAGG - Intronic
1015569614 6:134607421-134607443 ATTCCCATCTAGAAAGATACTGG - Intergenic
1016316893 6:142799811-142799833 ATTCCCTGCTAGACTGCAAAGGG - Intronic
1016493309 6:144631123-144631145 ATTCCCTTCTAGTATGAGGATGG + Intronic
1016514578 6:144880154-144880176 ATTCCCCTTAAGAAGGAAATTGG + Intergenic
1016614696 6:146032343-146032365 ATTCCCTTTGAGAAGAAACAAGG - Intronic
1017571949 6:155754541-155754563 TTTTCCTTTTAGAAGGATAATGG + Intergenic
1018253723 6:161897459-161897481 CTTCTCTTACAGAAGGAAAATGG - Intronic
1019460786 7:1157651-1157673 ATTACCTTCTGGAATGCAAACGG + Exonic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020489328 7:8759695-8759717 ATTCCATTCCAGAAGGCGAAGGG - Intergenic
1024907211 7:54399620-54399642 ATTGCTTTCAAGAATGAAAATGG + Intergenic
1024984734 7:55185222-55185244 CTTGCCATCTACAAGGAAAATGG + Intronic
1030794354 7:113769920-113769942 ATGCCCTACTAGGAGGACAAGGG - Intergenic
1032507339 7:132445584-132445606 ATTCACTTCTAGATAGATAATGG + Intronic
1033007589 7:137584302-137584324 ATTCAATCATAGAAGGAAAATGG + Intronic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034025384 7:147697843-147697865 TCTCCCTACTAGAAGCAAAAGGG + Intronic
1035482069 7:159195191-159195213 AATCACTTCTAACAGGAAAATGG + Intergenic
1037292247 8:17363597-17363619 TTTCCCTTTTTTAAGGAAAAGGG + Intronic
1037389083 8:18374106-18374128 AACCCCTTCTAGAAAGAAGATGG + Intergenic
1039830156 8:41207028-41207050 ACCACCTGCTAGAAGGAAAAGGG + Intergenic
1041002070 8:53463233-53463255 ATTGCCTTTGATAAGGAAAAGGG - Intergenic
1041422820 8:57688434-57688456 ATTGCCTTGTATATGGAAAATGG + Intergenic
1042186717 8:66143025-66143047 ATTCCCTTCAATAAGCAAACAGG - Intronic
1042337660 8:67645468-67645490 ATTCAATTTAAGAAGGAAAAGGG + Intronic
1042662974 8:71176172-71176194 ATTCTTTTCTACTAGGAAAAAGG + Intergenic
1043424841 8:80138378-80138400 ATGCCCTCTTAGGAGGAAAATGG + Intronic
1043602285 8:81955090-81955112 ATTTCCTTCTATCAGAAAAAGGG + Intergenic
1043655842 8:82663761-82663783 CTTTCATTCAAGAAGGAAAATGG - Intergenic
1044308782 8:90668009-90668031 ATTCACTTCGAGAAGCAAAATGG - Intronic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1047586678 8:126281035-126281057 ATTCCCTACTAAAAGGAATTGGG + Intergenic
1047789834 8:128191624-128191646 ATTCCCATCTGGAAGGAAAAAGG + Intergenic
1048389198 8:133945165-133945187 ATTCCATTCAGGAAGGAAGAAGG - Intergenic
1048578679 8:135713019-135713041 ATTCTCTTCTAAAAGGAATCAGG - Intergenic
1049021203 8:139958785-139958807 TTTCCTTTCCACAAGGAAAAGGG + Intronic
1051210236 9:14734281-14734303 TTTCCCTTCAATTAGGAAAAGGG + Intergenic
1051512816 9:17898165-17898187 ATTTCCTTTTAGAAAAAAAATGG - Intergenic
1052705460 9:31989028-31989050 ATTCCGTTTTAAAAGGGAAACGG - Intergenic
1056123600 9:83513276-83513298 ATTGTTTTCTGGAAGGAAAAAGG + Intronic
1056201939 9:84285496-84285518 ACTCCCATCATGAAGGAAAAGGG + Exonic
1056959058 9:91105765-91105787 ATTCCCTTTGGGAAGAAAAAAGG - Intergenic
1058914197 9:109549934-109549956 ATACTTTTCTAGAAAGAAAAGGG + Intergenic
1058936103 9:109771225-109771247 AGTCCCTTTGGGAAGGAAAAGGG - Intronic
1059527885 9:115009046-115009068 TTTCCATGATAGAAGGAAAATGG + Intergenic
1059587326 9:115620118-115620140 ATTCCATTTTATAAGGGAAACGG - Intergenic
1060000701 9:119956008-119956030 ATTGTCTTCTAGAAGGCACAAGG + Intergenic
1060140443 9:121205081-121205103 ATTCCCTGCTAGAAGGTAGCTGG - Intronic
1203611766 Un_KI270749v1:13778-13800 ATTCAATAGTAGAAGGAAAACGG + Intergenic
1187256343 X:17646243-17646265 ATTCACTTCTAAAAGGAGAAAGG - Intronic
1187556307 X:20355553-20355575 AATCCCTTGTAGAACGAAACTGG - Intergenic
1187595533 X:20767797-20767819 ATTCCCTGCTTGAAAGAAAGAGG + Intergenic
1188640468 X:32495642-32495664 AAACCTTTCTAGAATGAAAAAGG + Intronic
1188816949 X:34727181-34727203 TTTTTCTTCTAGAAAGAAAAGGG + Intergenic
1188840786 X:35014603-35014625 ATTCTCTTCTATTAGGAAAAGGG - Intergenic
1189383948 X:40521563-40521585 TTTCCCTTCCAGAAGGCCAAAGG + Intergenic
1189693001 X:43636452-43636474 ATTCCATTCAAGAAGAAAAAGGG - Intergenic
1190036014 X:47024606-47024628 ATTCCTTTCTAGAAAGCAAATGG - Intronic
1190087255 X:47406231-47406253 ATTCGCTTATTAAAGGAAAAAGG - Intronic
1192295560 X:69844075-69844097 ACTCCCTTGAAGAAGAAAAAAGG + Intronic
1192606219 X:72521468-72521490 ATTCCCTACTAAAAGGAACCAGG + Intronic
1194300526 X:92181352-92181374 ATTCAGTTTTAAAAGGAAAATGG + Intronic
1194487673 X:94505679-94505701 ATTTCATTCAAGAAGGAAAATGG + Intergenic
1194867100 X:99082703-99082725 TTTGCATTCTAGAAGGTAAAGGG - Intergenic
1195057054 X:101156395-101156417 ATTCCCATCTGGAAGGTGAAAGG + Intronic
1197729307 X:129796233-129796255 ATTAAATTCTAGAAGGGAAATGG - Intergenic
1197776630 X:130122340-130122362 ATGCCCCTCTGGAAGGAAAGGGG - Intergenic
1198038273 X:132822868-132822890 ATTCTCGTCTGGAAGGAACAGGG + Intronic
1198252520 X:134894322-134894344 ACTCACTTTTAGCAGGAAAATGG - Intronic
1198407140 X:136324842-136324864 ATTCCCCACTAAAAGGAAGAGGG - Intronic
1198756639 X:139988906-139988928 ATACTCTTTTGGAAGGAAAAAGG - Intergenic
1198968399 X:142251522-142251544 CTTCAATTCAAGAAGGAAAATGG - Intergenic
1199380495 X:147166683-147166705 ATTCACTGATAGTAGGAAAAGGG - Intergenic
1199539120 X:148938756-148938778 ACTCCATTCTAGAATGAACAAGG - Intronic
1199734648 X:150674037-150674059 ATTCCCTCCAAGAAAGCAAAAGG - Intergenic
1200240907 X:154493085-154493107 GTGTCCTTCTTGAAGGAAAAGGG + Intergenic
1201524813 Y:14920353-14920375 ATGCCCTTTGAGAAGGGAAAAGG - Intergenic