ID: 948892671

View in Genome Browser
Species Human (GRCh38)
Location 2:240915016-240915038
Sequence AGGGAGGGCGCAGGGACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948892671_948892684 12 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892684 2:240915051-240915073 CTTTTGCAGGCAGTATGGGCTGG No data
948892671_948892685 16 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892685 2:240915055-240915077 TGCAGGCAGTATGGGCTGGCAGG No data
948892671_948892682 8 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892682 2:240915047-240915069 AAGCCTTTTGCAGGCAGTATGGG No data
948892671_948892680 -1 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892680 2:240915038-240915060 TGCAGGCGGAAGCCTTTTGCAGG No data
948892671_948892681 7 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892681 2:240915046-240915068 GAAGCCTTTTGCAGGCAGTATGG No data
948892671_948892686 26 Left 948892671 2:240915016-240915038 CCTACAGTCCCTGCGCCCTCCCT No data
Right 948892686 2:240915065-240915087 ATGGGCTGGCAGGTGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948892671 Original CRISPR AGGGAGGGCGCAGGGACTGT AGG (reversed) Intergenic
No off target data available for this crispr