ID: 948888014

View in Genome Browser
Species Human (GRCh38)
Location 2:240893464-240893486
Sequence TGCGTGGCCCACGGCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948888014_948888017 -2 Left 948888014 2:240893464-240893486 CCTCATCTGCCGTGGGCCACGCA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 948888017 2:240893485-240893507 CACGCTCACTGCCCGTGACCTGG 0: 1
1: 0
2: 0
3: 11
4: 67
948888014_948888021 10 Left 948888014 2:240893464-240893486 CCTCATCTGCCGTGGGCCACGCA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 948888021 2:240893497-240893519 CCGTGACCTGGCAGCTTGGAAGG 0: 1
1: 0
2: 1
3: 10
4: 114
948888014_948888018 6 Left 948888014 2:240893464-240893486 CCTCATCTGCCGTGGGCCACGCA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 948888018 2:240893493-240893515 CTGCCCGTGACCTGGCAGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948888014 Original CRISPR TGCGTGGCCCACGGCAGATG AGG (reversed) Intronic
900339281 1:2180203-2180225 TGCGTGGCACAGGGCAGGCGTGG + Intronic
901061306 1:6473220-6473242 TGCCTGACCCTGGGCAGATGGGG + Intronic
901207134 1:7503729-7503751 TGTGTGGCCCTCGGGAGGTGGGG + Intronic
904263193 1:29303134-29303156 TGCGTGTCCCAAGGCGGGTGTGG + Intronic
904291559 1:29489082-29489104 TGCATGTCCCAAGGCAGGTGTGG - Intergenic
905262598 1:36730196-36730218 TGTGTGGGCCAGGGCAGATGGGG - Intergenic
906632424 1:47383320-47383342 CACGTGGCCTAAGGCAGATGTGG - Intergenic
910935065 1:92480732-92480754 TGAGAGGCCCACGGCAGCGGCGG - Exonic
913649597 1:120899619-120899641 TCAGTGGCCCACGACAAATGTGG + Intergenic
914296812 1:146334603-146334625 TCAGTGGCCCACGACAAATGTGG - Intergenic
914526648 1:148473445-148473467 TCAGTGGCCCACGACAAATGTGG - Intergenic
914639755 1:149593678-149593700 TCAGTGGCCCACGACAAATGTGG + Intergenic
915102125 1:153508159-153508181 TGCCTGCCCCAAAGCAGATGAGG + Intergenic
918132697 1:181643552-181643574 GGCATGGCCCACCCCAGATGTGG - Intronic
1063187872 10:3666640-3666662 TGCAGGGAACACGGCAGATGGGG + Intergenic
1065480101 10:26184204-26184226 AGCCTGGCCAAGGGCAGATGAGG + Intronic
1065774391 10:29105860-29105882 TGAGGGGCACAAGGCAGATGGGG + Intergenic
1070799203 10:79235216-79235238 TTCCTGGTCCATGGCAGATGAGG - Intronic
1074681689 10:115913763-115913785 TGCGTGGCCCACAGCCTTTGGGG + Intronic
1077222101 11:1422332-1422354 TGGGTGGCACACGGCAGACAGGG - Intronic
1077522866 11:3046611-3046633 GGCCTGACCCACGGCAGAGGCGG + Intronic
1078064997 11:8072378-8072400 TCCGCCGCCCACCGCAGATGAGG - Intronic
1078355240 11:10627874-10627896 TTCGTGACCCACTGGAGATGAGG - Intronic
1080540148 11:33257510-33257532 TGCGGGGCCCACGGCGATTGGGG - Intronic
1082810168 11:57474792-57474814 TGTGTGGCCCACGGCCAGTGGGG - Intronic
1083281127 11:61627930-61627952 GGCGAGGCTCACGGCAGATGTGG - Intergenic
1083661556 11:64253852-64253874 TGTGAGGACCCCGGCAGATGTGG + Intronic
1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG + Intronic
1096524530 12:52202684-52202706 TGCGTGGACCTTGGCAGAGGCGG - Intergenic
1102310987 12:111844113-111844135 TGCCTGGCCCAAGGAAGACGAGG + Intronic
1104120626 12:125795789-125795811 TGGGTGGCCCAAGGCAGCTCCGG + Intergenic
1104967195 12:132513673-132513695 TGCAGAGCCCACGGCAGACGAGG + Intronic
1105720224 13:23106465-23106487 TGCCTGGCCTCAGGCAGATGAGG + Intergenic
1111150374 13:84245701-84245723 TGCGTGGCCCAAGCCAGCAGAGG - Intergenic
1116997099 14:51335559-51335581 TGGGTGGCCAGGGGCAGATGGGG + Intergenic
1119217373 14:72879502-72879524 TGCATGGCCCAGGGCAGGTGTGG + Intronic
1121006051 14:90491371-90491393 TGCCTGGCACACGGCACATGTGG + Intergenic
1121094165 14:91204405-91204427 TGCCAGGCCCATGGGAGATGTGG - Intronic
1121099866 14:91242983-91243005 TGCAGGGCCCTCGACAGATGTGG - Exonic
1122208967 14:100162721-100162743 TGCCTGGCCCAGGGGAAATGGGG - Intergenic
1122284441 14:100642324-100642346 TGGGGGGCCCAGGGCAGAAGAGG + Intergenic
1124001988 15:25767617-25767639 TGCCTGGCCCACCCCACATGAGG + Intronic
1124143047 15:27094296-27094318 TGCATGGCCCAAGGCATTTGAGG + Intronic
1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG + Intergenic
1129253638 15:74321910-74321932 TGCGTGGCCCTTGGCAGATGAGG + Intronic
1130890402 15:88128594-88128616 TCCCTGGCCCATGGCAGCTGAGG - Intronic
1136402291 16:30025236-30025258 GGCAGGCCCCACGGCAGATGAGG + Exonic
1138250873 16:55500939-55500961 TGCCTGGCACACAGCAGATGTGG - Intronic
1140648751 16:77064306-77064328 TGCTTGGCCAACGCCAGAGGTGG - Intergenic
1143503838 17:7353196-7353218 TGCGTGGAGCAGGGCAGCTGTGG - Exonic
1148053456 17:44780230-44780252 TGCTGGGGCCAGGGCAGATGTGG + Exonic
1150823709 17:68457047-68457069 TGCGGGGGCCACGGAATATGGGG - Intronic
1152598297 17:81248982-81249004 CACGTGGCCCACGGCCGAGGTGG - Intronic
1157307243 18:46526061-46526083 TGTGTGGCCGAAAGCAGATGTGG + Intronic
1159443176 18:68507665-68507687 TGACTGGTCCACAGCAGATGAGG + Intergenic
1161769668 19:6224327-6224349 TGCATGGCCCAGGCCAGCTGGGG - Intronic
1163291351 19:16381358-16381380 GGGGTGGCCCTCGGCAGCTGAGG - Intronic
1163700683 19:18785241-18785263 GGCGTGGCCAATGGTAGATGGGG - Intronic
925971262 2:9108073-9108095 TGCCTGGCACATGGCACATGGGG + Intergenic
938219145 2:129550699-129550721 TGCGTGGCTGTTGGCAGATGTGG - Intergenic
940316997 2:152336169-152336191 TGCGAAGTCCCCGGCAGATGGGG + Intronic
946066762 2:216994563-216994585 TTCTTGGCCCATGGCAGATTGGG - Intergenic
946495763 2:220193539-220193561 TGGCTTGCCCATGGCAGATGTGG + Intergenic
948547602 2:238743775-238743797 TGCTTCCCCCACGGCAGTTGAGG - Intergenic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
948895615 2:240925554-240925576 TGTGGGGCCCATGGCAGGTGGGG + Intronic
1172208712 20:33182496-33182518 TCCCTGGCCCAAGACAGATGAGG + Intergenic
1174002203 20:47383034-47383056 TGAGTGGCCCACTGCAGAAGAGG + Intergenic
1175403413 20:58713078-58713100 TGCCTGGCACCCGGCAGATGGGG - Intronic
1176386510 21:6140790-6140812 TGCGTGGCCCGAGGAAGCTGAGG + Intergenic
1177836900 21:26194582-26194604 TGCATGGTCCACTGCACATGTGG - Intergenic
1179736963 21:43397462-43397484 TGCGTGGCCCGAGGAAGCTGAGG - Intergenic
1179891071 21:44335366-44335388 TGGGGGTCCCAGGGCAGATGTGG + Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181235132 22:21443982-21444004 TGCCTGGTCCATGGCAGAGGAGG + Intronic
1183398816 22:37589031-37589053 TGTGTGGCCCAGGGCAGAGCTGG - Intergenic
1185126869 22:49016134-49016156 TGCCTGGCCCACTGCAGACATGG - Intergenic
950434209 3:12968749-12968771 TGGGTGGCCCAGGACAGGTGGGG - Intronic
953603181 3:44387662-44387684 TGGCTGGCCCTTGGCAGATGTGG + Intronic
957021831 3:75136685-75136707 TGCGTTGCCCAAGCCAGCTGGGG - Intergenic
958624730 3:96609617-96609639 TGCCTTCCCCACCGCAGATGCGG + Intergenic
960682425 3:120263193-120263215 TGGGTGGCCCTTGGCAGGTGTGG + Intronic
968805277 4:2767934-2767956 GGTGTGGCACACGGCAGCTGAGG + Intergenic
970376102 4:15458557-15458579 TGCCTGCCACATGGCAGATGTGG - Intergenic
985549866 5:527727-527749 TGCCTGGCACACAGCAGGTGTGG - Intergenic
986462021 5:7982392-7982414 TGGGTGGCTCACTGCAGCTGAGG + Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1004133227 6:12941324-12941346 TGCTTGGCCCACTGCAGTTGTGG + Intronic
1013409830 6:109874143-109874165 TGCAAGGCCCACGGCAGCAGAGG + Intergenic
1018206174 6:161439228-161439250 TCCCGGGCTCACGGCAGATGCGG + Intronic
1020044438 7:5030681-5030703 TGCTGGGCCCAGGGGAGATGCGG - Intronic
1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG + Intronic
1025171080 7:56757215-56757237 AGCATGGCCCACATCAGATGAGG + Intergenic
1025700796 7:63818474-63818496 AGCATGGCCCACATCAGATGAGG - Intergenic
1031643689 7:124197349-124197371 TGCATGGCACAAGACAGATGGGG - Intergenic
1033352197 7:140570582-140570604 AGCGTGTCCCTCTGCAGATGGGG - Intronic
1036452702 8:8882688-8882710 TGCCTGGCACAGGGCAGATCAGG - Intronic
1049015882 8:139919774-139919796 TGTGTGGCCCAGAGCAGGTGCGG + Intronic
1049651437 8:143771633-143771655 TGCCTGGCCCCCGGCTGTTGCGG - Intergenic
1059798005 9:117720727-117720749 TGCTTGGCCCATGGGAAATGGGG - Intergenic
1060832283 9:126723907-126723929 GGCATGGACCACGGCAGCTGAGG + Intergenic
1062438270 9:136556739-136556761 TCCTGGGCCCACTGCAGATGGGG - Intergenic
1194212331 X:91083430-91083452 TGCCTTGCCCTTGGCAGATGTGG + Intergenic