ID: 948892108

View in Genome Browser
Species Human (GRCh38)
Location 2:240912531-240912553
Sequence CTGCCCCCTGTACCTTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948892108_948892113 1 Left 948892108 2:240912531-240912553 CCAGGTCAAGGTACAGGGGGCAG No data
Right 948892113 2:240912555-240912577 TACGGAGCCTCCAGGCCCCTGGG No data
948892108_948892112 0 Left 948892108 2:240912531-240912553 CCAGGTCAAGGTACAGGGGGCAG No data
Right 948892112 2:240912554-240912576 GTACGGAGCCTCCAGGCCCCTGG No data
948892108_948892111 -7 Left 948892108 2:240912531-240912553 CCAGGTCAAGGTACAGGGGGCAG No data
Right 948892111 2:240912547-240912569 GGGGCAGGTACGGAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948892108 Original CRISPR CTGCCCCCTGTACCTTGACC TGG (reversed) Intergenic
No off target data available for this crispr