ID: 948902798

View in Genome Browser
Species Human (GRCh38)
Location 2:240964758-240964780
Sequence ACGCCCTGCTCAGGCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948902794_948902798 -9 Left 948902794 2:240964744-240964766 CCAGACTTTGGGCCACGCCCTGC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902785_948902798 26 Left 948902785 2:240964709-240964731 CCTGGCCTTGCTGCCGCCTTTGA 0: 1
1: 0
2: 12
3: 229
4: 1929
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902792_948902798 -7 Left 948902792 2:240964742-240964764 CCCCAGACTTTGGGCCACGCCCT 0: 1
1: 0
2: 2
3: 11
4: 136
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902793_948902798 -8 Left 948902793 2:240964743-240964765 CCCAGACTTTGGGCCACGCCCTG 0: 1
1: 0
2: 1
3: 11
4: 119
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902790_948902798 2 Left 948902790 2:240964733-240964755 CCACTCTGTCCCCAGACTTTGGG 0: 1
1: 0
2: 3
3: 36
4: 298
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902786_948902798 21 Left 948902786 2:240964714-240964736 CCTTGCTGCCGCCTTTGAACCAC 0: 1
1: 0
2: 4
3: 4
4: 108
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902787_948902798 13 Left 948902787 2:240964722-240964744 CCGCCTTTGAACCACTCTGTCCC 0: 1
1: 0
2: 2
3: 15
4: 203
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902784_948902798 27 Left 948902784 2:240964708-240964730 CCCTGGCCTTGCTGCCGCCTTTG 0: 1
1: 0
2: 3
3: 22
4: 523
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178
948902788_948902798 10 Left 948902788 2:240964725-240964747 CCTTTGAACCACTCTGTCCCCAG 0: 1
1: 0
2: 2
3: 27
4: 218
Right 948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948902798 Original CRISPR ACGCCCTGCTCAGGCTCACA GGG Intronic
900463081 1:2810624-2810646 AGGCCCTGCACAGGGGCACAGGG - Intergenic
900607654 1:3531050-3531072 CCGCCCTGCCCAGGCTCGCCCGG + Intronic
902878545 1:19355673-19355695 GCGCCCCGCTGAGGCTCTCAAGG + Intronic
903178771 1:21595170-21595192 TCCCCCTGCTCAGGCCCACCTGG + Intergenic
905772639 1:40648246-40648268 AGGACCTGCTCAGGATCACATGG - Intronic
906034414 1:42741461-42741483 ACGCCCTGGGCGGGCACACAGGG - Intergenic
906687216 1:47770432-47770454 ACGCTTTGCTCAGCCTCACTGGG + Intronic
907414444 1:54304502-54304524 ACTCCCTACTCAGCCTCACCTGG - Intronic
907864880 1:58390029-58390051 TCGCCCTGCTAAGGCCCTCAGGG - Intronic
908908879 1:69049167-69049189 AGCCTCTGCTCAGGCACACATGG - Intergenic
912125329 1:106530410-106530432 ACCTTCTTCTCAGGCTCACATGG + Intergenic
916706143 1:167352401-167352423 AGGCCATGATCAGGCTCATAAGG - Intronic
920648083 1:207817936-207817958 CTGCCCTGCTCTGGCTCCCAAGG + Intergenic
921110887 1:212035600-212035622 ACCCCCTGCGCAGGCGCTCAAGG + Exonic
923560757 1:235039254-235039276 ACATTCTTCTCAGGCTCACATGG + Intergenic
924384308 1:243487943-243487965 TCGCCCTGCTCAGCCTCCGATGG - Intronic
1063759080 10:9051775-9051797 ACTCCATGCTTTGGCTCACAGGG + Intergenic
1069578837 10:69551311-69551333 ACCCCATGCTCAAGCTCCCATGG - Intergenic
1071615206 10:87069271-87069293 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1074702163 10:116102107-116102129 AAGCCTTGCTCAGAGTCACATGG + Intronic
1075726420 10:124613079-124613101 CTGCCCTACTCAGGCACACATGG - Intronic
1076033810 10:127182038-127182060 ACGCATTGCTCAGTCACACAAGG - Intronic
1076083028 10:127600526-127600548 AGCCCTTGCTCAGGCTCCCATGG - Intergenic
1076560201 10:131357807-131357829 GCTCCCTGCTCCGGCTCTCAGGG + Intergenic
1077064810 11:636512-636534 ACCCCCTGCCCAGGGTCAGAGGG + Intergenic
1077721779 11:4637335-4637357 ACGCTCTGCTCAGACGCCCAAGG - Intergenic
1079679015 11:23269624-23269646 ACATCCTTCTCAAGCTCACATGG + Intergenic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1087251166 11:95902130-95902152 ACACCCTGCCCATGGTCACATGG - Intronic
1087568637 11:99895772-99895794 AGGCACTGCTCAAGCCCACATGG + Intronic
1088696597 11:112371260-112371282 ACATCCTTCTCAGGCTCACCTGG + Intergenic
1091038285 11:132253634-132253656 ATGACTTGCTCAGGCTCACGTGG + Intronic
1091353542 11:134916303-134916325 CTGCCCTTCACAGGCTCACAGGG - Intergenic
1091562102 12:1622643-1622665 AAGCCCTCCTCTGGCTCTCAGGG - Intronic
1093397778 12:18704568-18704590 CCGCCCTCCTCAGCCTCCCAAGG + Intronic
1096751482 12:53761576-53761598 CCACCCTCCTCAGGCCCACAAGG - Intergenic
1100225514 12:92552085-92552107 ACTCCAGGCTCAGGCTCAAATGG - Intergenic
1101345961 12:103886373-103886395 CCACCCTTCTCAGGCTCTCAGGG - Intergenic
1103433385 12:120906101-120906123 AGGGCCTGCCCAGGCTTACAGGG + Intergenic
1104837210 12:131799410-131799432 TCGCCCTGCACAGGATCTCATGG + Exonic
1107717326 13:43213935-43213957 CCGCCCTGGCCAGGTTCACATGG + Exonic
1108395462 13:49986993-49987015 ACTCCCTGCCCAGTGTCACATGG + Intergenic
1108855309 13:54786245-54786267 TCGCCCTGCTTGGGCTCCCAGGG + Intergenic
1109352663 13:61204955-61204977 ATGCCCTGGTCAGGGCCACAAGG + Intergenic
1110248433 13:73354213-73354235 AGGACCTGCTCAGGCTCAATCGG + Intergenic
1111545600 13:89730809-89730831 ACATCCTTCTCAAGCTCACATGG - Intergenic
1112394319 13:99014557-99014579 ACCCCCTTCTCAGTCTCAGATGG + Intronic
1113662544 13:112117432-112117454 ACGCCCTGCACAGATTCACATGG + Intergenic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1117349846 14:54870525-54870547 TCGCCCTGCTTTGGCTCACTGGG - Intronic
1121297456 14:92840870-92840892 CCTCCCACCTCAGGCTCACAAGG + Intergenic
1121465853 14:94115146-94115168 AAGACATGCTCAGGGTCACATGG - Intronic
1121657681 14:95609721-95609743 TCTCCCAGCTCAGCCTCACAAGG - Intergenic
1127081669 15:55386649-55386671 CCGCCCGCCTCAGGCTCCCAAGG - Intronic
1127781963 15:62324460-62324482 ACTCCTTGCTCAGGTTCTCAGGG + Intergenic
1127836948 15:62797709-62797731 GTGCCCTGCTCTGGCCCACAAGG - Intronic
1128072360 15:64805914-64805936 ACAGCCTGCTGAGGCTCCCATGG - Intergenic
1128309311 15:66620654-66620676 ACCCCCTCCCCAGGCTCTCAGGG - Intronic
1129155530 15:73714964-73714986 ATGTCCTGCTCAGGGTCATAGGG - Intergenic
1132302828 15:100787128-100787150 TCGGCCTGCTCCAGCTCACATGG + Intergenic
1132658632 16:1051828-1051850 AGGCCCTGGTCATGCTCTCATGG - Intergenic
1133206555 16:4237569-4237591 AAGCCCTGCTTAGCCTAACAAGG + Intronic
1133826494 16:9282682-9282704 TCGCCCTGTTCAGCCTCAGATGG - Intergenic
1134862819 16:17575667-17575689 AGGCCCTGCCCAGCCTGACATGG + Intergenic
1135537278 16:23303670-23303692 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1135970287 16:27067244-27067266 ACCCGCTGCTCAGGCTGGCATGG - Intergenic
1136291113 16:29271979-29272001 CAGCCCTGCTGAGTCTCACAGGG - Intergenic
1136417520 16:30112971-30112993 ACGACCTGCACACCCTCACATGG + Intronic
1137805970 16:51305603-51305625 AGGCCCTGCTCTGCCTCCCAGGG + Intergenic
1138372401 16:56537789-56537811 CCGCCCTCCTCAGCCTCCCAAGG + Intergenic
1140066390 16:71615098-71615120 AGGGCCTGCGCAGGCTCACAGGG + Intergenic
1142283090 16:89159700-89159722 CCGGCAAGCTCAGGCTCACACGG + Intergenic
1142328020 16:89430932-89430954 ACCCACTTCCCAGGCTCACAGGG - Intronic
1142768976 17:2083029-2083051 ACACCTCGCTCAGGGTCACATGG + Intronic
1143497984 17:7323323-7323345 AAGTCCTGCCCAGGCCCACAGGG - Intronic
1147563024 17:41520471-41520493 AGAACATGCTCAGGCTCACAGGG - Exonic
1149141027 17:53434170-53434192 ACGCAATGCTCAGGCCCACCAGG + Intergenic
1151299206 17:73209956-73209978 AAACCCTGCTCAGCCTGACAGGG - Intronic
1152204739 17:78968477-78968499 GCGCCCTGCTCAGGGCCCCATGG - Intergenic
1153565053 18:6410906-6410928 AGGCCCTGCTCAGTGTCACCTGG - Intronic
1154111887 18:11577326-11577348 GCCCCCATCTCAGGCTCACAAGG + Intergenic
1159256591 18:65955021-65955043 CCACCCTCCTCAGCCTCACAAGG - Intergenic
1161397375 19:4051951-4051973 ACGCCCTGCTGTGACTCAGAGGG + Intronic
1163359968 19:16839672-16839694 ATTCTCTGCTCAGGCTCACAGGG - Intronic
1163812998 19:19445981-19446003 AGGCCCTGCCCAGGCTCATGTGG + Intronic
1164708407 19:30337181-30337203 AACCCCTGCTGAGGCTCTCAGGG + Intronic
1164836671 19:31359424-31359446 GTGACCTGCTCAGGCTCACTGGG - Intergenic
1165075997 19:33280216-33280238 CAGCCCTGCTCAGGCTGGCAGGG + Intergenic
1165812098 19:38617896-38617918 AGGCCCAGCTCAGGCCCCCAGGG - Exonic
1166000217 19:39873195-39873217 ACCCCCAGGGCAGGCTCACATGG + Intronic
1167475900 19:49700870-49700892 TAGCCCTGCTCAGGCTCTCCTGG + Intronic
925519934 2:4732810-4732832 ACTTTCTGCTCAAGCTCACATGG + Intergenic
925784296 2:7414982-7415004 ACACACTTCTCACGCTCACATGG - Intergenic
926084112 2:10010292-10010314 TGGCCCTGCTCAGGGGCACAAGG - Intergenic
926213391 2:10888291-10888313 CCGCCCACCTCAGGCTCCCAAGG + Intergenic
927397462 2:22670253-22670275 ACATCCTCCTCAGGCTCTCAAGG - Intergenic
935643113 2:105309239-105309261 CTGCCCTGCTCCCGCTCACAGGG - Intronic
935849605 2:107204451-107204473 AAGCCCTGCTCAGGCTGGCCAGG + Intergenic
936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG + Intronic
938387108 2:130874386-130874408 AGGCCCTCCTCAGGCCCACAAGG + Intronic
940583353 2:155610001-155610023 ACGACCTGCTCAGTCTCTCGTGG + Intergenic
945754409 2:213829273-213829295 ACCACCAGCTCAGGCCCACAGGG + Intronic
946878572 2:224155233-224155255 AGGCCCTGCACAGGCACCCAAGG - Intergenic
947854583 2:233314489-233314511 ACGCCCTGGTCAGCCCCGCAGGG + Intronic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948655049 2:239471256-239471278 ACGCCTTGCTCACGCTCATCAGG - Intergenic
948811168 2:240479159-240479181 ACTCCCTGCTCAGGTGCCCATGG - Intergenic
948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG + Intronic
1169933368 20:10857612-10857634 ACTCCCTGCCCAGGGTCCCAGGG - Intergenic
1171907834 20:30915042-30915064 AGGCCTTGGGCAGGCTCACAAGG - Intergenic
1175787103 20:61718568-61718590 ACCACCTGCACAGGCTCACAGGG + Exonic
1176041442 20:63067965-63067987 AGGCCGTGCTCAGGCACACGGGG - Intergenic
1176117451 20:63439274-63439296 CCGCCCTGCTCCTGGTCACAAGG + Intronic
1176126754 20:63478972-63478994 ACGTCCTGCCCACGCTCACCAGG + Intergenic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1180044143 21:45295199-45295221 ACGCCCACCTCGGGCCCACAGGG + Intergenic
1180081661 21:45490134-45490156 AGCCCCTGCTCAGGCCCACAGGG + Intronic
1180341278 22:11621212-11621234 AGGCCTTGGGCAGGCTCACAAGG - Intergenic
1181407559 22:22695441-22695463 CTGCCCAGCTCAGGCTCCCATGG + Intergenic
1183083990 22:35475288-35475310 ACCCCTTGTTCAAGCTCACAGGG - Intergenic
1183290676 22:36999975-36999997 CCTCCCTGCTCAGGCTCAAAAGG - Exonic
1183355216 22:37355205-37355227 AATCCCTGCTCAGTCTCACGTGG + Intergenic
1183670706 22:39270736-39270758 GCCCCTTGCTCAGGGTCACAAGG - Intergenic
1185101327 22:48842455-48842477 ACGCGTGGCTCAGGCCCACACGG - Intronic
1185266279 22:49906011-49906033 ACGGCCTGCTCTTGCTCCCAGGG + Intronic
1185311496 22:50158209-50158231 ACGCCCTGCCCAGGCACGCCTGG + Intronic
950336752 3:12200840-12200862 AGTCACTGCTCAGGCTCACCTGG + Intergenic
952426679 3:33182366-33182388 ACATTCTTCTCAGGCTCACATGG - Intronic
952566071 3:34660117-34660139 TCTTCCTGCTCAGGCTCCCAAGG + Intergenic
952718932 3:36512286-36512308 AGGCTCTGCTCTGGCTCACAGGG - Intronic
953856289 3:46501772-46501794 AAGCCCTGCTCTGGCTCAGTTGG + Intergenic
959906121 3:111712761-111712783 ATGCCCTGCACATGCTCACGAGG - Intronic
961071346 3:123930875-123930897 ACCCCCTGCCCAGAATCACATGG + Intronic
961427095 3:126856871-126856893 ATGACATGCTCAGGGTCACAAGG - Intronic
961535094 3:127565759-127565781 ATGCCCTGCTCAGGCTCGGATGG + Intergenic
961986452 3:131139912-131139934 AGGCCCTGCCCAGGCTCTCATGG - Intronic
962317206 3:134366373-134366395 AGGCTCTGGTCAGGCTCTCATGG + Exonic
962353977 3:134678025-134678047 ACTCCCTGCTCAAACCCACAGGG + Intronic
969623250 4:8289549-8289571 GCGTCCTGCTCAGGCCCACCTGG - Intronic
969638408 4:8382495-8382517 ACCCCCTGCCCAGGCACAGAGGG + Intronic
971264772 4:25087995-25088017 GCGACCTGCCCAGGCCCACAAGG - Intergenic
971710835 4:30109865-30109887 ACATTCTTCTCAGGCTCACATGG - Intergenic
972355928 4:38279573-38279595 TCCCCCTGCTCAGCCTCGCAGGG - Intergenic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
977002367 4:91519542-91519564 AGCCACTGCTCAGGCACACATGG - Intronic
977574872 4:98665089-98665111 AAGCCCAGCACAAGCTCACATGG + Intergenic
977846544 4:101773755-101773777 AGCCACTGCTCAGGCCCACATGG - Intronic
979178147 4:117691533-117691555 AGGCACTGCTCAAACTCACATGG + Intergenic
979219086 4:118200326-118200348 ACGGCCACCTCAGGCCCACAGGG + Intronic
982907860 4:161099875-161099897 ACCACCTCCTCAGGCTCAGATGG + Intergenic
983352283 4:166605775-166605797 ACATTCTTCTCAGGCTCACATGG + Intergenic
985786065 5:1895591-1895613 CAGCCATGCTCAGCCTCACAAGG - Intergenic
986331375 5:6718383-6718405 AGGCCCTGCTGAGCATCACAAGG - Intronic
989566700 5:42908565-42908587 ACACCCTGCTCAGGTTCGCAGGG + Intergenic
990204565 5:53414836-53414858 ATGCCCTGCTCAGCACCACAAGG + Intergenic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
994733466 5:103522674-103522696 AGGCCCTGCTCTGGCTTTCAAGG - Intergenic
995929102 5:117414196-117414218 ATCCCCTTCTCAGGCTAACAAGG - Intergenic
997590463 5:135069049-135069071 TCACCCTGCTCAGGCTGTCAGGG + Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
999449185 5:151665616-151665638 AGCCCCTGCTCAGCCTCAGATGG - Intronic
1000134919 5:158337909-158337931 ACACTCTTCTCAAGCTCACATGG - Intergenic
1002399050 5:178981092-178981114 AGGCCCTTCCCATGCTCACAGGG + Exonic
1004650579 6:17603684-17603706 ACTCCCACCTCAGCCTCACAAGG + Intronic
1007420986 6:41719582-41719604 ACACCCGGCCCAGGGTCACACGG + Intronic
1009324825 6:62337664-62337686 AGCCACTGCTCAGGCCCACATGG + Intergenic
1011504289 6:88023943-88023965 ATGACTTGCTCAGGGTCACATGG + Intergenic
1013244429 6:108273373-108273395 ACGCACTGCTCAAGTTTACAAGG - Intergenic
1013679349 6:112506627-112506649 ACACTCTTCTCAAGCTCACATGG - Intergenic
1013899550 6:115138004-115138026 CTCCCCTTCTCAGGCTCACAGGG - Intergenic
1014855517 6:126396326-126396348 ACCACCTCCTCAGGCCCACAGGG + Intergenic
1015345139 6:132147702-132147724 ACTGCCAGCTGAGGCTCACAAGG - Intergenic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1019644343 7:2121087-2121109 ACTCCCGGCGCAGGCTCCCAGGG + Intronic
1021307104 7:19045632-19045654 ACTCCCTGCTTAGCCTCAGAGGG - Intronic
1022718990 7:32925678-32925700 AAGCCCTACTCAGGCACTCAGGG + Intergenic
1026729312 7:72897467-72897489 ACGCCCTGGTGAGGATCATAAGG + Intronic
1040421037 8:47240812-47240834 ACCCCCTGCTGACACTCACATGG - Intergenic
1045035555 8:98173877-98173899 ACCCCTAGCCCAGGCTCACAGGG - Intergenic
1045654225 8:104370152-104370174 AAGCCCTGCTCATGCACAAAGGG + Intronic
1053524136 9:38811464-38811486 ACCGCCTGCTCAGTCTCACAAGG - Intergenic
1054196368 9:62035873-62035895 ACCGCCTGCTCAGTCTCACAAGG - Intergenic
1054642038 9:67552814-67552836 ACCGCCTGCTCAGTCTCACAAGG + Intergenic
1055057807 9:72039694-72039716 AAGCCCTGCCCAGGCTCACAGGG - Intergenic
1056178120 9:84055796-84055818 ATGCCCGGCCCAGACTCACAAGG - Intergenic
1057107088 9:92429541-92429563 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1060958386 9:127661202-127661224 ACCCCCTACTCAGGCTCACCTGG - Exonic
1062011888 9:134271740-134271762 GTGCCCTGCTCAGGGTCTCACGG - Intergenic
1062582126 9:137233427-137233449 CCGGCCTGCTCAGGCTCTCTGGG - Intronic
1185784344 X:2877259-2877281 ACTCCCTGCTGAGGCTCTCAGGG + Exonic
1186310509 X:8312788-8312810 ACCCTCTGCACAGTCTCACAAGG + Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1188244287 X:27821753-27821775 AAGCTCTGCTCAGGATTACAGGG - Exonic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1190297868 X:49039118-49039140 ACCCCCTGCTCAGGTGCCCAGGG - Exonic
1195241975 X:102960812-102960834 AGCCACTGCTCAGGCACACATGG - Intergenic
1198551118 X:137745873-137745895 ATGACATGCTCAGGGTCACAAGG + Intergenic