ID: 948901884

View in Genome Browser
Species Human (GRCh38)
Location 2:240960376-240960398
Sequence GAGCCACATGATGGTGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948901872_948901884 10 Left 948901872 2:240960343-240960365 CCAAGGGCCCGAGGTTGACACGG 0: 1
1: 0
2: 2
3: 8
4: 52
Right 948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
948901876_948901884 2 Left 948901876 2:240960351-240960373 CCGAGGTTGACACGGAGGCCCCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
948901871_948901884 15 Left 948901871 2:240960338-240960360 CCTGGCCAAGGGCCCGAGGTTGA 0: 1
1: 0
2: 0
3: 19
4: 103
Right 948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
948901875_948901884 3 Left 948901875 2:240960350-240960372 CCCGAGGTTGACACGGAGGCCCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
948901869_948901884 21 Left 948901869 2:240960332-240960354 CCTGGGCCTGGCCAAGGGCCCGA 0: 1
1: 0
2: 4
3: 41
4: 369
Right 948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948901884 Original CRISPR GAGCCACATGATGGTGACGT GGG Intronic
900639213 1:3680853-3680875 TGGCCACGTGATGGTGAAGTGGG + Intronic
902963007 1:19977984-19978006 GGGCCACTCGATGGTGAGGTAGG + Intronic
915942895 1:160130134-160130156 GAGCCACGTGCTGGTGATGAAGG + Exonic
923705689 1:236342656-236342678 GAGCCTGATGATTTTGACGTGGG + Intergenic
1069717177 10:70528791-70528813 AAGCCACATGTTGATGATGTTGG - Intronic
1075057431 10:119230031-119230053 AAGCCAAATGGTGGTGACTTGGG + Intronic
1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG + Intergenic
1082868001 11:57917485-57917507 GAGGCAGATGATGGTGAGGTGGG + Intergenic
1083541380 11:63513910-63513932 GAGCTGCATGAAGGTGAGGTAGG + Intronic
1089814218 11:121158145-121158167 GGGCGAAATGATGGTGAGGTTGG - Exonic
1091495305 12:967446-967468 GAGCTAGGTGATGGTTACGTGGG - Intronic
1096933522 12:55242485-55242507 GAGCCAGAAGATGATGAAGTGGG - Intergenic
1122411621 14:101528748-101528770 GAGCCACAGGAAGGTGACCTGGG + Intergenic
1125587503 15:40831283-40831305 GAGCCACAGGATGGGCACGGTGG + Intergenic
1125801229 15:42449524-42449546 GAGAAACAAGGTGGTGACGTAGG - Intronic
1127512197 15:59654004-59654026 GTGACAGATGATGGTGACTTAGG - Intronic
1130396972 15:83511210-83511232 GACCCCCATGATGGTGCCTTAGG + Intronic
1135891078 16:26358138-26358160 GACCCAGATGATGCTGAAGTCGG - Intergenic
1136081386 16:27854489-27854511 GAGCCACAGGGAGGTGAAGTTGG + Intronic
1136859940 16:33692297-33692319 GAGTGACATGATAGTGACGCTGG - Intergenic
1136999705 16:35217640-35217662 GAGCCAGAAGATGGAGACGGTGG - Intergenic
1137687694 16:50398177-50398199 GAGCCAAATGATGGAGAGATAGG - Intergenic
1138913751 16:61436872-61436894 GAGCTGCATGATGGTGAAGAGGG + Intergenic
1141489985 16:84366412-84366434 GAACCACAGGATGCTGAGGTTGG + Intergenic
1141889090 16:86914713-86914735 CAGCCCCATGAGGGTGACGAGGG + Intergenic
1203121446 16_KI270728v1_random:1540476-1540498 GAGTGACATGATAGTGACGCTGG - Intergenic
1144837955 17:18167410-18167432 GAAGCACATAAGGGTGACGTGGG - Intronic
1152233640 17:79127165-79127187 GACCTGCATGATGGTGACGTCGG - Intronic
1152278603 17:79372361-79372383 GATCCACAGGATGGGGAGGTGGG - Intronic
1159064047 18:63549824-63549846 GAGCCACATGGTGGTCACTCAGG + Intergenic
1161718300 19:5889828-5889850 AACACACGTGATGGTGACGTGGG + Intronic
924994744 2:349174-349196 GAACGAACTGATGGTGACGTCGG - Intergenic
925072114 2:977760-977782 GAACCACATGGCCGTGACGTTGG - Intronic
927806298 2:26149730-26149752 GATCCAGATGATTGTGACGATGG + Intergenic
934729791 2:96649368-96649390 CAGCCACATGGTGGTGATGGTGG - Intergenic
936737478 2:115464029-115464051 GTGGCTCATGATGGTGACATAGG + Intronic
938734575 2:134174820-134174842 GAGCCGCTTGATGGTGACCATGG + Intronic
939115625 2:138057000-138057022 AAGCCACCTGATGGTCACCTGGG + Intergenic
939332358 2:140780951-140780973 GAGCCACAAAAGGGTGAGGTTGG - Intronic
948595523 2:239077002-239077024 GGGCCACAGGCTGGTGAGGTGGG - Intronic
948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG + Intronic
1170892774 20:20390281-20390303 GAGCCACATGTTGGGGAAGTGGG - Intronic
1172150509 20:32787150-32787172 GAGCCATATGGGGGTGCCGTTGG + Intronic
1172392492 20:34575333-34575355 GAGCTACATGATGCTCACCTTGG - Intronic
1180990225 22:19931271-19931293 AAGCCATATGGTGGTGAGGTTGG + Intronic
949577506 3:5352961-5352983 CAGCCACATGAAGGTGACAGAGG + Intergenic
949913305 3:8934210-8934232 GATCCACATGATCTTGAAGTAGG + Intronic
953885380 3:46712028-46712050 GAACCAGATGAGGGTGAAGTGGG - Intergenic
962768609 3:138592104-138592126 GAGGCATATGATGGTGAGCTGGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
968247385 3:197166054-197166076 GAGCCTCAGCATGGTGACGAGGG + Intronic
977279801 4:95025437-95025459 AAGACAGATGATGGTGACTTGGG + Intronic
986278763 5:6305328-6305350 GACCCAGATGATGGTTACATTGG - Intergenic
987555584 5:19443021-19443043 AACCCACATGATGGGGACATGGG - Intergenic
995449077 5:112280659-112280681 GAGAAAGATGATGCTGACGTTGG + Intronic
997591353 5:135074627-135074649 GAGCCACAGGATCCTGAGGTTGG - Intronic
998847502 5:146325215-146325237 GAGGAATTTGATGGTGACGTGGG - Intronic
999754566 5:154654513-154654535 GAGCCACATGACTGGGACCTGGG - Intergenic
1006331488 6:33394219-33394241 GTGCCAGATGATGGTGTCTTAGG + Intronic
1012441997 6:99269458-99269480 GAGCCACATGATGGTGATAATGG + Intergenic
1019368191 7:646007-646029 GAGCAACATGTTGGTGACGAAGG - Intronic
1023125596 7:36951332-36951354 GAGCCAAGTGTTGGTGATGTGGG - Intronic
1026170969 7:67953567-67953589 GAGAAAGATGATGGTGAAGTGGG + Intergenic
1030077773 7:105751324-105751346 GATCCAGATGCTGGTTACGTGGG - Intronic
1035281462 7:157781032-157781054 GAGCCGCATGTGGGTGACGTGGG - Intronic
1037924409 8:22833173-22833195 GAGGGACATGATGGTGATGAAGG - Intronic
1046020790 8:108662276-108662298 GAGACACATGATAGAGAGGTAGG + Intronic
1046868059 8:119172926-119172948 GAGCCAAAGCATGGTGATGTAGG + Intronic
1053572323 9:39321687-39321709 GAGCCACTTGATGGTGAGTCAGG - Intergenic
1053623712 9:39846222-39846244 GAGCCACTTGATGGTGAGTCAGG - Intergenic
1053881157 9:42597006-42597028 GAGCCACTTGATGGTGAGTCAGG + Intergenic
1054124822 9:61297324-61297346 GAGCCACTTGATGGTGAGTCAGG + Intergenic
1054220186 9:62404477-62404499 GAGCCACTTGATGGTGAGTCAGG + Intergenic
1054230529 9:62504695-62504717 GAGCCACTTGATGGTGAGTCAGG - Intergenic
1196008722 X:110863666-110863688 GACCCAAATGATGGTGTCCTGGG - Intergenic