ID: 948883607

View in Genome Browser
Species Human (GRCh38)
Location 2:240872440-240872462
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 2, 1: 4, 2: 8, 3: 67, 4: 586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900034601 1:396511-396533 GTGAACCTGCAGGATTAGGAGGG - Intergenic
900055432 1:626399-626421 GTGAACCTGCAGGATTAGGAGGG - Intergenic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900851986 1:5151145-5151167 GTGAACATGCAGGCTTAGTAGGG + Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901234243 1:7659060-7659082 GTGAAGATGCAGGAGGCAGAGGG + Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902404764 1:16176572-16176594 GGGAGCTTGGAGGAGGAGGATGG - Intergenic
902862433 1:19256052-19256074 GTGAGCGGGCAGGGGGAGGAAGG + Intronic
903473160 1:23601383-23601405 GTAGACGTGCAGGAGGAGGCTGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905802079 1:40850787-40850809 GTGGACATCTAGGAGGAAGAGGG - Intergenic
906035674 1:42748971-42748993 GGGAAGGTGCAGGAGGTGGATGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906415360 1:45617574-45617596 GAAAACATGGAGGAGGAGGTGGG + Exonic
909374571 1:74924616-74924638 GTGCACCTGCAGGAGGTGGCTGG - Intergenic
909439007 1:75677012-75677034 GTGAACATGAAGGAGAATTAAGG + Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
912260823 1:108110503-108110525 GTGAAGATGGAGCAGGAGCAAGG + Intergenic
912670591 1:111620362-111620384 GGGGACATGCAAGAGGAGGAAGG - Intronic
913564111 1:120054224-120054246 CTGAGCATGCAGGTGAAGGACGG + Intronic
914375569 1:147070861-147070883 GTGTCCATATAGGAGGAGGAAGG - Intergenic
915092690 1:153437551-153437573 GTCAACATGTAAGAGAAGGAAGG - Intronic
915147240 1:153802413-153802435 GGGAGCATGGAGCAGGAGGAGGG + Intergenic
915316729 1:155033027-155033049 TAGAACATGCAGGATGAGGGGGG + Intronic
916087214 1:161280160-161280182 GTCATCATCCAAGAGGAGGAGGG - Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917023840 1:170619810-170619832 GTGAGCATGCTGGAGGCAGAAGG - Intergenic
917085020 1:171296545-171296567 TTAAACATGCAGGAGAAGGTGGG + Intergenic
918076838 1:181177003-181177025 GTGAATATGGAGGTGGAGGTGGG + Intergenic
918401243 1:184164674-184164696 GTGAGCATGCAGAGGGAGTAGGG + Intergenic
919203316 1:194387785-194387807 GGGAACTAGCTGGAGGAGGAAGG - Intergenic
919792976 1:201304210-201304232 GTGGCCAGGAAGGAGGAGGAGGG - Intronic
920244189 1:204575757-204575779 TTAAACATTCAGTAGGAGGATGG + Intergenic
920400524 1:205673307-205673329 ATGAACATGGAGGGGGAAGAGGG + Intronic
920536256 1:206738518-206738540 GTGAACCTGTTGGAGAAGGAAGG - Intergenic
921458717 1:215403760-215403782 GTGAAGATACAGGAAGAAGATGG - Intergenic
922256958 1:223900716-223900738 GTGAACCTGCAGGATTAGGAGGG - Intergenic
922602801 1:226870288-226870310 GAGAACAACCGGGAGGAGGAGGG + Intronic
922724989 1:227918461-227918483 GGGACCAGGGAGGAGGAGGAAGG - Intergenic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
922998447 1:229985404-229985426 TTGAACATGGTGGAGGGGGAGGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923749321 1:236732789-236732811 GTGGTCATGCTGGAGTAGGATGG - Intronic
923766913 1:236901052-236901074 GAGAATCTGGAGGAGGAGGAGGG + Exonic
924338152 1:243003529-243003551 GTGAACCTGCAGGATTAGGAGGG - Intergenic
924548764 1:245054562-245054584 GTGAACATCCAGGAGAGGGCCGG - Intronic
924791520 1:247254688-247254710 GTAGACATGAAGTAGGAGGAAGG - Intergenic
1063029949 10:2224882-2224904 GTGGACATGGAGGAAGAGGGCGG - Intergenic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063964569 10:11337032-11337054 TTGATCATGCAGGATGAGAAGGG + Intergenic
1064941616 10:20741762-20741784 GGGAGCTTGCATGAGGAGGATGG - Intergenic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1065338354 10:24678420-24678442 GGGGACATGTAGGAGGTGGAGGG - Intronic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1067960139 10:50838960-50838982 GTGATGATGGAGGAGGAGAAGGG - Intronic
1068213561 10:53952964-53952986 TTGAGCATGCAGCAGGAGGGGGG + Intronic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1070389416 10:75956302-75956324 GAGAACAAGCTGGAGGATGAGGG + Intronic
1070421159 10:76238556-76238578 GTGGGCATGCAGGAGGGGAAGGG + Intronic
1070667747 10:78357335-78357357 GTGAAAATGCCGGAGGAGGTGGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070843299 10:79502896-79502918 GTGAGCCGGCAGGAGGTGGAGGG - Intergenic
1070930362 10:80256692-80256714 GTGAGCCTGCAGGAGGTGGAGGG + Intergenic
1071363317 10:84873409-84873431 GTGCACATGCAAGAGGAGCCAGG + Intergenic
1072230494 10:93410288-93410310 GTGACAAACCAGGAGGAGGAAGG - Intronic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1072758698 10:98038418-98038440 GGGCACAGGCAGCAGGAGGAGGG + Intergenic
1072791477 10:98321247-98321269 GTGAACATGCGGGAGAATGTAGG + Intergenic
1072960316 10:99923458-99923480 GTTACAGTGCAGGAGGAGGAAGG - Intronic
1073703793 10:105959603-105959625 GTGTGCATGCAGGGGGAGGGAGG - Intergenic
1074447391 10:113531665-113531687 GTGAAACTGCAGCAGGAGGATGG - Intergenic
1074510825 10:114110427-114110449 GTGGACATGCAGTAGGAGCCTGG + Intergenic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1075173129 10:120134373-120134395 CTGAACATGCAGCAGGGGCATGG + Intergenic
1075555602 10:123429281-123429303 ATGAGCTTCCAGGAGGAGGACGG + Intergenic
1075954443 10:126510008-126510030 GTAAAGATGCAGGAAGAAGATGG - Intronic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076343154 10:129763906-129763928 GGGAACATGCAGGTGGCGGAGGG - Intronic
1076942858 10:133621420-133621442 GTCACCATGCAGGATGAGAAAGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077020202 11:413919-413941 GAGAAGGTGCAGGAGGAGGCAGG - Intronic
1077089172 11:770681-770703 GAGAACATGCAGGAGGATGGGGG + Exonic
1077159352 11:1105650-1105672 GTGGACACCCAGGAGGAGGCAGG - Intergenic
1077202668 11:1319379-1319401 GAAAACTTTCAGGAGGAGGAGGG + Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078580548 11:12536415-12536437 GTCAAGATGCTGGAGAAGGAGGG - Intergenic
1079170818 11:18093786-18093808 ATCAAGATGCAAGAGGAGGAGGG + Intronic
1079494287 11:21023756-21023778 GTGCACATGCAGGTGGGGGCTGG - Intronic
1080277357 11:30517616-30517638 AGAAACATGCAGGATGAGGAAGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080825957 11:35849643-35849665 GTGAAGATGCAGGGAGAAGATGG - Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1081482673 11:43504229-43504251 GAGAACAGAAAGGAGGAGGAAGG - Intergenic
1081867234 11:46366596-46366618 GTGGGCATGAATGAGGAGGAGGG + Exonic
1082082470 11:48022871-48022893 GGGAAGATGCAGGAGGAAGTAGG + Intronic
1083088653 11:60176877-60176899 GTGAACATGCAGGAAGCTCAAGG - Intronic
1083103665 11:60336445-60336467 GTGAACATGCAGGAAGCTCAAGG + Intronic
1083637413 11:64128107-64128129 GTGAGGATGGAGGAGGAGGGTGG - Intronic
1084128109 11:67114414-67114436 ATGAACATGGAGGAGGGGGTGGG + Intergenic
1084185107 11:67467409-67467431 GTGAATGTGAAGGAGGTGGAGGG + Intronic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084411904 11:69010391-69010413 GGGAACCTGCTGGAGGAGGAGGG + Intronic
1084935830 11:72586176-72586198 GTGAACCTGGAGGAGGGGGTGGG + Exonic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1088689696 11:112315226-112315248 ATGAACATAGAGGAGGAGGCAGG + Intergenic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1089871198 11:121673825-121673847 GTGAAAAGGCAAGAGGAGCAAGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090477892 11:127040120-127040142 GTGAACATGCAGGGAGTGGGTGG - Intergenic
1090993895 11:131847491-131847513 GCCAACCTGCAGGAGGAGGCAGG + Intronic
1092231802 12:6779928-6779950 GTGAAACTGCTGGAGCAGGAGGG + Intergenic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1094083594 12:26564665-26564687 GTGAAGATGGAGGAAGAGAATGG + Intronic
1095875030 12:47070880-47070902 CTGAAAATGCAGGAGATGGAAGG - Intergenic
1096248014 12:50006384-50006406 GTGATGATGCAGGAGGGGGAAGG - Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098033824 12:66281906-66281928 AGGAACATTCAGGAGGAGCAGGG - Intergenic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099868957 12:88322107-88322129 ATAAACATCCATGAGGAGGATGG + Intergenic
1101016918 12:100511261-100511283 GTGAGGATGTAGGAGGAGGTAGG - Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102563742 12:113780982-113781004 GTGCATATGCAGGGGAAGGAAGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102916999 12:116761523-116761545 GAGGACATGCAGGAGGATGGTGG - Intronic
1103590771 12:121990493-121990515 GGAAACAAGCATGAGGAGGAGGG - Intronic
1103628996 12:122244060-122244082 GTGAACGGGCAAGAGGAGGCAGG + Intronic
1103981932 12:124742354-124742376 GTGAACAGGCAGCCGCAGGAAGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104792138 12:131489996-131490018 GTGAGGATGCAGTTGGAGGAAGG + Intergenic
1105981203 13:25518241-25518263 GTGACCATTTGGGAGGAGGAAGG + Intronic
1106265800 13:28108623-28108645 GTGAACATGAAGGCAGAGGTCGG - Intergenic
1107423084 13:40267936-40267958 GTGAACATGGAGGAGGAAGTGGG + Intergenic
1110518010 13:76439369-76439391 GTAAACTTGTTGGAGGAGGAAGG - Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112704351 13:102049783-102049805 GTGAACATGAAGGAAGAGACTGG + Intronic
1113158554 13:107353066-107353088 GTGAACAGTCAGGAGGCAGAAGG - Intronic
1113378831 13:109785653-109785675 GAGAACGAGCAGGAGCAGGAGGG - Exonic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1113670480 13:112172281-112172303 GTGAAGATGCAGGCAGAGGTCGG - Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114084123 14:19226562-19226584 GGGAACATGCACAGGGAGGAGGG - Intergenic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114450058 14:22819581-22819603 GGGGAAGTGCAGGAGGAGGATGG - Intronic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1116802140 14:49454142-49454164 GTGAAGATGGGTGAGGAGGAAGG - Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117714420 14:58566083-58566105 TTGTTCATGCAGGAGGGGGAAGG + Intergenic
1118512374 14:66489623-66489645 GAGAAGATACAGGAGGAGGCAGG - Intergenic
1119227665 14:72956453-72956475 GTGCACATGCAGGGGCAGGTAGG - Exonic
1119649029 14:76370628-76370650 GAGAAAATGAAGGAGGAGAAGGG - Intronic
1119727549 14:76930973-76930995 GTGAAGATGGAGGCGGAGGTGGG - Intergenic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120625963 14:86827016-86827038 GGGAAGAGGCAGGAAGAGGAAGG + Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121662955 14:95649587-95649609 GGCACCATGCAGGAGGAGGCGGG + Intergenic
1123410967 15:20058757-20058779 GTGATCATCCAGGAGCAAGATGG - Intergenic
1123520297 15:21065445-21065467 GTGATCATCCAGGAGCAAGATGG - Intergenic
1123808239 15:23897272-23897294 GTGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123827766 15:24101092-24101114 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123842220 15:24260501-24260523 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123857247 15:24426563-24426585 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1124572015 15:30873231-30873253 GAGAACATGCTGGGGTAGGATGG - Intergenic
1124708871 15:31988454-31988476 GGGAACATCCAGCGGGAGGATGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125716636 15:41823272-41823294 ATGTACATGCTGGAGGAGGGAGG + Intronic
1125892347 15:43276054-43276076 GTGAGCCTGCAGGCAGAGGATGG - Intergenic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127965619 15:63920774-63920796 GAGAACAAGCAGGAGCAGCAGGG - Intronic
1128515218 15:68337795-68337817 GGGAACATGGAGGAGAGGGAAGG - Intronic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1129524746 15:76206611-76206633 GTGAGCCTGGAGGAGGAGGGTGG - Intronic
1129685987 15:77686381-77686403 GTGAACTTGCAGTAGGAGCTGGG - Intronic
1130102822 15:80906704-80906726 GTGGACATGCGGGCGGAGGTTGG + Exonic
1130288306 15:82573403-82573425 GTGAACATAGAGAAGCAGGAGGG - Intronic
1130865929 15:87933350-87933372 ATGAAAATGCTGGAGAAGGAAGG - Intronic
1131035607 15:89220051-89220073 GGTCACATGCAGGAGCAGGATGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131809220 15:96154993-96155015 GTGTATATGCAGGAGGGGAAGGG + Intergenic
1131852121 15:96554632-96554654 GTAAAAAGGAAGGAGGAGGAGGG - Intergenic
1132181487 15:99755974-99755996 GTGACATTGCAGGAGGAAGAGGG - Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132367175 15:101266092-101266114 GTGACCAGGCAGCAGGAGGGTGG + Intergenic
1132372749 15:101309559-101309581 CTGAACAGGCAGGAGGCTGATGG - Intronic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1133815419 16:9193860-9193882 GGAAACATGCAGATGGAGGAAGG - Intergenic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136367165 16:29814177-29814199 GTGAAGGGGCAGGGGGAGGAGGG - Intronic
1136461092 16:30410566-30410588 TGGCACATGGAGGAGGAGGAAGG + Intronic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1137510020 16:49090973-49090995 GTGAGCATTCAGATGGAGGAAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138431810 16:56973568-56973590 GTGCACACGCATGGGGAGGAGGG + Intronic
1138440984 16:57034883-57034905 GTGAACATGAAGGCAGATGATGG + Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139320377 16:66109573-66109595 CTGATCTTGCAGGAGGAAGAGGG - Intergenic
1140233036 16:73133572-73133594 GTGAACACTCTGGAGGAAGATGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141294175 16:82751393-82751415 GTGAGGAGGCAGGAGGAGGTGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1203141729 16_KI270728v1_random:1771501-1771523 GGGATGATGGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142946721 17:3435672-3435694 GTAAACCTGCAGGAGAAGCAGGG - Intergenic
1143315933 17:6033480-6033502 CTGAACCTGCAGGTGGGGGATGG + Intronic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144742185 17:17590161-17590183 GTGAAAATGCAGGAGCTGTAGGG + Intronic
1144873298 17:18383310-18383332 GTAAACCAGCTGGAGGAGGACGG + Exonic
1146616276 17:34359644-34359666 GTGGACATATAGGAAGAGGAGGG - Intergenic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147998688 17:44375437-44375459 GTGAACATGGAGGAGCATGCTGG - Intronic
1148077843 17:44949489-44949511 GAGAACATGCAGGGGGAAGCAGG + Intergenic
1148347299 17:46912079-46912101 GGGAAGCTGCAGGGGGAGGATGG - Intergenic
1148583561 17:48760645-48760667 GTGAACAGACAGGAGGTGGGTGG + Intergenic
1149959203 17:61088928-61088950 GTGTACATGCCTGAGGAAGATGG + Intronic
1150384839 17:64750571-64750593 GTGAGCCTGCAGGAGCAGGTTGG - Intergenic
1150701422 17:67450340-67450362 GTGCACCTTCAGGAGGAAGAGGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150983707 17:70171269-70171291 ATAAACATGAGGGAGGAGGAGGG - Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151747942 17:76021720-76021742 GTGAACCAGCTGGAGGACGACGG - Exonic
1152238767 17:79151415-79151437 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238783 17:79151453-79151475 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238799 17:79151491-79151513 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238814 17:79151526-79151548 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238829 17:79151561-79151583 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238845 17:79151599-79151621 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238860 17:79151634-79151656 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238877 17:79151672-79151694 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238892 17:79151707-79151729 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238907 17:79151742-79151764 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238937 17:79151815-79151837 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238954 17:79151853-79151875 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238969 17:79151888-79151910 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152533478 17:80936336-80936358 GTGAATATCCAGGAGTAGAATGG - Intronic
1155365283 18:25043472-25043494 GTGAGCCTGAAGGAGCAGGATGG - Intergenic
1155384750 18:25265535-25265557 GTGAGAATGAATGAGGAGGATGG - Intronic
1155592040 18:27438506-27438528 GTGAGCATGGAGGAGGCAGAAGG + Intergenic
1156489429 18:37487497-37487519 GTGACCAGGAGGGAGGAGGACGG - Intronic
1156656868 18:39298696-39298718 GGGAAGACGCAGGAGGAGCAAGG - Intergenic
1156959744 18:43011208-43011230 GTGATCAAGGAGGAGCAGGAAGG + Intronic
1157506542 18:48230595-48230617 TTGAACATGCTGGAAGGGGATGG + Intronic
1157618744 18:49003258-49003280 GGGAAAATGGAGGAGGGGGAAGG - Intergenic
1157693488 18:49702135-49702157 GTAAACACGTAGGAGTAGGATGG - Intergenic
1157772107 18:50358322-50358344 GTGAACAGGCAGGGAGAAGATGG - Intergenic
1158218958 18:55129993-55130015 GTGAAGATGGAGGTGGAGGTTGG + Intergenic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1158426511 18:57344888-57344910 GTAAAAATCCAGGAGGAGAAAGG + Intergenic
1158532745 18:58278353-58278375 GTGAAGAGGCAGGAGGGGCAGGG - Intronic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159463902 18:68754876-68754898 GTGAGCATGCAGGGAGAAGATGG + Intronic
1159633229 18:70773988-70774010 GAGTTCATGCAGGAGGAGAAAGG + Intergenic
1159731455 18:72033294-72033316 GGGACCATGCAGGAGGAGGAGGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160408360 18:78658669-78658691 GTGCCCCTGCAGCAGGAGGAAGG + Intergenic
1161227535 19:3154045-3154067 GTGGACAGGCAGGTGGATGATGG + Intronic
1161241522 19:3225899-3225921 GTGGACAGGGAGGAGGAGGGAGG + Intronic
1161244769 19:3243827-3243849 GTGAAGATGCAGGCGGAGATGGG - Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1164533465 19:29065571-29065593 GTGCACAGGCAGGCTGAGGAGGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1165069084 19:33245229-33245251 GGGGACATGTAGGAGGATGAAGG + Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165782779 19:38443601-38443623 GTGTGCATGCCGGAGCAGGATGG - Exonic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165986563 19:39774484-39774506 GGGAAAAGGCAGGAGGATGAGGG + Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167101379 19:47406256-47406278 GGATACATGGAGGAGGAGGATGG + Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1168583971 19:57578093-57578115 GGGAACCTGCGGGAAGAGGAAGG + Exonic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
927645339 2:24873686-24873708 GTGGTCTTGGAGGAGGAGGAAGG - Intronic
927645948 2:24877104-24877126 GGGGACATGGGGGAGGAGGAGGG - Intronic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
929183670 2:39070455-39070477 GTGAACATACAAGAGTAGAAGGG - Intronic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930292156 2:49508680-49508702 GTGAAGATGAAGGAAGAGCAAGG - Intergenic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
932072635 2:68636286-68636308 GTGAACATGCATGTTGAGAAAGG - Intergenic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933696991 2:85226992-85227014 GTGACCCTGCAGGATGGGGATGG + Intronic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934680141 2:96277867-96277889 GTGAGCCTGCAGGAGCAGGTTGG + Exonic
935043335 2:99455887-99455909 GTGAAAAAGCAGGTGGAGGGGGG - Intronic
936355051 2:111742534-111742556 GATAGCATGCAGGAGGAGAAAGG + Intergenic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937524292 2:122748227-122748249 GTGAACATGCAGGTGAGAGAAGG - Intergenic
938364215 2:130721154-130721176 GTGAACATCCAGGTAGACGATGG - Intergenic
938644766 2:133319161-133319183 TTGAAAATGCAGGGGGTGGAAGG - Intronic
939797000 2:146657326-146657348 GTGAAGATGCAGCAAGAAGAAGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940055524 2:149508980-149509002 GAGAATATGAAGGAGGAGTAAGG + Intergenic
940073471 2:149715473-149715495 GTGACCATGGAGGAGGAGGCTGG - Intergenic
940075447 2:149736536-149736558 GTAAAGATGCAGGGGAAGGAAGG + Intergenic
940567748 2:155389423-155389445 GTGAATATGTGGGAGGAGGAAGG + Intergenic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
942296719 2:174524623-174524645 GTGTACATGGAGGAGGGGAATGG - Intergenic
944841063 2:203624172-203624194 GTGAAGATGCAAGAAGAGGTTGG - Intergenic
945203810 2:207310717-207310739 GTGAGCATGCAGGAGGGGGAAGG - Intergenic
946088163 2:217195406-217195428 GTGATCATGGAGGAGGTGGGTGG - Intergenic
946664263 2:222032760-222032782 CTAAACATCCAGGGGGAGGAGGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947606364 2:231488591-231488613 GTGAGTATGCGGGAGCAGGAAGG + Intergenic
947629716 2:231644269-231644291 GAGAACATGAAGCAGGATGAGGG - Intergenic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948041238 2:234903297-234903319 GTGAACATGAAGGCTGAGGTTGG + Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948383733 2:237568567-237568589 GTGAGCCTGCAGGAACAGGAAGG + Intergenic
948731705 2:239968258-239968280 GTGGCCATTCAGGAGGAGGGAGG + Intronic
948825166 2:240570516-240570538 TGGAACATGCAGGAAGAGAAGGG - Intronic
948883564 2:240872158-240872180 GTGAACATGGAGGCGGAGGAGGG + Intronic
948883569 2:240872190-240872212 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948883593 2:240872347-240872369 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883613 2:240872472-240872494 GTGAACATGGAGGCGGAGGAGGG + Intronic
948944429 2:241212297-241212319 GTGCTCAGGCAGGTGGAGGACGG + Intronic
1168837328 20:885905-885927 GTGAACATATAGGAGAAGGCTGG + Intronic
1169339172 20:4783054-4783076 GTGAAGGTGCATGGGGAGGATGG - Exonic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1170665347 20:18381563-18381585 GTGACCATGAGGGTGGAGGAGGG + Intergenic
1170782422 20:19437808-19437830 GGGAACAGGGTGGAGGAGGATGG - Intronic
1170939013 20:20833309-20833331 GAGAATATGCAGGGGGAGGCGGG - Intergenic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1171364770 20:24616392-24616414 GGGAGGATGCAGGTGGAGGAGGG - Intronic
1172834930 20:37867275-37867297 TTAAAAATGCAGGAGGAAGAGGG - Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173410126 20:42802733-42802755 CTGATCATGCAGGAGAAGGGAGG - Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1174629280 20:51942448-51942470 TTGAACATGGAGGCGGAGGTTGG - Intergenic
1175199742 20:57268704-57268726 GAGGACATGCAGGAGGGAGAAGG + Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1175863178 20:62160988-62161010 GGGCACATGCAGCAGGAGCACGG + Intronic
1177586094 21:23097765-23097787 GGGAACTTGCACAAGGAGGAGGG - Intergenic
1178370093 21:32020341-32020363 GTGAACTTGAAGGAGCAGGGAGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179489800 21:41734006-41734028 GGGTGCATGGAGGAGGAGGAAGG - Intergenic
1179732765 21:43376638-43376660 GGGAGCATGCAGGTGGAGTAGGG - Intergenic
1179803881 21:43825354-43825376 ATAAACATCCAGGAGGAGGAGGG - Intergenic
1180254021 21:46610233-46610255 GTGGACATGCAGAAGGAGCTGGG - Intergenic
1180293848 22:10866641-10866663 GGGAACATGCACAGGGAGGAGGG + Intergenic
1180496655 22:15896056-15896078 GGGAACATGCACAGGGAGGAGGG + Intergenic
1180592941 22:16956215-16956237 GTGAACAAGAAGGGGGAGAATGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1180988562 22:19919933-19919955 GTGAACATGCAGGGGCAGGTGGG - Intronic
1181112303 22:20609333-20609355 GTGAACCTGCAGGGGAAGGCAGG - Intergenic
1181962772 22:26634891-26634913 GTGAAGATTCAGGAAGAGGCTGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183372454 22:37441552-37441574 ATGAAAATGCAGGAGAAAGAGGG - Intergenic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1184632911 22:45799421-45799443 GAGATCATACTGGAGGAGGATGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949877262 3:8634441-8634463 ATGAAGATGCAAGGGGAGGAAGG - Intronic
950136041 3:10581568-10581590 GTCCACAGGCAGGAGGAGAAGGG + Intronic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
951519687 3:23599718-23599740 GTCCACAGGCAAGAGGAGGATGG + Intergenic
952239811 3:31519519-31519541 GTGAGAATGCAGGAAAAGGATGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953968200 3:47326496-47326518 GGGCCCATGCAAGAGGAGGAGGG - Intronic
954590877 3:51780230-51780252 GTGAAGATGCAGGAACAGAAGGG + Intergenic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954745018 3:52782838-52782860 GTGGACAAGCAGGAGGAGATAGG - Intronic
954876397 3:53805711-53805733 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954876403 3:53805731-53805753 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954876409 3:53805751-53805773 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954876420 3:53805791-53805813 GGGAAGATAGAGGAGGAGGAGGG - Intronic
954876425 3:53805811-53805833 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954876479 3:53806005-53806027 GGGAACATGAGGGAGGAGGAGGG - Intronic
954968364 3:54630484-54630506 GTGAGTCTGCAAGAGGAGGATGG - Intronic
955628426 3:60946115-60946137 GTGAGGATACAGGAGGATGACGG + Intronic
957122317 3:76111114-76111136 GAGATCATGCTGGAGAAGGAGGG + Intronic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
959259204 3:104053211-104053233 CTGAACCTGCAGGAGGATGGAGG - Intergenic
959555475 3:107712417-107712439 GGGAAGATGCAGGAGAAGGTTGG - Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960997144 3:123347753-123347775 GTGAAGCTGGGGGAGGAGGATGG - Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961600957 3:128061754-128061776 GTGAAAAGGCAAGAGGGGGATGG + Intronic
961659730 3:128462365-128462387 GTGAACATGAAGGAGGGAGTGGG - Intergenic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962464273 3:135642196-135642218 GAGAAAATGGAGGAGGGGGAGGG - Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963391001 3:144664285-144664307 GTGAACATGAAGGCGGAGATTGG + Intergenic
963460090 3:145601413-145601435 GTGAAGATGCAGGTAGAGGTTGG + Intergenic
963524785 3:146404324-146404346 GTGAACATATAAGAGAAGGAAGG + Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965755002 3:172016770-172016792 GTGAACAGAGAGGATGAGGAGGG - Intergenic
966103407 3:176304538-176304560 ATGTACATGTAGGAGGAGGGAGG + Intergenic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
968218428 3:196914710-196914732 GTGTTCCTGCAGGAGGACGATGG - Intronic
968762314 4:2449136-2449158 GTGTCCATGAAGGAGCAGGAGGG - Intronic
968909876 4:3472368-3472390 GTGAGCATGCAGGAGGGGATTGG - Intronic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969261259 4:6035626-6035648 GTGCAGATGCTGGAGAAGGAGGG + Intronic
969512203 4:7624899-7624921 GTGATCATGGAGGAGGAGGACGG + Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969881257 4:10176051-10176073 GTGAACATGAGGGAGATGGATGG + Intergenic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
970490931 4:16572914-16572936 GAGAAGGTGAAGGAGGAGGAAGG + Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
971613643 4:28759277-28759299 GGGACCATGAAGGAGGGGGAGGG - Intergenic
971789745 4:31154220-31154242 ATGAACATGAAGGAGGAGTTTGG + Intergenic
971790208 4:31160484-31160506 GTGAATATGCAGTGGGTGGAGGG + Intergenic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
975712635 4:77175586-77175608 GGGAAGATGCGGGAGGAGGGAGG - Intronic
979238969 4:118431759-118431781 GTGAACCTGCAGGATTAGGAGGG + Intergenic
979535787 4:121819082-121819104 GGGAAAATACAGGATGAGGATGG - Intronic
980174414 4:129327166-129327188 GTAAACATGCAGGAGAAAGAGGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
982590139 4:157298443-157298465 GTTATCATGCATGAGCAGGAAGG + Intronic
983304607 4:165970494-165970516 GTGAAAGTGGAGGAGGAGGTTGG + Intronic
983759214 4:171384747-171384769 GAGAAGGTGAAGGAGGAGGAGGG - Intergenic
984191699 4:176613524-176613546 GAGATCATGCTGGAGTAGGATGG + Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984934771 4:184880585-184880607 GGGAAGATGCAGGCGGAGGCTGG - Intergenic
985784972 5:1888544-1888566 GTAAAAATGATGGAGGAGGAGGG - Intergenic
986191727 5:5502703-5502725 GGAACCAAGCAGGAGGAGGAAGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
989127863 5:38074449-38074471 GGGGACATGATGGAGGAGGATGG - Intergenic
990162297 5:52955573-52955595 ATGAACTTGCAGGAGAAGGAAGG + Exonic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990549424 5:56858898-56858920 GTGAAAGCACAGGAGGAGGAAGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992089490 5:73304316-73304338 GGGAAGATGGAGGGGGAGGAAGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992133645 5:73720549-73720571 GGGAAAATGCAAGAGGAGGAAGG + Intronic
992686934 5:79208293-79208315 GAGAAGGTGGAGGAGGAGGAAGG + Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995629681 5:114119624-114119646 GTGATCAGACAGGAGGAAGACGG - Intergenic
997158948 5:131587005-131587027 GGTACCATGCAGGAAGAGGAGGG - Intronic
997262392 5:132475073-132475095 GTGGAGATGGAGGAGGGGGAAGG + Intronic
997896293 5:137720587-137720609 GTGAACAGGAAGGAAGAGGGAGG + Intronic
998534482 5:142916793-142916815 GTGAAAATGGAGGAGGAGTGAGG + Intronic
999249210 5:150172061-150172083 GTGAAGATGCAGGAGAGGGAAGG - Intronic
999334190 5:150700905-150700927 GTGTGCCTGCCGGAGGAGGATGG - Intronic
999434061 5:151549441-151549463 GTGACCATTCATGTGGAGGATGG - Exonic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1001514324 5:172344906-172344928 GGGAAAAGGAAGGAGGAGGATGG + Intronic
1001917530 5:175574197-175574219 GTGAAAGTGAAGGAGGAAGACGG - Intergenic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1002739218 5:181422357-181422379 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1003735296 6:8871708-8871730 CTGAAAATACAGGAGCAGGAAGG + Intergenic
1003926624 6:10882953-10882975 GTGAACCTGGAGGAGGTGGGGGG + Intronic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1005391933 6:25342862-25342884 GTGCAGCTGGAGGAGGAGGAAGG - Intronic
1005979988 6:30829341-30829363 GGGCACCTGCAAGAGGAGGAAGG + Intergenic
1006113207 6:31761300-31761322 GGGAAAATGGAGGAGGATGAAGG + Intronic
1006360918 6:33586608-33586630 GGGAACAGGCAGGAGTAGGATGG - Intergenic
1006376904 6:33676751-33676773 CTGAACCTGAAGGTGGAGGATGG - Exonic
1007093621 6:39200000-39200022 GGGATTATGCAGGAAGAGGAGGG + Intronic
1007239992 6:40417858-40417880 GTGAACATTCAGGAGCAACAGGG + Intronic
1007735583 6:43980369-43980391 GTGGGCATGCAGGAGGGGGCTGG - Intergenic
1013041515 6:106438546-106438568 GTGACAATGCAGGAGGAGACTGG - Intergenic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1015295035 6:131581422-131581444 GTAGACATTCAGGAGGTGGAAGG + Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016846517 6:148573296-148573318 GTGAACAGGGAGGAGCAGTAAGG + Intergenic
1016983955 6:149880283-149880305 GTGAAACTGCAGGTGAAGGATGG + Intergenic
1017562760 6:155647793-155647815 GAGAGCATGCAGGTGGAGAAAGG - Intergenic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1018471446 6:164101402-164101424 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1018471462 6:164101444-164101466 GGGGACCTGCAGGTGGAGGAGGG - Intergenic
1018471470 6:164101465-164101487 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1018471477 6:164101486-164101508 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1018471484 6:164101507-164101529 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1018471491 6:164101528-164101550 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1018471555 6:164101780-164101802 GGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019135383 6:169904629-169904651 GTGCCCCTGCAGGAGGAGGTGGG - Intergenic
1019146166 6:169976790-169976812 GTGACCAGGGAGGAGGAGGGAGG - Intergenic
1019244328 6:170697916-170697938 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1019407676 7:892247-892269 GAGAACATGCTGGTGGTGGAAGG - Intronic
1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG + Intronic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022649721 7:32263320-32263342 GTATATATGCAGGGGGAGGAGGG - Intronic
1022942007 7:35250086-35250108 GTGCACAGAGAGGAGGAGGACGG + Exonic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023831120 7:44039518-44039540 GTGGACATCGAGGAGAAGGACGG - Intergenic
1024457538 7:49626486-49626508 GTGAGAATTCAGGAGGAGCAAGG + Intergenic
1027795825 7:82691991-82692013 GTGAAAATACAGGAGAATGAAGG + Intergenic
1029204450 7:98860529-98860551 GTGTTCATGCAGCAGGGGGAGGG - Intronic
1029353127 7:100029762-100029784 GTGAACATGCTGGTGCAGGAAGG + Intronic
1029741448 7:102493824-102493846 GTGGACATCGAGGAGAAGGACGG - Exonic
1029759440 7:102592993-102593015 GTGGACATCGAGGAGAAGGACGG - Exonic
1029776807 7:102688903-102688925 GTGGACATCGAGGAGAAGGACGG - Intergenic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1031135949 7:117884239-117884261 GTGAGCATGCAGCAGGAAGCTGG - Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031554721 7:123159386-123159408 GTGCACATGCAGTAGAAAGAGGG - Intronic
1031626992 7:124003591-124003613 ATCAAGATTCAGGAGGAGGATGG - Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033556673 7:142494133-142494155 ATGAACATGCAACAGGAGCAAGG + Intergenic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035175053 7:157044574-157044596 GTGAGCACGCAGGAAGAGGTGGG - Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035503797 8:110256-110278 GTGAACCTGCAGGATTAGGAGGG - Intergenic
1035574753 8:697424-697446 GTGGGCATGCAGCAGGATGACGG - Intronic
1036110128 8:5889761-5889783 GTGATGATGCAGGGAGAGGATGG - Intergenic
1036619603 8:10415855-10415877 GGGAAATTGCAGGAGGAGGTGGG - Intronic
1036634196 8:10537814-10537836 ATGAGCCTGCAGGAGGAGAAAGG - Intronic
1038186472 8:25279569-25279591 GTTAACATTAAGGAGGAGAATGG - Intronic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038790629 8:30665133-30665155 GTGAGGGTGGAGGAGGAGGAAGG - Intergenic
1039201592 8:35099994-35100016 GTCAAAATGAAGGAAGAGGAGGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039954779 8:42198636-42198658 GTGAGCAAGCTAGAGGAGGAGGG + Intronic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040498206 8:47984962-47984984 GGGAGCAGGAAGGAGGAGGAGGG + Intergenic
1040806046 8:51397527-51397549 GTGAACATTCTGGAGGAGTATGG - Intronic
1040873029 8:52120539-52120561 CTGAGCATCCAAGAGGAGGAAGG + Intronic
1041803800 8:61828014-61828036 GTGCACTTGTAGGAGGAGGAGGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042317649 8:67440875-67440897 GTGAACATACAAGAAGAGAATGG - Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043777019 8:84282498-84282520 GTAAAAAGGCAGGAGGAGGTAGG + Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1047425565 8:124742430-124742452 GTGAGCAAGCAAGAGGAGGCTGG + Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048045186 8:130766397-130766419 GTGAGGATGCAGGAGGAGTCAGG + Intergenic
1048236339 8:132694400-132694422 GTGAAGATGCAGGGAGAAGATGG + Intronic
1048859261 8:138711781-138711803 AGCATCATGCAGGAGGAGGAAGG + Intronic
1048874952 8:138829277-138829299 CTGCCCATGCAGGAGGAAGATGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049381903 8:142320379-142320401 GTGAAGTTGCAGGTGCAGGAGGG - Intronic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049961521 9:742286-742308 GTCAACATCCAGGATGACGAGGG + Exonic
1051145441 9:14022487-14022509 ATGAACATGCATGAGGTGGCTGG - Intergenic
1051146766 9:14035154-14035176 GTGAAAATGTATGAGGATGAGGG + Intergenic
1051288586 9:15522281-15522303 GTGAACTTCTAGGAGGAGGAAGG - Intergenic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1051896024 9:21989979-21990001 GTTAGGATCCAGGAGGAGGATGG + Intronic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1056566337 9:87776019-87776041 GAGAATATGCAGGAGAAGAAGGG - Intergenic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1056896848 9:90559220-90559242 GTGAACCTGCAGGTGGTGGCAGG + Intergenic
1056950372 9:91036578-91036600 GTGATGGGGCAGGAGGAGGAGGG - Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057226602 9:93296294-93296316 GGGAAGATGGAGGGGGAGGAAGG - Intronic
1057319796 9:94002040-94002062 GTGAACATGGAGTCTGAGGATGG - Intergenic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1057757081 9:97847491-97847513 TTGATCTTGCAGGAGGATGATGG + Intergenic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058458454 9:105160028-105160050 GTGAACATGGATGTGGAGAAAGG + Intergenic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060495748 9:124117643-124117665 GTGAACAGGGAGGCTGAGGATGG + Intergenic
1060500606 9:124151037-124151059 GAGAAGATGCAGGAGGATGCTGG - Intergenic
1060976877 9:127770258-127770280 GTGCACCTGGAGCAGGAGGAAGG - Intronic
1060986906 9:127825279-127825301 GGGACCCTGCAGGATGAGGACGG + Exonic
1061255406 9:129452229-129452251 GTGACCAGGCAGGGCGAGGATGG + Intergenic
1061700619 9:132412243-132412265 GTGACCATGCTGGAGCAGCAGGG + Intronic
1062097860 9:134712113-134712135 GGGAACAGGAAGGAGGGGGAAGG - Intronic
1062143741 9:134976733-134976755 GTGAAAATGGGGGAGGGGGAAGG - Intergenic
1062394534 9:136347443-136347465 GTGAGCAGGGAGGAGGATGAGGG + Intronic
1203604516 Un_KI270748v1:47142-47164 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185550667 X:980798-980820 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550729 X:980996-981018 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550779 X:981151-981173 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550797 X:981203-981225 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185689146 X:2138937-2138959 GTGAAGATACAGTAGGAAGAAGG + Intergenic
1185918456 X:4062733-4062755 GAGATCATCCTGGAGGAGGAAGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186175728 X:6924043-6924065 GTGACTTTGCAGGAGGACGAAGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187248526 X:17575526-17575548 GAAAACATGGAGGAGGGGGAGGG - Intronic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187396559 X:18924423-18924445 GTGCACCTGCTGGAGGATGACGG - Exonic
1188755090 X:33952573-33952595 GTGAAAATGAAGGGGGAGGGGGG + Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1192591210 X:72360970-72360992 GTGAGCAGGCAGGAGGATGGGGG + Intronic
1192619451 X:72662657-72662679 GTAGACATGCATGAGGAGAAGGG - Intronic
1193295272 X:79825947-79825969 GTAGACATGCAGGAGAAGGAAGG + Intergenic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1197546259 X:127828263-127828285 GGGAACTTGAAGGAGGAGAAAGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199853185 X:151739674-151739696 GTGACCACACAGGAGGGGGATGG + Exonic
1201148157 Y:11077858-11077880 GTGAAAATGCAGTCTGAGGATGG + Intergenic
1202386727 Y:24333555-24333577 GTGAACCTGCAGGATTAGGAGGG + Intergenic
1202484058 Y:25336573-25336595 GTGAACCTGCAGGATTAGGAGGG - Intergenic