ID: 948897661

View in Genome Browser
Species Human (GRCh38)
Location 2:240934798-240934820
Sequence TGCAAGCCAGAGCTCTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948897661_948897666 -5 Left 948897661 2:240934798-240934820 CCGCCCAAGAGCTCTGGCTTGCA 0: 1
1: 0
2: 0
3: 19
4: 220
Right 948897666 2:240934816-240934838 TTGCACACCTCCGTGGCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 80
948897661_948897669 14 Left 948897661 2:240934798-240934820 CCGCCCAAGAGCTCTGGCTTGCA 0: 1
1: 0
2: 0
3: 19
4: 220
Right 948897669 2:240934835-240934857 AGGGCTCACTCCTTTCCCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 233
948897661_948897665 -6 Left 948897661 2:240934798-240934820 CCGCCCAAGAGCTCTGGCTTGCA 0: 1
1: 0
2: 0
3: 19
4: 220
Right 948897665 2:240934815-240934837 CTTGCACACCTCCGTGGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948897661 Original CRISPR TGCAAGCCAGAGCTCTTGGG CGG (reversed) Intronic
900381008 1:2383895-2383917 TGCAGGCCTGAGCTCCTGGCTGG - Intronic
902620054 1:17645539-17645561 TCCAGACCAGAGCTCTTGGCTGG + Intronic
903390991 1:22963420-22963442 TGCAGGCCACAGCTCCTGGTTGG + Intronic
903766921 1:25740994-25741016 TGGGGGCCACAGCTCTTGGGAGG + Intronic
904249025 1:29209499-29209521 TGGAAGCCAGAGGTCTTTGTGGG + Intronic
904474683 1:30757276-30757298 TGGAAGGCAGGGATCTTGGGAGG - Intronic
905113198 1:35613237-35613259 GCCAAGCCAGAGATCTTTGGTGG - Intronic
905926572 1:41754214-41754236 TGAAAGCCAAAGGTCCTGGGTGG - Intronic
907569140 1:55466995-55467017 TGCAAGGCCCAGCTCTTAGGAGG + Intergenic
907938399 1:59063620-59063642 TGGAAGCCAGACCTCTTTGGAGG + Intergenic
908591054 1:65633992-65634014 TGCCTGCCAGAGGTCTTGGATGG - Intronic
909478532 1:76109707-76109729 TGTAAGCCCGAGCTCTTGTGTGG - Intronic
911504207 1:98728201-98728223 TGCAAGCCAGAAGTGTTTGGTGG + Intronic
913385625 1:118255498-118255520 TTCAAGACAGAGATTTTGGGAGG - Intergenic
916519909 1:165554331-165554353 GGGGAGCCAGAGCTCTTGAGGGG + Intronic
917773021 1:178301066-178301088 TGGAACCCAGAGCTTTTGGCTGG + Intronic
918542633 1:185648931-185648953 TGCACTCCTCAGCTCTTGGGTGG + Intergenic
919070681 1:192751452-192751474 TGCACACCTCAGCTCTTGGGCGG - Intergenic
920744478 1:208613595-208613617 TGCAACCCAGAGCTCTCTTGAGG + Intergenic
922534982 1:226373065-226373087 TGCCAGGCTGAGCTCTTGGCAGG + Intronic
922730200 1:227945584-227945606 TGCCAGGCAGAGCTTTTGAGAGG + Intronic
924223330 1:241900566-241900588 TGTAAGCCACTGCTCTTGGCAGG + Intergenic
1063259336 10:4367737-4367759 TGTAAGCCATAGTCCTTGGGCGG - Intergenic
1064072457 10:12242442-12242464 CTCAAGCCTGAGCTCTTGGAAGG + Intronic
1065042581 10:21712605-21712627 TATAAACCAGAGCTCTTGGGAGG - Intronic
1065658844 10:27983385-27983407 TGGGACCCAGACCTCTTGGGAGG - Intronic
1067344687 10:45428808-45428830 TGCGATCCAGGGCTCCTGGGTGG + Intronic
1067574289 10:47398614-47398636 AGGAAGCCAGTGCTCTTGGGTGG - Intergenic
1069246243 10:66210893-66210915 AGAAAGCCACAGTTCTTGGGTGG + Intronic
1073326436 10:102646200-102646222 TGAAAGCCAGAGGACTGGGGAGG - Intronic
1074097291 10:110325312-110325334 TGCAAGCCAGAGTTGTTCAGGGG - Intergenic
1074257947 10:111822054-111822076 TGCAACCCAGAACACTTGGCAGG - Intergenic
1076004242 10:126935388-126935410 TGCAAGCCAGAACTCCTCTGGGG - Intronic
1076463270 10:130660800-130660822 TACAAGGGAGAGCCCTTGGGGGG + Intergenic
1076637562 10:131892185-131892207 TGAAAGAGAGAGCTATTGGGAGG + Intergenic
1078415425 11:11160863-11160885 TGCAAGCCAGACTACCTGGGCGG + Intergenic
1078710291 11:13784536-13784558 AGCAAGCCAAAGCTCCTGGAAGG + Intergenic
1083528803 11:63397816-63397838 TCCAAGCCTGGGCTCTTGGATGG - Intronic
1083903291 11:65654340-65654362 TGCAACCCAGTGCTCTGGGGAGG + Exonic
1083920597 11:65779993-65780015 TGCAAGCCCGGGCTGCTGGGGGG - Exonic
1084514428 11:69628592-69628614 TGCAATAAAGGGCTCTTGGGGGG + Intergenic
1086420440 11:86632720-86632742 TGCACTCCAGAGACCTTGGGTGG + Intronic
1088358517 11:108967808-108967830 TGCCAGGCTGAGCTCCTGGGAGG + Intergenic
1089659344 11:119975907-119975929 AGCAAGCCAGAGTGTTTGGGTGG - Intergenic
1091326166 11:134689833-134689855 TTCAGGGCAGAGCTCCTGGGAGG - Intergenic
1091802193 12:3331259-3331281 TGCCTGGCAGAGCTCCTGGGAGG + Intergenic
1096217116 12:49803869-49803891 TGCCAGCCAGAGCCCTGGGGAGG - Intronic
1096464139 12:51838864-51838886 TGCAAGGCAGAGCTCTTCTGGGG - Intergenic
1097043881 12:56172929-56172951 GGCAAGCCAGAGCTGGTAGGTGG - Intronic
1100840521 12:98607992-98608014 TTAAAACCAGAGCTCTTGGCTGG + Intergenic
1100883326 12:99042072-99042094 TGCACCCCAGAGATTTTGGGGGG - Intronic
1102339103 12:112108144-112108166 CCCAATCCAGAGCTGTTGGGTGG - Intronic
1102734452 12:115145901-115145923 GCCATGCCAGACCTCTTGGGTGG - Intergenic
1105530877 13:21219148-21219170 TGACAGCCACAGCTCTTGGCTGG + Intergenic
1108421813 13:50258112-50258134 TGAAACCCAGAGCTCTAAGGAGG - Intronic
1110072108 13:71190481-71190503 TGCAAGCCATAGCCCTTGTAAGG + Intergenic
1110511431 13:76355798-76355820 TGCAAGCCCCAGGTCTTGGAAGG + Intergenic
1110576514 13:77062686-77062708 AGCAAGCCAGAGCTGTTGAAAGG + Exonic
1112323583 13:98428707-98428729 GCCAAGGCAGAGGTCTTGGGAGG - Intronic
1114576462 14:23718986-23719008 GGCAAGCAAGAGCTCTTTGCAGG + Intergenic
1115164505 14:30432568-30432590 TACCAGCCACAGCTCTTGGTTGG + Intergenic
1115421292 14:33198738-33198760 TGCACTCCTGAGCCCTTGGGTGG + Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1115965294 14:38880574-38880596 TGAAAGCCACAGCTCTTAGCAGG + Intergenic
1117867867 14:60167996-60168018 TGTAAGCCAGAGCTTGTGGAGGG - Intronic
1122467247 14:101942447-101942469 TCGAAGCCAGAGCTCAAGGGAGG + Intergenic
1124886669 15:33693682-33693704 TGCAACCTACAGCCCTTGGGAGG - Intronic
1124946100 15:34268204-34268226 GGCAAGCCAGAGCTGCTAGGAGG - Intronic
1128933514 15:71726323-71726345 TACAGGCCAGAGCTCTGGGAAGG + Intronic
1131113260 15:89778245-89778267 CGCAGGCCTGAGCTCTGGGGAGG - Exonic
1131310803 15:91288120-91288142 GGCAAGTCAGATCTCTGGGGTGG + Intronic
1132251315 15:100337547-100337569 TGCAGCCCAGAGCTCCTTGGTGG + Intronic
1134141995 16:11728405-11728427 TAAAAGCCACAGCTTTTGGGAGG + Intronic
1134388220 16:13794101-13794123 TGCAGGGTAGAGCTTTTGGGTGG - Intergenic
1134659985 16:15976845-15976867 TGAAAGCCAGAGAGATTGGGTGG + Intronic
1136009854 16:27356503-27356525 TGCAGGCCAGAGATCTTCTGGGG + Intronic
1137566797 16:49538320-49538342 TGCCAGCCAGAGCTGTACGGTGG - Intronic
1138336672 16:56258813-56258835 GGCAGGCAATAGCTCTTGGGTGG + Intronic
1138506131 16:57479224-57479246 TGCCAGCCAGCCCTCTGGGGCGG + Intronic
1139752395 16:69117291-69117313 TGCAAGGCAGAGCTGATGGTAGG - Exonic
1140481096 16:75263306-75263328 TGCCAGCCAGAGGTCTGAGGTGG + Intronic
1140940184 16:79714099-79714121 TGTAAGTCAGAGCCCTCGGGTGG - Intergenic
1141880532 16:86856005-86856027 TGCCAGCCACAGCGCTTAGGTGG - Intergenic
1142225139 16:88873515-88873537 TGGAACCCATAGCTCTGGGGAGG - Intergenic
1142239680 16:88939598-88939620 TGCAAGCCGGAGCTGCCGGGAGG - Intronic
1143552787 17:7641198-7641220 TGCACTCCTCAGCTCTTGGGTGG - Intergenic
1144776845 17:17789092-17789114 TGCAAGCCAAAGCTGCTGTGGGG - Intronic
1144995407 17:19264867-19264889 TGCAGTCCAGAGGTCGTGGGAGG + Intronic
1147674055 17:42192839-42192861 TGCAAGTCAGAGGTCTCTGGTGG + Intronic
1151247397 17:72805366-72805388 TGCATCCCAGGGCTCTCGGGAGG + Intronic
1151303837 17:73249926-73249948 TGCAACCCAGACCTGTTGGTAGG + Intronic
1152255550 17:79237361-79237383 TGCCTGCTAGAGCTGTTGGGAGG - Intronic
1152600418 17:81259474-81259496 TGCCACTCAGAGCTCGTGGGAGG + Intronic
1152642808 17:81456233-81456255 TGCAAACCACAGCCCCTGGGCGG - Intronic
1152800475 17:82328482-82328504 TGCAAGGCTGAGCTCCTGCGTGG - Intronic
1155744198 18:29331028-29331050 TGCAAGACAGAGCTGTGGGAAGG + Intergenic
1156352770 18:36315366-36315388 TGGGATCCAGAGCTCTTGGGTGG - Intronic
1157509634 18:48261604-48261626 TTCCAGGCAGAGCTGTTGGGTGG - Intronic
1158716618 18:59886055-59886077 TGCAAGCCACAGTGCTTGGGTGG - Intergenic
1158825320 18:61212150-61212172 TGCATTCCTGAGCTCTTTGGCGG + Intergenic
1160237513 18:77097780-77097802 TGGAAGGCAGAGCTCTTTGTGGG + Intronic
1160341078 18:78089265-78089287 TGAAAGCTAGACCTCCTGGGAGG + Intergenic
1160894131 19:1394902-1394924 CCCAAGCCAGAGCTCTTTGCTGG - Intronic
1161261754 19:3341664-3341686 AGCAAGCCTCACCTCTTGGGAGG + Intergenic
1161709910 19:5841971-5841993 TGCAAGCCACGGGTCCTGGGAGG - Intergenic
1161716119 19:5877123-5877145 TGCAAGCCAGGGGTCCTGGGAGG - Intronic
1163767312 19:19170734-19170756 TGCAAGACGGGGCTCTCGGGTGG + Intronic
1165347859 19:35260059-35260081 TGCAAGACAGAGTTCATGTGTGG + Intronic
925526460 2:4808387-4808409 AGCAAGCCAGAGCTCCGGAGGGG - Intergenic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
930593451 2:53356792-53356814 TGCACTCCTCAGCTCTTGGGCGG - Intergenic
933901911 2:86856153-86856175 TGCAAGCCAGAGCTGGAGAGAGG + Intronic
935244245 2:101204564-101204586 TGCAAGCCTGTGCACTTGGGAGG - Intronic
935682597 2:105651114-105651136 TGCAACCTAGATCTCTTGTGTGG + Intergenic
936072251 2:109378962-109378984 TGCAGGCCAGAGTTCTGGAGAGG - Intronic
937197293 2:120170426-120170448 CACCAGCCAGAGCTCTTGGCAGG + Intronic
937767800 2:125681417-125681439 TCTCCGCCAGAGCTCTTGGGTGG - Intergenic
940063664 2:149601236-149601258 TGCAAGCCAGATGTATTGAGAGG - Intergenic
940456863 2:153912834-153912856 TGCCAGCCAAAGCTCTTTGTAGG + Intronic
941113556 2:161445345-161445367 TGTAAGCCCAAGCACTTGGGGGG - Intronic
942033465 2:171987451-171987473 TGCAAGCCAGGCTACTTGGGAGG + Intronic
943354167 2:186831250-186831272 TGGAAACCAGAGCTCTTGTGGGG - Intronic
943676100 2:190717769-190717791 TGGCAGCCAGTTCTCTTGGGTGG - Intergenic
946187381 2:217988673-217988695 CCCCAGCCAGACCTCTTGGGAGG + Intronic
946805380 2:223465852-223465874 TGCAAGCCAGAAACCCTGGGAGG + Intergenic
948785378 2:240349726-240349748 TGGCAGGCAGACCTCTTGGGTGG + Intergenic
948897661 2:240934798-240934820 TGCAAGCCAGAGCTCTTGGGCGG - Intronic
1170701410 20:18707031-18707053 TGGATGCCACTGCTCTTGGGTGG + Intronic
1170729424 20:18960116-18960138 TGCAGGCCAGAGTCCTTGGAAGG - Intergenic
1170900206 20:20455180-20455202 TGCGAGGCAGAGCACTTAGGTGG - Intronic
1171798102 20:29582104-29582126 TGCCTTCCAGAGCTCTTGGCAGG + Intergenic
1171850140 20:30302057-30302079 TGCCTTCCAGAGCTCTTGGCAGG - Intergenic
1172134444 20:32677566-32677588 TGAGAGTCAGAGCTCTTTGGGGG - Intergenic
1172407918 20:34703178-34703200 TGAAAGCCAGGACTCTGGGGAGG + Intronic
1177182329 21:17757586-17757608 TGCACTCCTCAGCTCTTGGGTGG + Intergenic
1180020946 21:45126625-45126647 TGCAAGGCTGAGGTCTAGGGTGG + Intronic
1182597851 22:31435952-31435974 GGCAAGCCAGAGCTTTTAGCAGG + Intronic
1182609914 22:31538897-31538919 TTCAAGGCAGAGGTCTTGGCTGG - Intronic
1184004274 22:41697184-41697206 TACAAGCCAGAGCTCTGGAGAGG + Exonic
1184552134 22:45210148-45210170 TGCAAGCCAGGGCTCTAACGAGG - Intronic
1184995915 22:48207511-48207533 TGCATGCAGCAGCTCTTGGGAGG - Intergenic
1185151351 22:49165307-49165329 TGGAAGCCGGTGCTCCTGGGAGG + Intergenic
949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG + Intergenic
950703099 3:14763478-14763500 TGGGAGGCAGAGCTTTTGGGAGG - Intronic
952990674 3:38828529-38828551 TGCATGCCAGAGCTCTAAGTTGG - Intergenic
955387226 3:58489349-58489371 TGCAACCCTGAGCTCTGTGGAGG + Intergenic
956165857 3:66397668-66397690 AGCAAGGCAGAGCTCTGGAGGGG - Intronic
956685734 3:71825665-71825687 TGTCAGCCAGAGCTCATGGAAGG - Intergenic
957371549 3:79300581-79300603 TGCACGCCCCAGCCCTTGGGTGG - Intronic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
961002765 3:123385004-123385026 TGCCAGGCAGAGCTGCTGGGTGG - Intronic
961058097 3:123805664-123805686 TGCAAGACAGAGGACTTGGGTGG + Intronic
961329528 3:126130477-126130499 TGGCAGGCAGAGCCCTTGGGTGG + Intronic
963181145 3:142357777-142357799 TCCCAGCCACAGCACTTGGGAGG + Intronic
967401965 3:189073279-189073301 TGGAAGCCAGAGTTCTTGGAAGG - Intronic
967817164 3:193809331-193809353 TGCAAGCAAGGGCTGTTGGCTGG + Intergenic
968930233 4:3575094-3575116 TGCAAGCCAGAGCCCGCTGGAGG - Intergenic
969442955 4:7227990-7228012 AGCAAGCGGGAGCTCATGGGTGG + Intronic
972831564 4:42819972-42819994 TGCAAGCTGGAGCTCATGGCAGG + Intergenic
972900189 4:43672720-43672742 TGCATTCCTCAGCTCTTGGGTGG - Intergenic
974982227 4:68972817-68972839 TACAAGCAATAGCTCTTGAGTGG + Intergenic
975744999 4:77466706-77466728 TGCACTCCTCAGCTCTTGGGTGG - Intergenic
978577198 4:110199066-110199088 TCTAAGCCAGAGCTCCCGGGTGG - Intronic
986453016 5:7885064-7885086 TGCAGGCCAGGGCTCTGGGGAGG - Intronic
986919087 5:12662266-12662288 TGCACTCCTCAGCTCTTGGGTGG - Intergenic
987120552 5:14762717-14762739 TTCCAGCTAGAGCTATTGGGGGG + Intronic
990154125 5:52855359-52855381 TACAATCCAGACCTCTTGGCTGG + Intronic
990168063 5:53017511-53017533 TGCCAGCCAAAGCTCTTTGTTGG + Intronic
992010770 5:72525181-72525203 TAAAAAGCAGAGCTCTTGGGTGG + Intergenic
992103520 5:73430707-73430729 GGCAGGCCAGATCTCATGGGCGG + Intergenic
993250093 5:85510787-85510809 TGCATCCCAGAGCTTTTGGTAGG + Intergenic
998849579 5:146340217-146340239 AGCAAGCCAGAGCTCTTCAACGG + Exonic
999268983 5:150285441-150285463 TCCCAGGCAGAGCTGTTGGGTGG - Intronic
1000943410 5:167391327-167391349 GAAAAGCAAGAGCTCTTGGGTGG + Intronic
1001127106 5:169029664-169029686 TGCAAACAAGAGATCTTGGAAGG + Intronic
1003023724 6:2534714-2534736 TGCAACCCAGACCCCTGGGGAGG + Intergenic
1003398037 6:5770026-5770048 TGAATGCCAGAGCCCTTGGCTGG - Intronic
1003621445 6:7704586-7704608 TGCAAGAGAGAGCCCTTGAGTGG + Intergenic
1004693120 6:18009891-18009913 TGCGAGCCTGAGGTCGTGGGGGG - Intergenic
1004746681 6:18515969-18515991 TGCATTCCAGAGCTGTGGGGTGG + Intergenic
1005682230 6:28218502-28218524 TGGAAGCCAGAGCCCTTCAGTGG + Intergenic
1007072426 6:39047528-39047550 TGCTAGACTGACCTCTTGGGAGG + Intergenic
1007700150 6:43761676-43761698 GGCAAGCCCCAGCTCTGGGGTGG - Intergenic
1009880003 6:69554953-69554975 TGTAAGCCAGAGATCCTGGGAGG - Intergenic
1012024163 6:93967056-93967078 TGCAAGCCAGAGGCCTAGGAAGG + Intergenic
1015004549 6:128263198-128263220 TTCATGACAGAGTTCTTGGGAGG + Intronic
1015977158 6:138802024-138802046 TGGAAGCCGGAGCCCTTGTGTGG - Intronic
1018343251 6:162874522-162874544 TCAAAGCCAGATCTCCTGGGAGG + Intronic
1019478613 7:1255840-1255862 TGGGAGACAGAGCGCTTGGGAGG - Intergenic
1019564224 7:1671601-1671623 TGCAAGCTGGACCTCTTTGGAGG - Intergenic
1021943785 7:25705265-25705287 TGCAATGCAGAGCTGTTAGGTGG + Intergenic
1022243346 7:28533792-28533814 CCCAAGTCAGAGCTCTTGAGGGG + Intronic
1023987650 7:45106230-45106252 TGCAAGCAAGAACTCTAGAGTGG + Intronic
1026251709 7:68676998-68677020 TTTAAGTCAGAACTCTTGGGAGG - Intergenic
1027996057 7:85426805-85426827 TGAAAGCCAGAGGACTAGGGTGG + Intergenic
1028494117 7:91445091-91445113 AGCAAGCCATAGCTCTACGGGGG - Intergenic
1030366961 7:108657258-108657280 TGCAATCCTCAGCCCTTGGGTGG + Intergenic
1031528570 7:122850379-122850401 TGCAACCCAGTGCTCTGGGGAGG - Intronic
1032069698 7:128796481-128796503 TGAAAGCCAAACCTCTTGGCTGG - Intronic
1032756899 7:134899549-134899571 TGTAAGGCACAGCTCTAGGGTGG - Intronic
1036185203 8:6616598-6616620 TGCAACCCAGGGCTCCTAGGAGG + Intronic
1036932751 8:12972356-12972378 TGGGAGGCAGATCTCTTGGGAGG + Intronic
1040566457 8:48571988-48572010 TGCCAGCCACAGCTCTCTGGGGG + Intergenic
1040800194 8:51331476-51331498 TCCTAGCCAGAACTCTGGGGAGG + Intronic
1041256456 8:55983302-55983324 TGCATGTCAGGGCTCTTGGCTGG - Intronic
1041588445 8:59547482-59547504 TGCAATCCTCAGCCCTTGGGCGG - Intergenic
1047100132 8:121667443-121667465 TGCACTCCTCAGCTCTTGGGCGG + Intergenic
1048241267 8:132743720-132743742 TGCAATCCAGAGCTCAGAGGAGG - Intronic
1048267885 8:133003806-133003828 TGCAAACCAGAGCTGCTGAGGGG - Intronic
1048288529 8:133162081-133162103 TGCAAAACTGAGCTCTTGGTGGG - Intergenic
1048421999 8:134285982-134286004 TGCAAGCCACAGCTCCTTGGTGG + Intergenic
1048665316 8:136654837-136654859 AGCAAGCCATAGCACTAGGGAGG + Intergenic
1049212755 8:141394314-141394336 GGCAAGCCCAAGGTCTTGGGGGG - Intronic
1049586984 8:143436841-143436863 TGGAAGCCAGAGCTGTGGGTGGG - Intergenic
1050025534 9:1331072-1331094 TTCAAGCCATAGCACTAGGGAGG - Intergenic
1050078322 9:1888567-1888589 TGCTATGCAGAGCTCTAGGGAGG + Intergenic
1050975205 9:11928900-11928922 TGCATGCCTCAGCCCTTGGGTGG + Intergenic
1051355475 9:16236084-16236106 TGCATCCCAGGGCTCTTGGAAGG + Intronic
1053116451 9:35508246-35508268 TGCAATCCAGAGCGCCAGGGAGG - Intronic
1053787911 9:41665350-41665372 TGCCTTCCAGAGCTCTTGGCAGG - Intergenic
1054157218 9:61649417-61649439 TGCCTTCCAGAGCTCTTGGCAGG + Intergenic
1054176187 9:61876692-61876714 TGCCTTCCAGAGCTCTTGGCAGG - Intergenic
1054476993 9:65580422-65580444 TGCCTTCCAGAGCTCTTGGCAGG + Intergenic
1054661352 9:67704116-67704138 TGCCTTCCAGAGCTCTTGGCAGG + Intergenic
1054973378 9:71115234-71115256 TGAAGTCCAGAGCTCTTGGAAGG - Intronic
1055640359 9:78314698-78314720 AGAAAGCCAGAGATCATGGGCGG + Intronic
1059458399 9:114414016-114414038 TGGAAACCAGTGCTCCTGGGAGG + Intronic
1060812334 9:126616801-126616823 TGCAGGCCAGAGCCCTAGAGAGG + Intronic
1061238921 9:129358031-129358053 TTCCAGCCAGAGCCCTGGGGTGG + Intergenic
1062469492 9:136696334-136696356 TGCAACCCACAGCCCTTGGTGGG - Intergenic
1188852772 X:35151504-35151526 TGCAAGCCAAAGCTTTTCGTAGG - Intergenic
1189194309 X:39139751-39139773 TGGAAGCCAGTGTTCATGGGTGG - Intergenic
1189655787 X:43243950-43243972 TCCATGCCAGAGCTTTTTGGGGG - Intergenic
1192880855 X:75282432-75282454 TGTATGCCAGAGGTTTTGGGAGG + Intronic
1193469212 X:81878688-81878710 TCCAGGCCATAGCTCTAGGGTGG - Intergenic
1197767760 X:130070060-130070082 TGCAAGCCAGAGACCCGGGGAGG - Intronic
1198481478 X:137045430-137045452 AGCATGGCAGAGCTCTGGGGAGG + Intergenic
1199307229 X:146280354-146280376 TGCGAGACAGAACTCCTGGGGGG - Intergenic
1199823646 X:151476059-151476081 TGCAAGCTAGAGAACTAGGGAGG - Intergenic
1201573082 Y:15434205-15434227 TGCACTCCTCAGCTCTTGGGTGG - Intergenic