ID: 948902624

View in Genome Browser
Species Human (GRCh38)
Location 2:240964098-240964120
Sequence GGCTCTAGAAAGGCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948902620_948902624 -7 Left 948902620 2:240964082-240964104 CCAACGGCCTGGCTGGGGCTCTA 0: 1
1: 0
2: 1
3: 16
4: 189
Right 948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG 0: 1
1: 0
2: 4
3: 48
4: 152
948902609_948902624 29 Left 948902609 2:240964046-240964068 CCAGGAGGTGGTGCAGAGCTGGG 0: 1
1: 2
2: 8
3: 69
4: 543
Right 948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG 0: 1
1: 0
2: 4
3: 48
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948902624 Original CRISPR GGCTCTAGAAAGGCCCCTGT GGG Intronic
901772308 1:11536666-11536688 GGCTATAGGGAGGCCCCTGCGGG - Exonic
902193360 1:14779347-14779369 GGCTCCAGAAAAGCCCCAGAGGG - Intronic
903261765 1:22135497-22135519 GGCTCTAGAAAGACCCATCAAGG - Intronic
907463051 1:54617002-54617024 GGCTTTAAAAATGACCCTGTGGG - Intronic
911790977 1:102014857-102014879 GGCTGTAGGAAGCCACCTGTTGG + Intergenic
912216282 1:107616699-107616721 GGCTCTAGAATGTGCCCTATAGG - Intronic
912397513 1:109358222-109358244 GGTTCTAGCAAGGCCACTTTGGG + Intronic
917680872 1:177366078-177366100 ACCTCTAGAAAGGCCCCTGTTGG - Intergenic
918261991 1:182804716-182804738 GGCTCTGGAGGGGCTCCTGTTGG - Intronic
921893216 1:220373109-220373131 AGCTCTTGAATAGCCCCTGTGGG + Intergenic
924615471 1:245608389-245608411 AGCTCCAGCAAGGCCTCTGTTGG - Intronic
1063606701 10:7528764-7528786 GGCTCTGGAAATGCCCCCGGGGG + Intergenic
1063671898 10:8105647-8105669 GGCTATAGCAAGGCCAGTGTTGG + Intergenic
1067348303 10:45454130-45454152 GGCTCTGGCAAGGCCTCTGAGGG - Intergenic
1070179410 10:73999163-73999185 GAGTCTAGAAAGGCCCCAGTGGG - Intronic
1071471750 10:85988510-85988532 GGGTCTAGGAAGGCCCAGGTTGG - Intronic
1073968120 10:109014721-109014743 GGCCAGAGAAAGGCCCCTGATGG + Intergenic
1075287736 10:121201784-121201806 AGCTCTGGGAAGGCCCCTGGTGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077453307 11:2663707-2663729 GGGTCTTGCAAGGCCCCTGCAGG + Intronic
1079106541 11:17575683-17575705 GGCTGGAGAGAGGCCCCTTTAGG + Intronic
1079673661 11:23199111-23199133 GGCTCTACATTGGCCCCTGTTGG + Intergenic
1081589016 11:44407909-44407931 GGAACTAGAAGGGCCCCTATGGG + Intergenic
1083263774 11:61536852-61536874 GGCTCTTGAGAGGCCCCTAGGGG - Intronic
1084431640 11:69114583-69114605 GGCCCCAGAAGGACCCCTGTAGG - Intergenic
1086760641 11:90626310-90626332 GACTCAAGAAAGGCCAATGTGGG - Intergenic
1087394026 11:97573774-97573796 GGCTCTAAAATGGCCGCTCTGGG + Intergenic
1091003676 11:131932739-131932761 GCATCTGGAAAGTCCCCTGTGGG - Intronic
1095909124 12:47408095-47408117 GGTCCAAGAAAGGGCCCTGTGGG + Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1100370519 12:93965046-93965068 GGCTGGAGAAAGGCCACTGAAGG - Intergenic
1102515865 12:113446282-113446304 GGCCCTGGGAAGGGCCCTGTAGG + Intergenic
1103716926 12:122950332-122950354 GGCCCTGGAAATGCCCCTGGTGG - Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105624107 13:22096569-22096591 GGCTCTAGAGTGGCCCATTTCGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114626952 14:24136314-24136336 GGGTCTAGAAAGGGCCCACTGGG + Intronic
1116372550 14:44154592-44154614 GGCTCCAGGTTGGCCCCTGTAGG + Intergenic
1119237146 14:73029231-73029253 TGCTCTAGAAAAGCTCCTGAAGG + Intergenic
1122284040 14:100640300-100640322 GGCTCTAGAAGGCTCCCTGGAGG - Intergenic
1122509448 14:102254708-102254730 GGCTCTAGTTAGGCGACTGTGGG - Intronic
1122902631 14:104788107-104788129 GGGTCTGGAACGGCCCCCGTGGG - Intronic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1125092569 15:35811630-35811652 GGCTCTAGACTTGCCCTTGTTGG + Intergenic
1126774813 15:52091645-52091667 GGCTCTAAAAATTCCCCTGGTGG - Intergenic
1128229472 15:66024751-66024773 GGCTCTATAAAGGGCTTTGTGGG + Intronic
1130913417 15:88286428-88286450 GGATTTAGAAGGGCCTCTGTGGG + Intergenic
1131343470 15:91624825-91624847 GGCTTTAGAAAGCTCCCTGGAGG + Intergenic
1132611193 16:817099-817121 GCCTCCAGAAAGGCCGCTGCGGG - Intergenic
1132831873 16:1932431-1932453 GGCTCTGGGAAGGGCTCTGTGGG - Intergenic
1133132361 16:3685144-3685166 GGCTGTGGAATGGGCCCTGTGGG - Intronic
1134338092 16:13319750-13319772 CACCCTGGAAAGGCCCCTGTGGG - Intergenic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1138393045 16:56683877-56683899 GGCTCGAGCCAGGCCTCTGTTGG + Intronic
1140533743 16:75690199-75690221 GGCTCTAGCAAGGCCATTTTAGG + Intronic
1140767029 16:78169571-78169593 AGCTCTTGAAAGACCCCAGTGGG + Intronic
1143451486 17:7039305-7039327 AGCTTTAGAAAGGCCACAGTTGG + Intronic
1144354234 17:14428855-14428877 GGCTCCACCAGGGCCCCTGTGGG - Intergenic
1145801237 17:27686602-27686624 GGCTCTAAAATGGCCACTCTGGG - Intergenic
1148714215 17:49704262-49704284 GGGTTTGGAAAGGGCCCTGTTGG - Intronic
1149821976 17:59788987-59789009 GCCTTTAGAAAGGCCCCTTTTGG + Intronic
1151127069 17:71856578-71856600 GGCTCTTGCAAAGCCTCTGTAGG - Intergenic
1155985128 18:32222254-32222276 GGCTCTATAAAGGCAACTTTAGG - Intronic
1161153861 19:2722353-2722375 GACTCTGGAGAGACCCCTGTGGG - Intronic
1162777224 19:12987213-12987235 GGCTCTGGGAAGGCCTGTGTGGG + Intergenic
1162791701 19:13066364-13066386 GGCTCAAGAAAAGCCATTGTTGG - Intronic
1163279486 19:16306903-16306925 GGCGGTAGAAAGGACCCAGTGGG + Intergenic
1163415378 19:17183326-17183348 GGTTCCAGAAGGGCCTCTGTGGG + Intronic
1163432925 19:17278964-17278986 GGCTCTGGCAAGGCCGCTGCAGG - Exonic
1163521643 19:17795276-17795298 GGCTCTGGAGAAGCCCCTGCCGG + Intronic
1164647390 19:29869767-29869789 TTCTGTAGAAAGGCCTCTGTAGG + Intergenic
1166123278 19:40698788-40698810 TGCTTTAGAAAGACCCCTCTGGG + Intronic
1167573761 19:50307360-50307382 GCATCTAGAAAGGGCCCTGTAGG + Intronic
1168024924 19:53637162-53637184 GTCTCTGGAAAGACCCCAGTAGG + Intergenic
925211111 2:2047439-2047461 GGTTCTAGAATGGCCACTGGGGG - Intronic
930595914 2:53387724-53387746 GTCTCTAAAATGGCCACTGTAGG - Intergenic
931706161 2:64948014-64948036 GGCCCTGGAAAGGCCCCATTGGG - Intergenic
942165077 2:173233727-173233749 TTCTCTAGAAAGGTCACTGTGGG - Intronic
945132300 2:206585961-206585983 GGTTCTATAAAGGCCTCTTTGGG + Intronic
945577488 2:211549913-211549935 ATCTCTAGAAAGAACCCTGTCGG + Intronic
947467224 2:230361977-230361999 TGATTTAGAAAGGTCCCTGTGGG + Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1170410323 20:16082296-16082318 GGCTTGAGAAAGAGCCCTGTGGG + Intergenic
1170598504 20:17823180-17823202 GGCTCTAGAAAAGTCCCTTGGGG + Intergenic
1171030683 20:21673862-21673884 GAATCCAGAAAGGCCACTGTGGG + Intergenic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1173253682 20:41377742-41377764 AGCCCTGGACAGGCCCCTGTAGG - Intergenic
1175296020 20:57909283-57909305 GGATCTGAAAAGGCTCCTGTCGG + Intergenic
1178631527 21:34265407-34265429 GAATCTAGATAGGCCCCTGGAGG + Intergenic
1178758224 21:35373610-35373632 GGAGCTAGAAAGTCCCCTGGAGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180636903 22:17269017-17269039 AGCTTCAGAAAGGCCGCTGTGGG + Intergenic
1183547622 22:38463283-38463305 AGCACCAGAAAGGCCCCTGGAGG + Intergenic
1183720845 22:39560479-39560501 GGGTCTAGAGAGACCCCTCTGGG + Intergenic
1183933954 22:41251192-41251214 GGCAGTACAAAGGCCCCTGGCGG + Intronic
1185383807 22:50522494-50522516 GGCTCTAGAAAGTCATCTGCTGG - Exonic
951720086 3:25689085-25689107 TGGTCAAGAAAGGCCCCTTTAGG + Intergenic
955392882 3:58534130-58534152 GTCTCCAGAAAGGGCTCTGTTGG + Exonic
955514856 3:59716446-59716468 GGCTCTAAAATGGCCACTCTGGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
957874834 3:86131525-86131547 GTCTCTAAAATGGCCCCTTTCGG - Intergenic
957939481 3:86987652-86987674 GGCTCTATAAACCCCACTGTAGG + Intronic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
970942337 4:21649585-21649607 GGCCTTAAAAAGTCCCCTGTAGG + Intronic
971153751 4:24061119-24061141 GGCTCTAGATTGACCCCTGTGGG - Intergenic
971365813 4:25976353-25976375 GCCTCTAAAATGGCCCCCGTGGG + Intergenic
973191230 4:47388344-47388366 GGCTCTAGAAAAGTCACTCTGGG + Intronic
977067233 4:92333365-92333387 GTTTCCAGAAAGGCACCTGTGGG - Intronic
978387130 4:108187363-108187385 GGCCCTAGAAAGCCCTCTCTCGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986359219 5:6959869-6959891 GGCTCTAGAAAGCTCCAGGTTGG - Intergenic
988717720 5:33844425-33844447 GCCTCTAAAATGGCCCCTTTGGG + Intronic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
992805376 5:80332131-80332153 AGCTCCAGAAGGGCTCCTGTGGG - Intergenic
994415494 5:99464676-99464698 GCCCCCAGAAAGGCCCCAGTGGG - Intergenic
999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG + Intronic
1000892795 5:166818812-166818834 GGCTCAAGCAAGGCAGCTGTTGG + Intergenic
1002649175 5:180679294-180679316 GGCTCTCCAAGGGCACCTGTGGG + Intergenic
1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG + Intronic
1006777800 6:36609736-36609758 GGCTTAAGAAAGGCTCCTTTGGG + Intergenic
1006981033 6:38148439-38148461 CTCTCTGGAAAGGCCCTTGTTGG + Intronic
1008219160 6:48834803-48834825 ATCTCTGGAAAGGCCCCTCTTGG + Intergenic
1011729363 6:90244796-90244818 GGAGCTAGAAAGGCCCATGAGGG - Intronic
1015814455 6:137193639-137193661 AGCTCTAGAAAGGACACTCTGGG + Intergenic
1016622634 6:146130004-146130026 GGCTTTAGAAAGGCAATTGTAGG + Intronic
1016642133 6:146361193-146361215 GGCTCCAGAACTGCCCCTGTTGG - Intronic
1019417668 7:934765-934787 GGCCCTAGAGACGCCCCTATGGG - Intronic
1019573488 7:1724983-1725005 GGCCCTGGCGAGGCCCCTGTGGG + Intronic
1020115296 7:5472823-5472845 GGGTCCAGAACGGCCACTGTGGG - Intronic
1020264892 7:6553707-6553729 GGCTCCAAAAAGCCCTCTGTAGG - Intergenic
1022355290 7:29609052-29609074 GGCTTCAGAAAGGACCCTGACGG + Intergenic
1022904917 7:34846350-34846372 TGCTATAGAAAGGGCCCTTTTGG - Intronic
1023863759 7:44229311-44229333 GGCTCTGGAGTGGCCCCTCTAGG + Intronic
1025116737 7:56264689-56264711 GCCTCTAAAATGGCCCCTTTGGG + Intergenic
1025246926 7:57324523-57324545 GGCTCTAAAATGGCCGCTCTGGG + Intergenic
1026569625 7:71517985-71518007 AGCTCATGAAAGGCCCCTGGGGG + Intronic
1026730620 7:72908658-72908680 GGCTCTAAAATGGCCGCTCTGGG - Intronic
1026959395 7:74398856-74398878 GGCTCTAGGGAAGCCCCTGGGGG - Intronic
1028155313 7:87422716-87422738 TGCTCAGGAAAGGCCCCTCTGGG - Intronic
1032495806 7:132361259-132361281 GCCTCTTCAAAGGCCCCTGCAGG + Intronic
1034543092 7:151771978-151772000 GGGTCTAGAATGGCGCCTGAAGG - Intronic
1034944848 7:155255292-155255314 GGCTCAAGCAGGGCCGCTGTGGG - Intergenic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1038752251 8:30306224-30306246 AGCTCTAGAAAGGAAGCTGTAGG - Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1042709267 8:71697102-71697124 GCCTCTAAAATGGCCCCTTTGGG - Intergenic
1045148695 8:99378114-99378136 GGCTCTAAAATGGCCGCTCTGGG - Intronic
1049668017 8:143856765-143856787 GGCTCTAGAAAATCCCTGGTAGG - Intergenic
1049729041 8:144166580-144166602 GGCTCTATAAGTGCCACTGTTGG + Intronic
1050103082 9:2138813-2138835 GGCCCTAGAAAGAACCATGTGGG + Intronic
1050622979 9:7474059-7474081 GGCTCTATAAAGTCCTCTATGGG + Intergenic
1051555026 9:18373596-18373618 GGGTTTAGAAGAGCCCCTGTTGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1189220482 X:39367712-39367734 GCCTCTAGAAAGTCTCATGTCGG + Intergenic
1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG + Intergenic
1191726977 X:64291947-64291969 GGCACTAGGTAGGCACCTGTGGG + Intronic
1192182097 X:68922516-68922538 GGGTCTAGAGAGGCCTCTGCTGG - Intergenic
1192562861 X:72138996-72139018 GGCTGGAGACAGGCCCCGGTGGG + Exonic
1198610021 X:138388245-138388267 GGTTCTAGATATGCCCTTGTTGG - Intergenic
1200950448 Y:8893773-8893795 GACTCTAAAATGGCCCCTTTCGG + Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic