ID: 948891817

View in Genome Browser
Species Human (GRCh38)
Location 2:240910529-240910551
Sequence TCTCGAGCCCCTCAGCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948891817_948891826 15 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891826 2:240910567-240910589 ACTCCAGACAGCCTTGGGTCTGG No data
948891817_948891823 9 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891823 2:240910561-240910583 CCCAGGACTCCAGACAGCCTTGG No data
948891817_948891821 -8 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891821 2:240910544-240910566 GCTCGAGACAGGGGTTTCCCAGG No data
948891817_948891830 30 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891830 2:240910582-240910604 GGGTCTGGAACCCCAGTCCTGGG No data
948891817_948891829 29 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891829 2:240910581-240910603 TGGGTCTGGAACCCCAGTCCTGG No data
948891817_948891825 10 Left 948891817 2:240910529-240910551 CCTCTTTGCTGAGGGGCTCGAGA No data
Right 948891825 2:240910562-240910584 CCAGGACTCCAGACAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948891817 Original CRISPR TCTCGAGCCCCTCAGCAAAG AGG (reversed) Intergenic
No off target data available for this crispr