ID: 948884339

View in Genome Browser
Species Human (GRCh38)
Location 2:240875380-240875402
Sequence TCGGGCCAGTCGAGGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948884339_948884348 -9 Left 948884339 2:240875380-240875402 CCCCCATTCCTCGACTGGCCCGA 0: 1
1: 0
2: 1
3: 11
4: 233
Right 948884348 2:240875394-240875416 CTGGCCCGAGGCTCTGGGCAGGG 0: 1
1: 1
2: 2
3: 39
4: 353
948884339_948884347 -10 Left 948884339 2:240875380-240875402 CCCCCATTCCTCGACTGGCCCGA 0: 1
1: 0
2: 1
3: 11
4: 233
Right 948884347 2:240875393-240875415 ACTGGCCCGAGGCTCTGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 246
948884339_948884351 -3 Left 948884339 2:240875380-240875402 CCCCCATTCCTCGACTGGCCCGA 0: 1
1: 0
2: 1
3: 11
4: 233
Right 948884351 2:240875400-240875422 CGAGGCTCTGGGCAGGGTCATGG 0: 1
1: 0
2: 2
3: 27
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948884339 Original CRISPR TCGGGCCAGTCGAGGAATGG GGG (reversed) Intronic