ID: 948894011

View in Genome Browser
Species Human (GRCh38)
Location 2:240919896-240919918
Sequence CTGTCTCCACGGTGGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948894011_948894023 12 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894023 2:240919931-240919953 AGTGTGGGTGGGCCCTGGTCTGG 0: 1
1: 1
2: 4
3: 28
4: 304
948894011_948894019 -3 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894019 2:240919916-240919938 CAGGGCACAAGGCTGAGTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 288
948894011_948894021 1 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894021 2:240919920-240919942 GCACAAGGCTGAGTGTGGGTGGG 0: 1
1: 0
2: 2
3: 21
4: 221
948894011_948894018 -4 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894018 2:240919915-240919937 ACAGGGCACAAGGCTGAGTGTGG 0: 1
1: 0
2: 0
3: 34
4: 360
948894011_948894024 21 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894024 2:240919940-240919962 GGGCCCTGGTCTGGCCACCCAGG 0: 1
1: 0
2: 4
3: 41
4: 474
948894011_948894022 7 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894022 2:240919926-240919948 GGCTGAGTGTGGGTGGGCCCTGG 0: 1
1: 1
2: 5
3: 54
4: 541
948894011_948894020 0 Left 948894011 2:240919896-240919918 CCAGGGTCCCACCGTGGAGACAG 0: 1
1: 0
2: 2
3: 16
4: 197
Right 948894020 2:240919919-240919941 GGCACAAGGCTGAGTGTGGGTGG 0: 1
1: 0
2: 2
3: 42
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948894011 Original CRISPR CTGTCTCCACGGTGGGACCC TGG (reversed) Intronic
900369406 1:2324701-2324723 GTGTCTCCACGGGGAGGCCCCGG - Intronic
900698347 1:4027026-4027048 CTGTCCCCAAGGTGGGATCATGG - Intergenic
900856562 1:5189965-5189987 CCATCTCCACTGTGGGACCAAGG + Intergenic
902513691 1:16979200-16979222 CTGGCTACACGGTGGGACTTGGG + Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903005518 1:20295648-20295670 CTGTCTCCACAGTGGCACCCAGG - Intronic
903450356 1:23449646-23449668 GTGGCTCCATGGTGGGAGCCAGG + Intronic
905000311 1:34662976-34662998 CTGTCTTCAAGCTGGGACACTGG + Intergenic
905202310 1:36323157-36323179 CTCTCTCCAGGGTGGAACCTGGG - Intronic
905443990 1:38012929-38012951 CTGTCGCCACCGTGGGATCCGGG + Intronic
912505053 1:110150617-110150639 CTCTCTCCGCCGTGGGACCTGGG + Exonic
912910967 1:113759074-113759096 CCGGCCTCACGGTGGGACCCCGG - Exonic
912968378 1:114257450-114257472 CTGTCTTTAAGGTTGGACCCTGG - Intergenic
914971161 1:152308995-152309017 CTGTCTTCGTGATGGGACCCAGG + Exonic
916039731 1:160951717-160951739 CTGGCTCCACGGTGGCATCCTGG + Intronic
916942397 1:169689505-169689527 CTGTCTCCGTGATGTGACCCTGG - Intronic
921213126 1:212916611-212916633 CTCTCTCCACCGTGGCTCCCGGG + Intergenic
922786028 1:228282714-228282736 CTGTCACCACGGTGGGACTTGGG - Intronic
923380202 1:233410060-233410082 CGGTCTCCACGGTGGCAGGCTGG - Intergenic
923485833 1:234430181-234430203 CTCTCTCCATGCTGGGCCCCTGG - Exonic
923498555 1:234545458-234545480 CTGTCTCCCCAGTGTGAGCCTGG - Intergenic
1062976506 10:1687708-1687730 CTGTCTCCAGCCTTGGACCCGGG - Intronic
1063153144 10:3354953-3354975 CTGCCTCCAGGGTGGGCTCCAGG + Intergenic
1067131106 10:43566228-43566250 CTCAGTCCACAGTGGGACCCTGG - Intronic
1067148817 10:43712861-43712883 CTGTGTGCAAGGTGGGATCCTGG - Intergenic
1069907099 10:71738418-71738440 CTGGACCCACGGTGGGACCCAGG + Intronic
1072210667 10:93243949-93243971 CTGTCTTCAAGGTGGGAAACTGG - Intergenic
1072747221 10:97949303-97949325 CTGTCTTCTCTGTGGGACCAGGG - Intronic
1073357697 10:102870056-102870078 CTCACTCCACTGTGGGACGCTGG + Intronic
1074701277 10:116094904-116094926 CTGGTGCCACGGTGGGCCCCTGG + Intronic
1075274911 10:121084706-121084728 CTGTCTCCTCGGGGAGTCCCAGG + Intergenic
1075585131 10:123651891-123651913 CGGTCCCCATGATGGGACCCTGG - Intergenic
1075713167 10:124541599-124541621 CTGTCCCCACGGGTGGTCCCAGG - Intronic
1075715007 10:124550900-124550922 CAGCCTCCTCTGTGGGACCCAGG - Intronic
1077474703 11:2780800-2780822 CTCTCTCCAATGTGGGTCCCTGG - Intronic
1077662220 11:4079890-4079912 CTGTCTCTAGGTTGGGACCCAGG + Intronic
1078474318 11:11618562-11618584 CTGTCTCCCAGGAGGGCCCCAGG - Intronic
1079110563 11:17602865-17602887 CTGTCTCCTCGATGGGACTGTGG - Intronic
1081537526 11:44006262-44006284 CTGCCACCAAAGTGGGACCCAGG + Intergenic
1081666443 11:44919671-44919693 CTGTCACCACTGTGTGACCATGG - Intronic
1083484539 11:62975144-62975166 CTGCCTTCCAGGTGGGACCCTGG - Intronic
1083961068 11:66015373-66015395 CTCACTCCCAGGTGGGACCCAGG - Intergenic
1091831127 12:3551825-3551847 CTGTCTCCACTCTGGGACGATGG - Intronic
1093473752 12:19532735-19532757 CTGTCTTCACTGTGAGAACCTGG + Intronic
1095247496 12:39939957-39939979 CTGTCTCCACCATGGGACTCTGG - Intronic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1098347825 12:69524538-69524560 GTGTGGCCAGGGTGGGACCCTGG + Intronic
1101015082 12:100491732-100491754 CTGTGTCCACTGTGGGTTCCAGG - Intronic
1101151053 12:101882755-101882777 CAGTCTCCATGGTGGGACTTGGG + Intronic
1102036147 12:109771533-109771555 CTGTGTCCAGGGCGGGACCCAGG + Intergenic
1102611241 12:114114274-114114296 CTGGCTCCATGGTGGGAGGCTGG - Intergenic
1107235874 13:38169679-38169701 GTGTTTCCAAGGTGGGATCCTGG - Intergenic
1107518660 13:41157824-41157846 CTGTCTCCCCAGTGGATCCCAGG + Intergenic
1111304091 13:86383176-86383198 TTGCCTCCACTGTGGGAACCAGG - Intergenic
1113598277 13:111549402-111549424 CTGTCTCCACAGGGTGATCCTGG - Intergenic
1113870661 13:113557943-113557965 CTCTCTGCCTGGTGGGACCCAGG + Intergenic
1118106095 14:62661466-62661488 CTTTCTCCACGGTGTGTTCCTGG - Intergenic
1119323325 14:73744290-73744312 CTGTGGCCACTGTGGGACCAGGG + Intronic
1120032060 14:79653059-79653081 CTGTCTGCACGTGGGGACTCTGG - Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1121330447 14:93046340-93046362 CTGTCCCCACCGTGGGGCCCCGG - Intronic
1121522208 14:94593879-94593901 CTGTCACCAGCGTGGGACCCTGG - Intronic
1122792021 14:104187998-104188020 CTCTCTCCTCGGTGGGCTCCTGG + Intergenic
1123122807 14:105925892-105925914 CTGACTCCGCCGTGGAACCCAGG - Intronic
1125691703 15:41601170-41601192 CTGTCTCCCCTCTTGGACCCTGG - Intergenic
1127555428 15:60082803-60082825 CTGTGTCCTCTCTGGGACCCAGG - Intergenic
1127883067 15:63174957-63174979 CTCTCTACACAGTGGGCCCCAGG + Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129172186 15:73814992-73815014 CTGGTTCCATGGTGGGCCCCAGG + Intergenic
1129698843 15:77755959-77755981 CTGACTCCTCGGTGGGAGCAGGG + Intronic
1129739146 15:77981593-77981615 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1129846813 15:78771596-78771618 CAGGCTCCTTGGTGGGACCCGGG + Exonic
1129977428 15:79833875-79833897 CTGTGCCCATGGTGGGAACCAGG - Intronic
1130255087 15:82322295-82322317 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1130599887 15:85267711-85267733 CAGGCTCCTTGGTGGGACCCGGG + Intergenic
1130873202 15:87989008-87989030 ATTTCTCCACTGTTGGACCCAGG - Intronic
1130996585 15:88907655-88907677 CTGTCCCCACAGTGCTACCCTGG - Intronic
1131221550 15:90588808-90588830 GTGTCTGCATGGTGGAACCCTGG - Intronic
1131529683 15:93180684-93180706 GTGTCTCCGCCGTGGGAACCTGG - Intergenic
1132473135 16:117995-118017 CTGTCTACAGGGTGTGACCGCGG + Intronic
1132799572 16:1745227-1745249 CTTCCTCCACGCTGGGTCCCCGG - Intronic
1133319128 16:4902293-4902315 CTGTCTCCCTGGTAAGACCCGGG + Intronic
1135394020 16:22117222-22117244 CTGCCTCCAAGGTTGTACCCAGG + Intronic
1139545531 16:67647967-67647989 CTGTCTTCAGGGTGGGAGCTTGG + Intronic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1142643867 17:1299897-1299919 CTGTCTACAGGGAGGGGCCCTGG + Exonic
1143672441 17:8405878-8405900 CAGTCTCCACAGTGAGACCAGGG + Intergenic
1144178529 17:12731190-12731212 CTGGCTCCGTGGTGTGACCCTGG - Intronic
1146739298 17:35267946-35267968 CTGTGTCCACGGAGAGTCCCTGG - Exonic
1147167901 17:38603140-38603162 CTTTTTCCAGGGTGGGTCCCTGG + Intronic
1148237405 17:45978105-45978127 CTTTCTCCACTTTGGGACCAGGG - Intronic
1149394681 17:56227614-56227636 CTGTCTCCAAGATTGGACCTGGG + Intronic
1151980042 17:77503248-77503270 CTGTCCCCAAGGAGAGACCCAGG + Intergenic
1154078572 18:11230646-11230668 CTGTCTTCAAGCTGGGACACTGG + Intergenic
1155172897 18:23280317-23280339 CGGTCTCCACTGTGAGACCAAGG + Intronic
1158554665 18:58465528-58465550 CTGTTACCATGGTGGGCCCCTGG - Intergenic
1158908537 18:62037449-62037471 TTGTCTGCACGATGGGGCCCTGG - Intergenic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160775987 19:855946-855968 CTGCCTCCACAGGGGGACTCCGG + Exonic
1161250179 19:3276082-3276104 CTGGCTCTGGGGTGGGACCCTGG + Intronic
1161410786 19:4116069-4116091 GTGTCTCCTCGGTGAGACCACGG + Intronic
1161914425 19:7218012-7218034 CTGTCTCCACTGTGGGAGGATGG + Intronic
1163054210 19:14706174-14706196 CTGTGTCCAGGGTGGAGCCCAGG - Intronic
1163104240 19:15114467-15114489 CTGTGTCCATGCTGGAACCCAGG - Exonic
1163714092 19:18864033-18864055 CTGTCTCCAGGGAGAGCCCCTGG + Intronic
1163979123 19:20882064-20882086 CAGTCACCACAGTGGGAACCAGG + Intergenic
1164536040 19:29087304-29087326 TGGTACCCACGGTGGGACCCTGG - Intergenic
1164705728 19:30318034-30318056 CCGTCTCCACAGTGGCACGCAGG + Intronic
1165167131 19:33864530-33864552 CTGTCTACAGGGTGGAAGCCAGG + Intergenic
1165347444 19:35257749-35257771 CTTTCACCAGGGTGGGACCAGGG - Intronic
1166081142 19:40444634-40444656 CTGGCTCCACGGTGGAGTCCAGG - Exonic
1167322384 19:48805290-48805312 CTGTCCCCACATGGGGACCCAGG - Intronic
1167511795 19:49899082-49899104 CATTCCCCACTGTGGGACCCAGG - Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
926274298 2:11391806-11391828 CTGTCTCCATGGTGAAACCAAGG - Intergenic
927135655 2:20094359-20094381 CTGCCTCCCCACTGGGACCCAGG - Intergenic
927193846 2:20534492-20534514 CTGACTCCAGGGTGGGGACCAGG + Intergenic
928126528 2:28620430-28620452 CTGTCTCAGCGCTGGGACCTGGG - Intronic
928294167 2:30068511-30068533 CTGTCTCTAAGGTGAGACCTTGG - Intergenic
929876321 2:45799982-45800004 CTGTTTCCATGGTGGGTCCTGGG + Intronic
932775719 2:74527236-74527258 CTGCCTCCAAGGTGAGACCCAGG - Exonic
933752619 2:85612590-85612612 CTGTCCCCGCGGGAGGACCCAGG + Intronic
938407859 2:131042612-131042634 CTGTGTCTAGGGTGGGGCCCTGG - Intronic
939007537 2:136806784-136806806 TGGTATCCAGGGTGGGACCCTGG - Intronic
941367241 2:164622696-164622718 CTGTCTTCACGGAGTGCCCCAGG - Intergenic
946130314 2:217601535-217601557 CTGTTTCCTTGGTTGGACCCTGG + Intronic
947103117 2:226642620-226642642 TTGGCTCCACAGTGGGAACCAGG - Intergenic
947936001 2:234004123-234004145 CTGTCTCCCAAGTGGGCCCCTGG + Intronic
948179346 2:235967186-235967208 CTGGCTCCAAGGAGGGAGCCTGG - Intronic
948386648 2:237584915-237584937 CTGTCTGCAGAGGGGGACCCTGG - Intronic
948894011 2:240919896-240919918 CTGTCTCCACGGTGGGACCCTGG - Intronic
949065536 2:241988042-241988064 CGGTCTCCCCGGTGTGTCCCGGG - Intergenic
1168917082 20:1499083-1499105 CTTTCTCCAGGATGGGTCCCAGG + Intergenic
1169532497 20:6500931-6500953 CTGTCTTCATGCTGGGAACCAGG - Intergenic
1170316562 20:15047889-15047911 ATGTCTTCACTGTGGGTCCCAGG - Intronic
1175418794 20:58818323-58818345 CTGTCAGCACTGGGGGACCCGGG - Intergenic
1176072880 20:63235978-63236000 CTGTCCCCAGGGTGGGCCCCGGG + Exonic
1180140881 21:45892846-45892868 CCGTCTCCACTGTGGGTGCCAGG + Intronic
1183151588 22:36042055-36042077 TTGTCTTCACTCTGGGACCCAGG + Intergenic
1183351205 22:37335648-37335670 CTGCCTCCAGGGAGGGAGCCTGG + Intergenic
1183587356 22:38760680-38760702 CTGTCTCCACGCAGGGGGCCTGG - Intronic
1184111424 22:42397846-42397868 CTGTCTACACAGTGAGTCCCGGG - Exonic
1184244345 22:43228367-43228389 CTGTCTTCCCAGTGGTACCCTGG + Intronic
1184495045 22:44835953-44835975 CGGCCTCCAGGGTGGGACACTGG + Intronic
1184774040 22:46614595-46614617 CTGTCTCCACGGTTGGCCCCTGG - Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
950220482 3:11191638-11191660 CTGTCTCCATGCTGGCCCCCAGG - Intronic
953240517 3:41144636-41144658 CTGTTTCCACAGTGGCCCCCTGG - Intergenic
954135959 3:48582348-48582370 CTCTCTCCACAGGGGGAGCCTGG - Exonic
954362002 3:50126943-50126965 CTGCCTCCAAGGTGCCACCCTGG + Intergenic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
955688048 3:61564030-61564052 CTGCCTCTACGGTAGGACACTGG + Intronic
961829831 3:129617783-129617805 CCCTCTGCACGGTGGGACCTTGG + Intergenic
966681170 3:182643574-182643596 CTGTCTCCAAGGAGGGGTCCTGG - Intergenic
968495497 4:913158-913180 CTGTCACCACGCTGGGCACCAGG - Intronic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
968678036 4:1896082-1896104 CTTACTACACTGTGGGACCCCGG - Intronic
969323369 4:6426392-6426414 CTGGCTCCAGGGTGGGACTAGGG + Intronic
969411632 4:7032148-7032170 CTGTCTTCACGGGGGGGTCCCGG + Exonic
970011378 4:11463379-11463401 CTCTTTCCATGGTGAGACCCGGG + Intergenic
973681816 4:53328237-53328259 CTGTGTCCACTGTGAGGCCCTGG + Intronic
982088587 4:151861246-151861268 CTGCCTCCACTGTGGCCCCCTGG + Intergenic
985701838 5:1378167-1378189 CTGTGTCCACTGGGGGACCTCGG - Intergenic
998206474 5:140160531-140160553 ATGTCACCACGGGGGGACACTGG - Intergenic
1002300791 5:178256387-178256409 ATGTCTCCACAGGGGGAGCCTGG - Exonic
1006225611 6:32534595-32534617 CCGTGGCCATGGTGGGACCCCGG + Intergenic
1006295545 6:33168545-33168567 CATTCTCCCCGGTGGGACCAGGG + Exonic
1007297393 6:40835633-40835655 TTGTCTCCACGGTGGTTCCAAGG - Intergenic
1007861355 6:44912558-44912580 CTCTCTACACTGTGGGACCTGGG + Intronic
1008421924 6:51311044-51311066 CTTTCTACAGAGTGGGACCCTGG - Intergenic
1011795190 6:90945489-90945511 CTTTCTCCACAGTGTGTCCCAGG - Intergenic
1019310438 7:357784-357806 CTGTCTCCAAGCAGGGTCCCAGG - Intergenic
1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG + Intronic
1019894476 7:3972921-3972943 CCGTCTCCAGGGTGGCCCCCAGG - Intronic
1020260727 7:6529468-6529490 CTGTCCCCCAGGTGGGAACCAGG + Intronic
1023057072 7:36299220-36299242 ATGTGTCCACCCTGGGACCCAGG + Exonic
1033025056 7:137764202-137764224 CTTTGTCCAGGGTGGCACCCTGG + Intronic
1033171762 7:139091011-139091033 CTTTCTCCACCCTGTGACCCTGG + Intronic
1033172286 7:139094754-139094776 CAGTCTCCAGGGTGTGGCCCAGG - Intronic
1035617128 8:1010902-1010924 CAGTCTACACAGTGGGCCCCAGG + Intergenic
1035680133 8:1481936-1481958 CCTTCTCCACGGGGGGACCCTGG - Intergenic
1035754447 8:2021269-2021291 CTGTCTCCCCCGTGGCACTCAGG + Intergenic
1035848870 8:2894125-2894147 CTGTCTCCGAGGTGGGGCCCTGG - Intergenic
1035848877 8:2894148-2894170 CTGTCTCGGGGGTGGGGCCCTGG - Intergenic
1036124671 8:6052009-6052031 CTGCCTCCACCGTGGGAGCCCGG + Intergenic
1036773675 8:11595500-11595522 CTCACTCCAGGCTGGGACCCCGG + Intergenic
1040450348 8:47539856-47539878 CTCTCTCCATGGTGGGAAGCTGG + Intronic
1045383358 8:101648245-101648267 CTGTCACGTCTGTGGGACCCTGG + Intronic
1048271091 8:133028730-133028752 CTGCCTCCATGGTGAGACCATGG + Intronic
1048281987 8:133112467-133112489 CTGTCTGCACTGTGGGAGTCTGG - Intronic
1049300130 8:141865309-141865331 CTGCCTCCAAGCTGGGACGCTGG - Intergenic
1049583233 8:143422022-143422044 CCGTCTCCTGGCTGGGACCCAGG - Intronic
1051837997 9:21362482-21362504 CTGTCTCCTCAGTGGGACGAGGG + Intergenic
1051845729 9:21449310-21449332 CTGTCTCCTCAGTGGGACGAGGG - Intergenic
1052826608 9:33180773-33180795 CTGCCTCCATGGTGGGAGCTAGG + Intergenic
1053048349 9:34938049-34938071 CTGTCTCCACTTTGTGGCCCGGG - Intergenic
1056763355 9:89429665-89429687 CTGTCACCCGGCTGGGACCCAGG - Intronic
1057410021 9:94809878-94809900 CAGTCTCCAGGGTAGGGCCCAGG - Intronic
1060040471 9:120296037-120296059 ATGTCCCCATGGTGGGACACTGG - Intergenic
1060289130 9:122284165-122284187 ATCTCTCCAGGGTGGGGCCCAGG + Intronic
1060803735 9:126562102-126562124 CTTTCTCTGCTGTGGGACCCTGG - Intergenic
1060912391 9:127361511-127361533 CTGTCTCCACCTTGGGACAGGGG - Intronic
1061009036 9:127944495-127944517 TTGTCGCCACAGTGTGACCCTGG - Intronic
1062046214 9:134425646-134425668 CTGTCCCCACAGGGGGACCTTGG - Intronic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1062627150 9:137448476-137448498 CTGGCACCACAGTGGGCCCCTGG - Exonic
1189373182 X:40445986-40446008 CTGTCTCCATAGAGAGACCCAGG + Intergenic
1194574712 X:95597413-95597435 CTGTCTCCAGGATTGGTCCCTGG - Intergenic
1197601258 X:128533152-128533174 CTGTTTCTACGGTGGGCTCCCGG - Intergenic
1200012098 X:153127056-153127078 CTGTCTCCACGCAGGGCACCTGG + Intergenic
1200027502 X:153272863-153272885 CTGTCTCCACGCAGGGCACCTGG - Intergenic
1200887445 Y:8282825-8282847 GTGTGTCCACGGTGGGAAACTGG + Intergenic
1200920383 Y:8607811-8607833 CTCTCTCCTCTGTGGGATCCAGG + Intergenic
1200963791 Y:9018432-9018454 CTGTCTTCTCTGTGGGATCCAGG - Intergenic
1202149313 Y:21830356-21830378 CTGTCTTCTCTGTGGGATCCAGG + Intergenic
1202149610 Y:21832859-21832881 CTGTCTTCTCAGTGGGACACAGG + Intergenic