ID: 948892786

View in Genome Browser
Species Human (GRCh38)
Location 2:240915447-240915469
Sequence GATCCCAGGGCCAGGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948892786_948892802 20 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892802 2:240915490-240915512 ACGCTCCCATTTCACAGATGGGG No data
948892786_948892794 -10 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892794 2:240915460-240915482 CCCTGGGATCCAGGAGGGCCTGG No data
948892786_948892796 -6 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892796 2:240915464-240915486 GGGATCCAGGAGGGCCTGGATGG No data
948892786_948892800 18 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892800 2:240915488-240915510 CAACGCTCCCATTTCACAGATGG No data
948892786_948892805 28 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892805 2:240915498-240915520 ATTTCACAGATGGGGACATGAGG No data
948892786_948892801 19 Left 948892786 2:240915447-240915469 CCTCAGCCCCTGGCCCTGGGATC No data
Right 948892801 2:240915489-240915511 AACGCTCCCATTTCACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948892786 Original CRISPR GATCCCAGGGCCAGGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr