ID: 948903469

View in Genome Browser
Species Human (GRCh38)
Location 2:240967293-240967315
Sequence CAGTCCAATGGGCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948903469_948903485 28 Left 948903469 2:240967293-240967315 CCCTCCACCCGCCCATTGGACTG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 948903485 2:240967344-240967366 GGATGACTCCCGCATCCAGATGG 0: 1
1: 0
2: 1
3: 4
4: 63
948903469_948903480 7 Left 948903469 2:240967293-240967315 CCCTCCACCCGCCCATTGGACTG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 948903480 2:240967323-240967345 TGACCTCAGTCCTTCTGCCCAGG 0: 1
1: 1
2: 2
3: 30
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948903469 Original CRISPR CAGTCCAATGGGCGGGTGGA GGG (reversed) Intronic
900397189 1:2457936-2457958 CTGTCCACCGGGCGGGTGGTAGG + Intronic
900846528 1:5107344-5107366 CAGCCCAGTGGGCAGGCGGAGGG + Intergenic
904267434 1:29325834-29325856 TTGTCCCATGGGCGGGTGGTGGG + Intronic
905552580 1:38855195-38855217 CAGTCCAGGGGGGAGGTGGAAGG + Intronic
909467129 1:75984993-75985015 CAGTCCAATGGGCAGGGGTGGGG + Intergenic
910199109 1:84679914-84679936 CAGTCCAATGTGGGGTTGGGGGG - Intronic
922930099 1:229382180-229382202 CAGTGGAGTGGGCGGCTGGAGGG + Intergenic
1064790420 10:18951727-18951749 CAGTGCAGTGGGCGGGCTGAAGG + Intergenic
1065889573 10:30109650-30109672 CAATCCAAGGGTTGGGTGGATGG + Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070115984 10:73529285-73529307 CAGGCCTATCGGAGGGTGGAGGG + Intronic
1071477154 10:86034851-86034873 CAGATCAATGGGTTGGTGGATGG + Intronic
1076578000 10:131483666-131483688 TAGACAAATGGGTGGGTGGATGG + Intergenic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1084268431 11:68016740-68016762 GAGCCCAATGGGCTGGGGGAAGG - Intronic
1084464496 11:69314098-69314120 GAGTCCGAAGGGTGGGTGGATGG - Intronic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1096113631 12:49042600-49042622 GAGTCCATTGGGCTGCTGGAGGG + Exonic
1096463157 12:51833974-51833996 CAGACAAATGGACGGATGGATGG + Intergenic
1096463162 12:51834006-51834028 CAGACAAATGGACGGATGGATGG + Intergenic
1097236049 12:57540379-57540401 CTGTCCTATGGGTGGGTTGAAGG + Intronic
1107989326 13:45803373-45803395 CAGTCTAATGGGGGGTTGGCTGG + Intronic
1109782627 13:67131954-67131976 CAGTCAAATGTGCTGATGGATGG - Intronic
1114063117 14:19037965-19037987 CAGTCCAGTGCGCGGAGGGACGG + Intergenic
1114099141 14:19362030-19362052 CAGTCCAGTGCGCGGAGGGACGG - Intergenic
1121963183 14:98280475-98280497 CAGGCCAAGGGTGGGGTGGAGGG - Intergenic
1122355065 14:101118007-101118029 CAGATGAATGGGTGGGTGGATGG - Intergenic
1122957372 14:105076935-105076957 CAGGCCAGAGGGCGGGTGGGGGG + Intergenic
1123493433 15:20800218-20800240 CAGTCCAGTGCGCGGTGGGACGG - Intergenic
1123549942 15:21369320-21369342 CAGTCCAGTGCGCGGTGGGACGG - Intergenic
1123878923 15:24656198-24656220 GAGGCCTATGGGAGGGTGGAAGG + Intergenic
1124511547 15:30331605-30331627 CAGCCCTCTGGGCGTGTGGAGGG + Intergenic
1124731367 15:32199152-32199174 CAGCCCTCTGGGCGTGTGGAGGG - Intergenic
1125149624 15:36517100-36517122 CAGTCCTAAGAGCGGGTGCATGG - Intergenic
1125190496 15:36986955-36986977 CAGGCCAAGGGGTGTGTGGAAGG + Intronic
1127306129 15:57707080-57707102 CAGTCCTACGGGCGAGTGGACGG + Intronic
1130862921 15:87907495-87907517 CAGTCTTATGGGCAGGTGCATGG - Intronic
1131344228 15:91631142-91631164 CAGCCCAGAGGGTGGGTGGATGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1202958271 15_KI270727v1_random:96538-96560 CAGTCCAGTGCGCGGTGGGACGG - Intergenic
1132626523 16:894167-894189 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132626534 16:894199-894221 CAGTCCAGTGGACAGGGGGACGG - Intronic
1135230361 16:20700682-20700704 AAGTGCAATGGGTGGGTGCATGG + Intronic
1135618661 16:23934045-23934067 AAGTCAAATGGGTGGATGGATGG - Intronic
1136295311 16:29298262-29298284 TAGACGAATGGGTGGGTGGATGG + Intergenic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1142101210 16:88272268-88272290 TAGACGAATGGGTGGGTGGATGG + Intergenic
1147339872 17:39746949-39746971 GAGTCCACTGGATGGGTGGAGGG - Exonic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1151684545 17:75639068-75639090 CAGGCCAATTGCAGGGTGGAGGG + Exonic
1152971090 18:161567-161589 CAGCCTAATGGGGGGGTGGGAGG - Intronic
1154450984 18:14474756-14474778 CAGTCCAGTGCGCGGTGGGACGG - Intergenic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1160958168 19:1704666-1704688 CAGATCAATGGACGGATGGATGG + Intergenic
1161237748 19:3206201-3206223 CAGGCCAGTGGGTGGGTGGGTGG + Intronic
1161899219 19:7105310-7105332 CAGACAAATGGGTGGGTGGATGG + Intergenic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1163731867 19:18954243-18954265 CAGGCAGATGGGTGGGTGGATGG - Intergenic
1163760312 19:19132894-19132916 CAGTCCTGTGGGTGGGTGGGGGG - Intronic
1165332817 19:35150798-35150820 GAGGGCAATGGGCGGGAGGAGGG + Intronic
1165469859 19:35996934-35996956 CAGACCAAAGGGAGGATGGACGG + Intergenic
1165485648 19:36093973-36093995 CAGGCAAATGGGCTGGTGGTGGG - Intronic
1165800117 19:38544094-38544116 CAGACCAATGGAAGCGTGGATGG - Intronic
926803441 2:16682929-16682951 AAGTTCACTGGGCGGCTGGATGG + Intergenic
928008246 2:27582743-27582765 GAGACCACTGGGCGGGTGGATGG + Intergenic
928607167 2:32953627-32953649 CAGGCCCATGGGCCGGAGGAGGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933627166 2:84614122-84614144 CAGTACACTGTGCGGGTGGTGGG - Intronic
935321623 2:101895137-101895159 CAGGCCTATGGGGGGGTTGATGG - Intergenic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
936046096 2:109189031-109189053 GACTCCTATGGGAGGGTGGAAGG - Intronic
938480469 2:131658127-131658149 CAGTCCAGTGCGCGGTGGGACGG + Intergenic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
948781587 2:240324855-240324877 CTGTCCCATGTGCCGGTGGAGGG - Intergenic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
948962779 2:241354511-241354533 CAGTCCAGTGGGCAGGAAGAAGG - Intergenic
1171151098 20:22827034-22827056 CTGTCCAATGTGGGAGTGGATGG - Intergenic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1175154827 20:56963615-56963637 CAGTCCAATGGGAGAGAAGATGG + Intergenic
1176445253 21:6815817-6815839 CAGTCCAGTGCGCGGTGGGACGG + Intergenic
1176823420 21:13680850-13680872 CAGTCCAGTGCGCGGTGGGACGG + Intergenic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1179551094 21:42144444-42144466 CAGTCAGATGGTTGGGTGGATGG - Intergenic
1180481610 22:15760594-15760616 CAGTCCAGTGCGCGGAGGGACGG + Intergenic
1180834352 22:18922453-18922475 GAGGCCAATGGGTGGGGGGAAGG - Intronic
1183116010 22:35693354-35693376 CAGTATCACGGGCGGGTGGAGGG - Intergenic
1184251545 22:43263233-43263255 CAGTCTGCTGGGCGGGTGGGGGG - Intronic
1184604716 22:45565711-45565733 CAGACCAATGGATGGATGGATGG + Intronic
1203284441 22_KI270734v1_random:147752-147774 GAGGCCAATGGGTGGGGGGAAGG - Intergenic
950541307 3:13614936-13614958 CAGACGGATGGGTGGGTGGATGG - Intronic
950610837 3:14125590-14125612 CAGTCCCTTGGGAGGGAGGAAGG + Intronic
950964587 3:17137490-17137512 CAGCCCTAGGGGCGTGTGGAGGG - Intergenic
954607973 3:51928691-51928713 CCATCCAATGGGAGGTTGGAGGG + Intergenic
957942591 3:87023558-87023580 GAGTCCAAGGGGTGGTTGGAAGG - Intergenic
959083504 3:101827514-101827536 GGGTGCAGTGGGCGGGTGGAGGG - Exonic
960139626 3:114139614-114139636 CACTCCAAAGGGCAGGTAGAAGG + Exonic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
971330538 4:25677808-25677830 GATTCCAGTGGGTGGGTGGATGG - Exonic
973742642 4:53933234-53933256 CAGTCCAATCAGCGTGAGGAAGG + Intronic
977675472 4:99742352-99742374 TAGTACAATGGGTAGGTGGATGG - Intergenic
979532589 4:121784941-121784963 AAGGACAATGGGTGGGTGGATGG + Intergenic
981734892 4:147938200-147938222 GAGGCCTATGGGAGGGTGGAGGG + Intronic
983827532 4:172282333-172282355 TAGTCCTTTGGGTGGGTGGATGG - Intronic
988691753 5:33579583-33579605 TAGTTCAATGGGGAGGTGGAGGG - Intronic
992861556 5:80916149-80916171 CAGTCCTGTGGGTGAGTGGATGG - Intergenic
993854195 5:93052502-93052524 CCGTCCACTGGGGTGGTGGATGG + Intergenic
996307087 5:122059713-122059735 CAGTCCAAAGGCTGGGTAGAGGG - Intronic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
1001145772 5:169183112-169183134 CACTCCAATGTGCTGGTGGTTGG - Intronic
1002835746 6:863758-863780 CAGTCCAGTGTGCTGTTGGAAGG + Intergenic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1004913484 6:20309004-20309026 GAGTCCAATAGGAGGCTGGATGG + Intergenic
1008925216 6:56885114-56885136 GAGTCCATTGGCCAGGTGGAAGG - Intronic
1009029382 6:58038224-58038246 CTGTCCAGTGGCCAGGTGGATGG - Intergenic
1010256777 6:73767209-73767231 GGGTCCTATGGGAGGGTGGAGGG - Intronic
1013627735 6:111954284-111954306 CAGTTCAAAGGGCCGGTGTAGGG + Intergenic
1019546263 7:1578180-1578202 CAGACAGATGGGTGGGTGGATGG - Intergenic
1020904975 7:14053280-14053302 GATTCCAGTGGGTGGGTGGATGG - Intergenic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1033237362 7:139648910-139648932 CAAGGCATTGGGCGGGTGGAGGG + Intronic
1034057278 7:148048487-148048509 CAGTCCAATGGCAGGGAGGCTGG + Intronic
1035239832 7:157522310-157522332 AAGCCCCATGGGCGGGTGCAGGG - Intergenic
1036799401 8:11779137-11779159 AAGTCCAATATGCTGGTGGAGGG + Intronic
1037319513 8:17630079-17630101 CACTCCCATGGGAGGGTAGAGGG + Intronic
1045919922 8:107517833-107517855 CAGGCCACTGTGCGTGTGGACGG + Intergenic
1049179137 8:141212148-141212170 CATTCCAGTGGGCGGGTGGGCGG - Intronic
1049585987 8:143432598-143432620 CAGTGCGATGGGCGGGAGGGGGG - Intergenic
1055237985 9:74147571-74147593 CATTCCAATGGGCCTGTTGAGGG + Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1061399561 9:130360964-130360986 TAGACAAATGGGCAGGTGGATGG - Intronic
1062247725 9:135578060-135578082 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247794 9:135578406-135578428 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247863 9:135578752-135578774 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1203523942 Un_GL000213v1:68708-68730 CAGTCCAGTGCGCGGTGGGACGG - Intergenic
1185883371 X:3759830-3759852 CAGATGAATGGGTGGGTGGATGG - Intergenic
1189231162 X:39453534-39453556 CTCTCCAATGGGCGGGTGGGGGG - Intergenic
1190399084 X:50013764-50013786 CAGTGCAATGGGCTTGTGCAAGG + Intronic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG + Intergenic
1199871072 X:151899481-151899503 CAGTCTAATGGTGGGATGGATGG - Intergenic
1201901247 Y:19047335-19047357 GTGACCAATGGGTGGGTGGATGG + Intergenic