ID: 948893221

View in Genome Browser
Species Human (GRCh38)
Location 2:240916930-240916952
Sequence CCAACCAGGAGGAGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 309}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948893221_948893238 24 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893238 2:240916977-240916999 TGGGCCCAGGAGGAGGAGCAGGG 0: 1
1: 0
2: 13
3: 122
4: 1037
948893221_948893237 23 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893237 2:240916976-240916998 CTGGGCCCAGGAGGAGGAGCAGG 0: 1
1: 0
2: 6
3: 145
4: 1349
948893221_948893232 11 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893232 2:240916964-240916986 CCTGGGTCCCAGCTGGGCCCAGG 0: 1
1: 1
2: 14
3: 96
4: 691
948893221_948893228 -6 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893228 2:240916947-240916969 GGTTGGTGGTCTTGGCACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 189
948893221_948893234 17 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893234 2:240916970-240916992 TCCCAGCTGGGCCCAGGAGGAGG 0: 1
1: 0
2: 2
3: 78
4: 523
948893221_948893227 -7 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893227 2:240916946-240916968 TGGTTGGTGGTCTTGGCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 203
948893221_948893230 5 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893230 2:240916958-240916980 TTGGCACCTGGGTCCCAGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 210
948893221_948893229 4 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893229 2:240916957-240916979 CTTGGCACCTGGGTCCCAGCTGG 0: 1
1: 0
2: 1
3: 28
4: 269
948893221_948893233 14 Left 948893221 2:240916930-240916952 CCAGCAGCTCTCCTCCTGGTTGG 0: 1
1: 1
2: 0
3: 21
4: 309
Right 948893233 2:240916967-240916989 GGGTCCCAGCTGGGCCCAGGAGG 0: 1
1: 0
2: 6
3: 59
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948893221 Original CRISPR CCAACCAGGAGGAGAGCTGC TGG (reversed) Intergenic
900031691 1:377369-377391 CAAACCACAGGGAGAGCTGCCGG + Intergenic
900052238 1:605561-605583 CAAACCACAGGGAGAGCTGCCGG + Intergenic
900963130 1:5938298-5938320 CCCACCAGGTGAAGAGCTGGGGG + Intronic
901087523 1:6620465-6620487 CCAAGGAGGAGAAAAGCTGCAGG + Intronic
901170375 1:7252689-7252711 CCAACCAGCAGAAGAGTAGCTGG - Intronic
901666701 1:10830332-10830354 CCAAACAGGATCTGAGCTGCAGG - Intergenic
903543700 1:24110822-24110844 TGGCCCAGGAGGAGAGCTGCTGG + Intronic
904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG + Intronic
905249283 1:36637760-36637782 CCAAGCAGGAGGAGTGGGGCTGG + Intergenic
905254656 1:36672519-36672541 CAAACCCTGAGGGGAGCTGCCGG - Intergenic
906580845 1:46934220-46934242 CCAAGCATCAGGAGAGGTGCCGG - Exonic
906602878 1:47144674-47144696 CCAAGCATCAGGAGAGGTGCCGG + Exonic
908405976 1:63814804-63814826 CACAGCAGGAGGAGAGCTGTGGG - Intronic
909122797 1:71625893-71625915 CATAGCAGGAGGTGAGCTGCAGG + Intronic
909443362 1:75722482-75722504 CCACCCAGGAGGACTGCTGAGGG + Intergenic
910516771 1:88070137-88070159 TCAGCCAGGATGGGAGCTGCTGG + Intergenic
910963325 1:92784613-92784635 CCCACGAGAAGGAGGGCTGCGGG + Intronic
914381207 1:147117982-147118004 CCAAAGAGGAAGAGAGCAGCTGG + Intergenic
915091262 1:153428117-153428139 CCATTCAGGAGTAGAGGTGCAGG + Intergenic
915093850 1:153445172-153445194 CCATTCAGGAGTAGAGGTGCAGG - Intergenic
915453086 1:156020553-156020575 CCAAGGAGGAGGGGAGCAGCGGG - Intronic
915598303 1:156907705-156907727 CCAGCCAGGGGGGCAGCTGCAGG - Exonic
915879617 1:159653494-159653516 CCAAACAGGAGCATAGCTTCAGG + Intergenic
916512203 1:165482348-165482370 CCACGTAGGAGGAGTGCTGCGGG + Intergenic
918263240 1:182816075-182816097 CAAAGCAGGAGGAGTGCTGCTGG + Intronic
919911497 1:202113625-202113647 CCAGGCAGGAAGAGAGCTGGTGG - Intergenic
922031177 1:221801004-221801026 CACACCAGGAGGTGAACTGCGGG + Intergenic
922800838 1:228364134-228364156 CCAAGCAGGATGAGACCTCCAGG + Intronic
923296784 1:232602188-232602210 CCAACCTGGATGAGAGGTGAGGG + Intergenic
1063242423 10:4184883-4184905 CCAAACAGAAGGAAATCTGCTGG + Intergenic
1064089028 10:12367803-12367825 CAAAACAGGAGGTGAGCAGCCGG - Intronic
1065060667 10:21897508-21897530 CCTAGCAGGAGGTGAGCGGCAGG + Intronic
1067373787 10:45709060-45709082 CTAAGGAGGAGGAGAGCTACAGG + Intergenic
1067379896 10:45763172-45763194 CTAAGGAGGAGGAGAGCTACAGG - Intronic
1067881617 10:50050827-50050849 CTAAGGAGGAGGAGAGCTACAGG + Intergenic
1067887595 10:50103826-50103848 CTAAGGAGGAGGAGAGCTACAGG - Intronic
1068900898 10:62268539-62268561 CCACCCAGCAGGTGAGTTGCGGG - Exonic
1069453186 10:68533728-68533750 CAAACCAGGAGGAGAGCCACTGG + Intergenic
1069577427 10:69540875-69540897 GCGTTCAGGAGGAGAGCTGCGGG + Intergenic
1069895834 10:71679518-71679540 CCAGCCAGGAGGAGGGCTGGGGG + Intronic
1069970567 10:72164643-72164665 ATACCCAGGAGGAGAACTGCTGG + Intronic
1070482805 10:76901804-76901826 GCATCCAGGAGCAGAGCTGTGGG + Intronic
1070820835 10:79353188-79353210 CCAGCCAAGAGCAGAACTGCAGG - Intronic
1071117936 10:82245376-82245398 CACAGCAGGAGGTGAGCTGCTGG - Intronic
1073490850 10:103852393-103852415 CCACGCAGGAGGAGCTCTGCTGG - Intronic
1074765653 10:116698364-116698386 CCACCCAGGAGTGGAGCTGCTGG + Intronic
1077274818 11:1699659-1699681 CCACCCAGGACCTGAGCTGCAGG - Intergenic
1079466303 11:20734409-20734431 CCAGATAGGAGGAGAGGTGCAGG + Intronic
1080413875 11:32051630-32051652 CCCACCTGGAAGAGAGCTCCAGG + Intronic
1080645474 11:34184744-34184766 CCAATGAGGTGGAGAGATGCCGG - Intronic
1080701841 11:34650577-34650599 CCAGCAAGGAGGGGAGCTGAGGG + Intronic
1081446561 11:43136694-43136716 CCTACCAGTAGGAGTGGTGCAGG - Intergenic
1081758456 11:45560776-45560798 TCAGCCAGGTGGAGAGCTGGGGG - Intergenic
1083078485 11:60066559-60066581 CCAGCCAGGAGGATATCTGGGGG - Intronic
1084719563 11:70895534-70895556 CCAACCAGGAGGAGAGTCTTTGG - Intronic
1085265614 11:75236331-75236353 CCAAGCAAGAGGAGAGAAGCTGG + Intergenic
1085498369 11:76993881-76993903 CACAGCAGGAGGTGAGCTGCAGG - Intronic
1086238186 11:84657715-84657737 CACAGCAGGAGGAGAGCAGCAGG - Intronic
1087127222 11:94640064-94640086 CCACCCAGGAAGAGGGCGGCAGG - Intergenic
1088682820 11:112258689-112258711 GCAACCTGGAGGAGAGCCTCAGG - Intronic
1089052626 11:115558781-115558803 CCAAGCAGGAGGTGAGTGGCTGG + Intergenic
1091689042 12:2583344-2583366 AAAAGCAGGAGGAGAGCTGAAGG - Intronic
1091942236 12:4498256-4498278 CTAACCAGGAGTCCAGCTGCAGG + Intronic
1092725464 12:11481275-11481297 CCAACCAGCAGATGAGCTTCAGG - Intronic
1093362910 12:18254337-18254359 CAAACCATGTGGAGAGCTGTAGG + Intronic
1094141391 12:27185557-27185579 CCAACCAAGATTAGAGGTGCAGG - Intergenic
1096606880 12:52772972-52772994 ACAATTAGGAGGAGAGCTGGGGG - Intronic
1098172704 12:67762835-67762857 CCCAACAGGAGGTGAGCAGCAGG + Intergenic
1098245200 12:68509906-68509928 CAATGGAGGAGGAGAGCTGCAGG + Intergenic
1099220449 12:79907852-79907874 CCAACCTGGAGTACAGCAGCAGG - Intronic
1101720812 12:107349105-107349127 CCAAAGAGGAGGGCAGCTGCAGG + Intronic
1101724988 12:107381494-107381516 CCAAGAAAGAGGAGAGCTCCGGG + Intronic
1101799375 12:108007353-108007375 GCAACCAAGAAGAGAGCTGCAGG - Intergenic
1104010375 12:124925977-124925999 CCAACCATAAGAAGAGCTGGAGG - Intergenic
1104662334 12:130620325-130620347 TCAGGGAGGAGGAGAGCTGCAGG - Intronic
1106999067 13:35522644-35522666 CCCAGCAGGAGGTGAGCAGCAGG + Intronic
1107067119 13:36226501-36226523 CCCAGCAGGAGGTGAGCTGCAGG - Intronic
1107455108 13:40547655-40547677 TCATCCAGAAAGAGAGCTGCAGG - Intergenic
1114190796 14:20438136-20438158 GCAACCAGGAGGACAGCTAATGG - Intergenic
1115506987 14:34102171-34102193 CCTACCTGGAGGAGAACTGAAGG - Intronic
1115524233 14:34263607-34263629 TCAACCATGCAGAGAGCTGCTGG - Intronic
1116341101 14:43724177-43724199 TCCACCTGGAGCAGAGCTGCTGG + Intergenic
1117439712 14:55748172-55748194 ACAACCAGCAGGAGAGCAGGAGG - Intergenic
1117871244 14:60202862-60202884 CAAAGCAGGAGGAGAGCTTTAGG - Intergenic
1119436307 14:74600016-74600038 CCAGCCAGGAGGGCAGCTGTTGG + Intronic
1119497319 14:75091279-75091301 CCAGCCAGGACAGGAGCTGCTGG + Exonic
1120721573 14:87894769-87894791 CCAACATGGAGGAAAGGTGCCGG - Intronic
1120990318 14:90370327-90370349 CCAAGAAGCAGGAGAGCTGGAGG + Intergenic
1121240888 14:92429197-92429219 ACAACCAGGAGTAGGGGTGCAGG + Intronic
1121437648 14:93929637-93929659 CCACCCAGGCTGAGGGCTGCTGG + Intergenic
1121798195 14:96753036-96753058 CCCAGCAGGAGGTGAGCAGCAGG + Intergenic
1121817286 14:96938323-96938345 CAAAGCAGGAGGTGAGCAGCAGG + Intergenic
1122594853 14:102883085-102883107 ACATCCAGGAGAAGAACTGCTGG - Intronic
1124096849 15:26656552-26656574 CACAGCAGCAGGAGAGCTGCAGG + Intronic
1126364631 15:47881652-47881674 CACACCAGGAGGTGAGCAGCAGG + Intergenic
1126524075 15:49630769-49630791 CACACCAAGAGGTGAGCTGCTGG + Intronic
1127863221 15:63011692-63011714 CCAGAGAGGAGGGGAGCTGCTGG - Intergenic
1127884069 15:63183798-63183820 CACACCAGGAGGTGAGCAGCAGG + Intergenic
1128259760 15:66224968-66224990 CCTCCCAGGAGGAGAGGGGCTGG - Intronic
1128461550 15:67872132-67872154 ACACCCAGGAGTAGATCTGCTGG - Intergenic
1131158960 15:90091924-90091946 CACAGCAGGAGGAGAGCTGCAGG + Intronic
1131573947 15:93567527-93567549 TGAACCAGCAGGAGAGCAGCAGG - Intergenic
1132194982 15:99907911-99907933 CCAACCAGCAGGGGAGAGGCAGG + Intergenic
1133330491 16:4970281-4970303 CCAGCCAGGCTGAGAGTTGCGGG + Intronic
1133631198 16:7623629-7623651 CACAGCAGGAGGTGAGCTGCAGG - Intronic
1134379040 16:13707371-13707393 CCCAGCAGGAGGTGAGCGGCAGG + Intergenic
1135141703 16:19927581-19927603 CCAACAGGGAGAAGAGCTTCAGG + Intergenic
1136574548 16:31115764-31115786 CCAAGCAGGAGGATCGCTTCAGG - Intronic
1137545047 16:49396856-49396878 TCTACCAGCAGGTGAGCTGCTGG - Intronic
1138441877 16:57040169-57040191 CCGACCAGGACCAGAGCTACAGG - Intronic
1138774876 16:59709150-59709172 CACACCAGGAGGTGAGCAGCAGG - Intergenic
1139287683 16:65830135-65830157 TCAACCAGGAGGAAAGCACCTGG + Intergenic
1140588918 16:76327753-76327775 CCAAAGAGGATGAGAGCTGATGG + Intronic
1140606871 16:76549366-76549388 TGGACCAGGAGCAGAGCTGCAGG - Intronic
1142267911 16:89072989-89073011 CAAAGCAGGAGGTGAGGTGCAGG + Intergenic
1142292772 16:89200517-89200539 CCAAACAGGAGGAGGGCAGGTGG + Intronic
1142674455 17:1505104-1505126 ACCAGCAGGAAGAGAGCTGCTGG - Intronic
1143066042 17:4248216-4248238 CCCAGCAGGAGGTGAGCTGCGGG + Intronic
1144585573 17:16485731-16485753 CCCACCAAGAGCAGTGCTGCCGG - Intronic
1146448726 17:32954625-32954647 GCAGCCAGGAGGAGGGCTGACGG - Intergenic
1146689371 17:34862564-34862586 CACACCAGGAGGTGAGCTGCTGG + Intergenic
1147120163 17:38330977-38330999 CCTACCTGGAGGAGACCTACCGG - Exonic
1147547496 17:41413938-41413960 CCAACCAGGGGCTGAGCTGGAGG + Intergenic
1147574756 17:41592827-41592849 CACAGCAGGAGGTGAGCTGCTGG - Intergenic
1148033356 17:44638570-44638592 CCCAGCAGGAGGTGAGCAGCAGG - Intergenic
1148318136 17:46722467-46722489 CCCAGCAGGAGGAGAGGTACTGG - Intronic
1149583119 17:57765243-57765265 CCAACCAGGCGGACAGCTTTTGG - Intergenic
1150322607 17:64228655-64228677 CACACCAGGAGGTGAGCTGTGGG - Intronic
1151416985 17:73973004-73973026 CCAGCCAGGAGGAGACGTGCGGG - Intergenic
1151625252 17:75271876-75271898 GCGACCGGGAGGAGCGCTGCCGG + Intergenic
1151669546 17:75564501-75564523 GCAGCCAGTAGGAGAGCTTCGGG + Exonic
1152660867 17:81541297-81541319 CCAACCACGAGGTGAGCACCCGG - Exonic
1152947963 17:83208344-83208366 CAAACCACAGGGAGAGCTGCCGG - Intergenic
1153602498 18:6795255-6795277 CCAGCAAGGAAGAGAGCTGGAGG + Intronic
1154350922 18:13582643-13582665 CCACCCAGGAGCAGAGCTCGTGG - Intronic
1154969739 18:21395447-21395469 CCCACCAGGAGGAATCCTGCTGG - Exonic
1155908320 18:31478994-31479016 CGTAGCAGGAGGTGAGCTGCGGG - Intergenic
1156315062 18:35962029-35962051 CAAAGCAGGAGGTGAGCAGCGGG + Intergenic
1156939968 18:42755401-42755423 ACAGCCAGGAGGAGACCTGTAGG - Intronic
1158529662 18:58247607-58247629 CGAACCAGGAGGCGGGCAGCAGG - Intronic
1161698973 19:5784791-5784813 CCAACCAGTGGGCGCGCTGCAGG - Intronic
1164540911 19:29120923-29120945 CCAGGCTGCAGGAGAGCTGCAGG + Intergenic
1164710782 19:30355691-30355713 TCAAGCAGGAGCTGAGCTGCAGG + Intronic
1165007175 19:32816808-32816830 CCAGCCAGGAGGAAAACAGCAGG + Intronic
1165789246 19:38481610-38481632 CCAACCAGCAGGAGAGCTGCAGG + Intronic
1166884607 19:45952799-45952821 GAAGCCTGGAGGAGAGCTGCAGG - Intronic
1168249279 19:55132591-55132613 ACATCCAGGAGGGGAACTGCTGG + Intergenic
925379890 2:3417346-3417368 CCCGGCAGGAGGAGAGCAGCAGG - Intronic
925522455 2:4762031-4762053 CCACCCAGGAGGGGGACTGCTGG + Intergenic
926196986 2:10769945-10769967 CCAATCAGGGGGAGGGCAGCTGG - Intronic
927274435 2:21250551-21250573 CCAATCAGCATGAAAGCTGCAGG - Intergenic
927319101 2:21721915-21721937 CTAAGCAGTAGCAGAGCTGCTGG + Intergenic
927529657 2:23783577-23783599 CTAACCAGTACGAGATCTGCTGG + Intronic
927565070 2:24104715-24104737 CCACACAGAAGCAGAGCTGCTGG - Intronic
930088484 2:47515140-47515162 CCAACAGAGAGGAGAGCTGATGG + Intronic
930090027 2:47525374-47525396 CCAGCTAGGAAGTGAGCTGCCGG - Intronic
931459307 2:62436485-62436507 CGAGCAAGGAGGAGAGATGCAGG + Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
934170671 2:89538607-89538629 AGAAGCAGGAGGAGAGCAGCTGG + Intergenic
934280974 2:91612927-91612949 AGAAGCAGGAGGAGAGCAGCTGG + Intergenic
934662200 2:96148958-96148980 CCACCCAGGAGCAGGGCTGCTGG + Intergenic
935011463 2:99140805-99140827 ACAACCAAGCGGAGAGCTGCGGG + Intronic
935682616 2:105651264-105651286 CACAGCAGGAGGTGAGCTGCTGG - Intergenic
936558651 2:113517666-113517688 CCTACCAGTAGGAGTGGTGCAGG + Intergenic
937247336 2:120502091-120502113 CCAGGCAGGAGCAGAGGTGCTGG + Intergenic
937363032 2:121242296-121242318 TCCACCAGGAGCAGGGCTGCTGG - Intronic
937473085 2:122190337-122190359 GGAACCAGGAGGAGACCTACAGG + Intergenic
937973238 2:127565849-127565871 GGAACCAGGATGAGAGCTTCAGG - Intronic
940375124 2:152949041-152949063 CACAGCAGGAGGTGAGCTGCAGG - Intergenic
940428014 2:153552958-153552980 CACAGCAGGAGGTGAGCTGCAGG - Intergenic
941476419 2:165956148-165956170 CACAGCAGGAGGTGAGCTGCGGG - Intergenic
941547325 2:166868256-166868278 CCACACAGCAGGAGAGCGGCAGG + Intergenic
942369278 2:175264768-175264790 TCAGCCTGGAGGAGAGTTGCCGG + Intergenic
947768387 2:232651958-232651980 CCAGCCTGGGGCAGAGCTGCGGG + Intronic
948508067 2:238444402-238444424 CCACCAAGGAGGTGAGCCGCCGG - Exonic
948893221 2:240916930-240916952 CCAACCAGGAGGAGAGCTGCTGG - Intergenic
1169117192 20:3073112-3073134 ACAGGCAGGAGTAGAGCTGCTGG - Intergenic
1169848329 20:10021428-10021450 CCAACCATGAGGCAAGGTGCTGG + Intronic
1171516263 20:25740230-25740252 CAAACCAGGAGGAGAGCCATTGG + Intergenic
1171892468 20:30728669-30728691 CCGTGGAGGAGGAGAGCTGCGGG + Intergenic
1173006357 20:39142582-39142604 CCATCCAGGATGAGAGGTCCTGG - Intergenic
1173609409 20:44355774-44355796 CCACCCAGCCGGAGAGCTGGGGG - Intronic
1173833520 20:46109190-46109212 CCCAGCAGGAGGTGAGCGGCTGG + Intergenic
1174042123 20:47707516-47707538 CCTCCCAGGTGGAGAGCTTCTGG + Intronic
1174452111 20:50626636-50626658 CCTGGCAGGAGGAGAGCTGCAGG + Intronic
1174852328 20:54007182-54007204 CCAATCAGGACAGGAGCTGCGGG - Intronic
1175249431 20:57600210-57600232 CCAGAGAGGAGGAGAGCAGCTGG + Intergenic
1176266824 20:64213807-64213829 CCCCCCAGGAGCAGAACTGCGGG + Intronic
1178824705 21:36005171-36005193 AGAAGCAGGAGGAGAGCTGGCGG + Intergenic
1180022421 21:45136721-45136743 GCAACCTGGGGGAGAGCGGCAGG - Intronic
1180057929 21:45368623-45368645 CTGCCCAGCAGGAGAGCTGCAGG - Intergenic
1180606988 22:17066303-17066325 CCACCCATCTGGAGAGCTGCAGG + Intergenic
1180787745 22:18556486-18556508 CCACCCAGCTGGAGAGCAGCCGG - Intergenic
1181914259 22:26266667-26266689 GCAACCAGGATGAGAGCTATGGG - Intronic
1182011885 22:27007935-27007957 GCACCCATGAGGAGAGCTGCAGG + Intergenic
1183601304 22:38842203-38842225 CCACCCAGGTGGAGTGCAGCAGG - Intronic
1183723686 22:39576787-39576809 CCACCCACGAGGAGGGCGGCCGG - Intronic
1183956521 22:41383285-41383307 CAAAGCAGGAGGAGAGAGGCTGG - Intronic
1184022627 22:41831295-41831317 CTAACCGGTAGGAGAACTGCCGG - Intergenic
1184610476 22:45600028-45600050 CCAACCTGGAGGAAAGTTGTGGG - Intronic
949577980 3:5357427-5357449 CCAAAGAGGAAGAGACCTGCAGG - Intergenic
950001685 3:9661454-9661476 GGAACCAGGAGGTGAGCAGCAGG - Intronic
950655270 3:14432570-14432592 GCACCCTGGAGCAGAGCTGCAGG + Intronic
951984938 3:28608564-28608586 CCAACCAGGAGCACAACCGCTGG - Intergenic
954505718 3:51070770-51070792 CACATCAGGAGGTGAGCTGCCGG + Intronic
955334237 3:58071746-58071768 ACAACCAGGAGAGAAGCTGCTGG + Intronic
958920235 3:100097037-100097059 CAAAGCAGGAGGTGAGCAGCAGG + Intronic
959620755 3:108396515-108396537 CACAGCAGGAGGTGAGCTGCAGG - Intronic
960908986 3:122629962-122629984 CCCAGCAGGAGGTGAGCGGCAGG - Intronic
961502853 3:127350079-127350101 CCGCCCAGGCGGAGAGGTGCTGG + Intergenic
961533503 3:127554950-127554972 CCACAGAGGAGGAGAGCAGCTGG + Intergenic
962207350 3:133445983-133446005 TCAACCAGAAGGAGAACTCCAGG + Intronic
963361639 3:144280924-144280946 ACTAGCAGGAGGTGAGCTGCAGG + Intergenic
963744786 3:149115284-149115306 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
966850892 3:184164485-184164507 CCCACCAGCATGAGGGCTGCAGG - Exonic
966862234 3:184236878-184236900 CCAATCAGGGGAAGAGCTGTTGG + Intronic
967196524 3:187031050-187031072 CCAACCAGATTGAGAGCTCCTGG - Intronic
967786283 3:193500668-193500690 CACAGCAGGAGGTGAGCTGCTGG - Intronic
968641613 4:1717675-1717697 CCTGCAGGGAGGAGAGCTGCTGG + Exonic
968723250 4:2223305-2223327 CACAGCAGGAGGAGAGCAGCAGG + Intronic
968920345 4:3519144-3519166 ACAAACCGGAGAAGAGCTGCCGG + Intronic
969029123 4:4197271-4197293 AGAAGCAGGAGGAGAGCAGCTGG - Exonic
969432771 4:7165734-7165756 CCAAGCAGGAGGAGGGCATCGGG - Intergenic
971257285 4:25026514-25026536 CCAGCCAGAAATAGAGCTGCGGG - Intronic
972104109 4:35461405-35461427 CAAGCCATGAGGAGATCTGCTGG + Intergenic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
973239544 4:47942640-47942662 CACAGCAGGAGGTGAGCTGCAGG + Intronic
973603713 4:52566254-52566276 CCACCCAGGAGCAGAGTGGCAGG + Intergenic
973724771 4:53764299-53764321 CCCACCCGGAGGAGACCTGGAGG - Intronic
975240053 4:72046760-72046782 CCAAACAAGAGGAGAGCTGTAGG + Intronic
981980096 4:150781505-150781527 CCATGCAGGAGGTGAGCGGCAGG - Intronic
982155493 4:152516261-152516283 CACAGCAGGAGGTGAGCTGCAGG + Intronic
983562515 4:169115304-169115326 CACAGCAGGAGGTGAGCTGCAGG + Intronic
985650292 5:1104428-1104450 CCCACCATGAGGACAGCTCCAGG + Intronic
985894728 5:2741475-2741497 CCAAAAAGGAGGAGAGGTGTAGG + Intergenic
986151353 5:5133109-5133131 CCTGCCAGCAGGAGAGCTGGGGG - Intergenic
986336874 5:6762082-6762104 GCAACCAGGGTGGGAGCTGCAGG - Intergenic
993033304 5:82729128-82729150 CCATCCCAGAGGAGAGCTGCAGG + Intergenic
993859988 5:93124418-93124440 CAGAGCAGGAGGTGAGCTGCCGG + Intergenic
993887584 5:93434271-93434293 CCAAACAGAAGGAGAGTTCCAGG + Intergenic
995354391 5:111222322-111222344 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
998168329 5:139857097-139857119 CCCAGAAGGAGGAGAGCAGCTGG - Intronic
999319700 5:150606220-150606242 CCAAGCTGGAGGACAGATGCTGG + Intronic
1000011805 5:157240228-157240250 CCCAGCAGGAGGTGAGCAGCAGG + Intronic
1001296846 5:170504442-170504464 CCAAGCTGCAGGCGAGCTGCCGG + Intronic
1001350194 5:170954916-170954938 CATAGCAGGAGGTGAGCTGCAGG + Intronic
1001691693 5:173638149-173638171 CCAAACAGCCTGAGAGCTGCTGG + Intergenic
1002742129 5:181441499-181441521 CAAACCACAGGGAGAGCTGCCGG - Intergenic
1003480587 6:6528518-6528540 CCAAGGAGGAAGAGAGATGCAGG + Intergenic
1003975692 6:11341651-11341673 CCATCCAATAGGACAGCTGCTGG - Intronic
1005297768 6:24443430-24443452 CCACCCAGAAGGAAAGCTGAGGG - Intronic
1006305301 6:33215019-33215041 CCAAGCAGGAGGATCACTGCAGG + Intergenic
1008046087 6:46852758-46852780 CCAACCACGTGGAAAGCTCCTGG - Exonic
1012553998 6:100490201-100490223 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
1013725404 6:113089249-113089271 CCCAGCAGGAGGCGAGCTTCCGG - Intergenic
1014350779 6:120342490-120342512 CCACACAGAAGGTGAGCTGCGGG + Intergenic
1015147713 6:130005981-130006003 CCCAGCAGGAGGTGAGCAGCAGG - Intergenic
1015294716 6:131577379-131577401 GCACCCAGGAGTAGAACTGCTGG - Intronic
1017719783 6:157236309-157236331 CCACCCAGGCGGAGCGCGGCGGG + Intergenic
1018512503 6:164540518-164540540 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
1019247264 6:170717237-170717259 CAAACCACAGGGAGAGCTGCCGG - Intergenic
1019881211 7:3863001-3863023 CACAGCAGGAGGCGAGCTGCTGG - Intronic
1020003415 7:4768556-4768578 CCATCCAGCAGCAGAGCTGAGGG - Exonic
1020020605 7:4865120-4865142 CCAACCAGGTAGAGAGCAGTGGG - Intronic
1021976233 7:26013427-26013449 CAAGGCAGGAGGACAGCTGCTGG - Intergenic
1022107227 7:27205218-27205240 CCACCCAGGAAGTGACCTGCGGG + Intergenic
1022540340 7:31129018-31129040 GCAAACAGGAAGTGAGCTGCTGG - Intergenic
1022665668 7:32407904-32407926 CCAAGCAGCAGCAGACCTGCAGG + Intergenic
1024332028 7:48164502-48164524 CGAAGCAGGAGGTGAGCAGCAGG - Intergenic
1024578684 7:50784434-50784456 CCATCCAGGCTGGGAGCTGCTGG - Intronic
1027494717 7:78873314-78873336 CACAGCAGGAGGTGAGCTGCGGG + Intronic
1028217043 7:88146546-88146568 CCATCTAGGAGGGGTGCTGCTGG - Intronic
1029241642 7:99167335-99167357 CCCAGCAGGAGGTGAGCAGCAGG + Intergenic
1031122694 7:117739478-117739500 CCAACCTGCAGGAGAGGAGCAGG - Intronic
1031166829 7:118239169-118239191 CACAGCAGGAGGTGAGCTGCAGG + Intronic
1032025371 7:128437527-128437549 ACAACTAGGAGTAGAACTGCTGG - Intergenic
1033149052 7:138897353-138897375 CCAACCAAGATGAGAGCTGATGG - Intronic
1033356972 7:140607830-140607852 CCAGCTTGGAAGAGAGCTGCTGG - Intronic
1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG + Intergenic
1034338331 7:150337502-150337524 CCATCCTGGAGGAGGCCTGCCGG + Exonic
1034396760 7:150831929-150831951 CAATCCATGAGAAGAGCTGCTGG + Intronic
1035500871 8:90698-90720 CAAACCACAGGGAGAGCTGCCGG + Intergenic
1035682784 8:1500565-1500587 CCCACTGGGAGGAGAGCTACGGG + Intergenic
1037311574 8:17561937-17561959 CCCAACACGAGGAAAGCTGCAGG - Exonic
1037903615 8:22702769-22702791 CCTACCAGAAGGTGAGCTCCAGG + Intergenic
1038120124 8:24603768-24603790 CCATCCAGGAGGTGATCTCCAGG - Intergenic
1038901423 8:31848550-31848572 CGCAGCAGGAGGCGAGCTGCAGG + Intronic
1039013903 8:33124966-33124988 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
1040901397 8:52420313-52420335 CAAACCAGGAGCAGAGGTGCAGG - Intronic
1041148185 8:54902170-54902192 GCAATCTGGAGAAGAGCTGCAGG + Intergenic
1041351191 8:56949519-56949541 CACAGCAGGAGGTGAGCTGCAGG + Intergenic
1042362854 8:67902284-67902306 CAAACCAGGAAGGGAGCAGCAGG - Intergenic
1044519921 8:93187533-93187555 CATAGCAGGAGGTGAGCTGCGGG - Intergenic
1044973426 8:97642027-97642049 CCAACCCGGTGCAGAGCTGCAGG + Intergenic
1046957144 8:120073408-120073430 CTCCCCAGGAGCAGAGCTGCAGG - Intronic
1048587034 8:135783635-135783657 CCCAGCAGGAGGTGAGCAGCAGG + Intergenic
1049250819 8:141588137-141588159 CCCACCAGCAGGACAGCTTCTGG + Intergenic
1049275739 8:141719285-141719307 CCGACCATGAGGAGGGCTGCTGG - Intergenic
1049894196 9:98505-98527 CCTACCAGTAGGAGTGGTGCAGG - Intergenic
1050088634 9:1993074-1993096 CACATCAGGAGGGGAGCTGCAGG - Intergenic
1051554344 9:18365787-18365809 CAAAACAGGAGGGGAGCAGCTGG + Intergenic
1052877824 9:33580577-33580599 CCATCCATGAGGGCAGCTGCGGG + Intergenic
1053391641 9:37740453-37740475 ACAGCCAGGAGGAGAGAAGCGGG + Exonic
1053735423 9:41098594-41098616 CCTACCAGTAGGAGTGGTGCAGG - Intergenic
1054356356 9:64067066-64067088 CCGAGGAGAAGGAGAGCTGCGGG - Intergenic
1054692955 9:68332807-68332829 CCTACCAGTAGGAGTGGTGCAGG + Intronic
1056845410 9:90033142-90033164 ACCACCAGGAGGTAAGCTGCGGG - Intergenic
1057130387 9:92650608-92650630 CCAGCCAAGGGGAGAGGTGCAGG - Intronic
1057910444 9:99016049-99016071 CCCATCAGGGGGAGGGCTGCCGG - Exonic
1058176823 9:101745393-101745415 CCAACCAGAAGAAGAACTTCAGG - Intergenic
1059348008 9:113645373-113645395 CACAGCAGGAGGTGAGCTGCGGG + Intergenic
1059885850 9:118743872-118743894 CCCAGCAGGAGGTGAGCAGCAGG - Intergenic
1059959743 9:119553325-119553347 CCACCCAGGTGGTGACCTGCTGG - Intergenic
1060931601 9:127492609-127492631 CCCACAAGGAAGAGAGATGCGGG + Intronic
1060985385 9:127816465-127816487 CAATCCAAGAGCAGAGCTGCAGG - Intronic
1062061299 9:134496738-134496760 GTAGCCAGGAGGAGAGATGCTGG - Intergenic
1062227644 9:135462388-135462410 CCAGCCAGGTGGAGAGTGGCGGG + Intergenic
1062248517 9:135582784-135582806 CGAAGCAGGAGGTGAGCGGCAGG - Intergenic
1203561831 Un_KI270744v1:64189-64211 CCGCGGAGGAGGAGAGCTGCGGG + Intergenic
1203608039 Un_KI270748v1:72714-72736 CAAACCACAGGGAGAGCTGCCGG - Intergenic
1185865524 X:3620495-3620517 CACACCAGGAGGTGAGCAGCAGG + Intronic
1186002807 X:5032907-5032929 CTATCCAGGATGAGAGCTCCTGG - Intergenic
1186287586 X:8062381-8062403 CACACCAGGAGGTGAGCAGCGGG + Intergenic
1188612663 X:32118984-32119006 CACATCAGGAGGTGAGCTGCAGG - Intronic
1189251371 X:39602737-39602759 CCACCCAGGATGAGATCTGGTGG - Intergenic
1189465873 X:41277100-41277122 CCCACCATGACCAGAGCTGCTGG + Intergenic
1192356698 X:70410772-70410794 CACAGCAGGAGGTGAGCTGCAGG - Intronic
1192619436 X:72662566-72662588 CCAACCAGGGGCAGGGCTGCTGG - Intronic
1195656225 X:107333940-107333962 CACAGCAGGAGGTGAGCTGCAGG - Intergenic
1195668148 X:107449122-107449144 GTGACCAGGAGGGGAGCTGCAGG + Intergenic
1200091402 X:153637794-153637816 ACAGGCAGGAGGGGAGCTGCTGG - Intergenic
1201534430 Y:15030555-15030577 CATAGCAGGAGGAGAGCAGCGGG - Intergenic