ID: 948904280

View in Genome Browser
Species Human (GRCh38)
Location 2:240970893-240970915
Sequence CTCTGGGTCTCACAGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948904272_948904280 4 Left 948904272 2:240970866-240970888 CCTGGCATGGTGTGACTGGCGTC 0: 1
1: 0
2: 1
3: 18
4: 142
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904269_948904280 18 Left 948904269 2:240970852-240970874 CCATAGGTGAGAAGCCTGGCATG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904264_948904280 26 Left 948904264 2:240970844-240970866 CCCCAGTCCCATAGGTGAGAAGC 0: 1
1: 0
2: 0
3: 8
4: 147
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904265_948904280 25 Left 948904265 2:240970845-240970867 CCCAGTCCCATAGGTGAGAAGCC 0: 1
1: 0
2: 1
3: 15
4: 114
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904268_948904280 19 Left 948904268 2:240970851-240970873 CCCATAGGTGAGAAGCCTGGCAT 0: 1
1: 0
2: 0
3: 12
4: 106
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904263_948904280 27 Left 948904263 2:240970843-240970865 CCCCCAGTCCCATAGGTGAGAAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
948904266_948904280 24 Left 948904266 2:240970846-240970868 CCAGTCCCATAGGTGAGAAGCCT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948904280 Original CRISPR CTCTGGGTCTCACAGTCATG GGG Intronic
900692932 1:3992659-3992681 CTCAGTATCCCACAGTCATGAGG - Intergenic
900759595 1:4461998-4462020 CACTGGGGCACACAGTTATGGGG - Intergenic
900822020 1:4897150-4897172 GGCTGGGTGTCACAGACATGGGG - Intergenic
900929830 1:5729477-5729499 CTCTCAGTATCACAGCCATGGGG + Intergenic
900991244 1:6099373-6099395 CTCCGGGCCTCACTGGCATGAGG - Exonic
901852132 1:12022336-12022358 CTCTGGGTCCCTCAGGCTTGAGG - Exonic
902395270 1:16129022-16129044 CCCAGGGTCCCACAGCCATGAGG - Intronic
902532980 1:17102475-17102497 CTCTGGGCCTCACCATCCTGTGG + Intronic
904321460 1:29700201-29700223 TTCTGGGGCTCACAGTCAAGAGG - Intergenic
904359378 1:29962068-29962090 TTCTGGGGCTCACAGTCAGGAGG - Intergenic
905023217 1:34832097-34832119 CTCAAGGTCACACAGCCATGTGG - Intronic
905171606 1:36113112-36113134 CTCTAGGTCTAAGAGTCACGGGG + Intronic
905329972 1:37187618-37187640 CTCTGGGACTCAGGGTCATAGGG - Intergenic
905458811 1:38107323-38107345 CTCTGAGTCTCACAGGACTGTGG + Intergenic
905649274 1:39645726-39645748 CTCTGGGTCTCAGTGTCCTTAGG - Intergenic
906568837 1:46819457-46819479 GTCTGTGTCTCACAGTCACGTGG + Intergenic
915900928 1:159846328-159846350 CTCTGGGCCTCCCAGGCATAGGG - Intronic
916123928 1:161552504-161552526 GTCTGGGTCTCACAGGAATCTGG + Intergenic
917210589 1:172628018-172628040 CTCTGGGACACAAAGACATGCGG - Intergenic
918324242 1:183394639-183394661 ATCTGGGGCTGACAGTCAGGTGG - Intronic
919874675 1:201854979-201855001 CACTGGGTTTCACATTCATATGG + Intronic
920369968 1:205472758-205472780 CTCTGGAGGTCACAGTCAGGAGG + Intergenic
920955847 1:210619476-210619498 CTCTGGGTCTCAGAGGAAAGGGG + Intronic
923698732 1:236280998-236281020 CTCTGGCTCTGGCAGTCGTGAGG - Intronic
1063007501 10:1987560-1987582 CCCTGATTCTCACAGCCATGCGG + Intergenic
1064028293 10:11866821-11866843 CTCTGGGTCTCACAGACACCAGG - Intronic
1064224942 10:13474377-13474399 CCCCGAGTCTAACAGTCATGAGG - Intronic
1064566478 10:16644608-16644630 CTCTGGGTCTCCCAGACCTGTGG + Intronic
1068116289 10:52740719-52740741 CTCTGGATCTCAGGGTCCTGGGG - Intergenic
1070917722 10:80165497-80165519 AGCTGGGTCTCATAGTTATGCGG + Intronic
1073804422 10:107081790-107081812 CTCTGGCTATCTCAGTCATGAGG + Intronic
1074241787 10:111646838-111646860 CTCTGTGTCTCACAGTGTAGGGG + Intergenic
1074993605 10:118735380-118735402 CTCTGGATCTCACACTTTTGAGG - Intronic
1075818199 10:125282751-125282773 TTCTGGGTCCCACAGTGCTGAGG + Intergenic
1076735272 10:132456170-132456192 CTGTGGGGGTGACAGTCATGGGG + Intergenic
1077779086 11:5305369-5305391 CTTTTTGTCTCACAGTCATTAGG - Intronic
1078251479 11:9620154-9620176 CCCTGGGTCTCAGAGGCATCTGG + Intergenic
1078360466 11:10663914-10663936 CTCTAGGTCACACAGTCAGAAGG + Intronic
1079592600 11:22198193-22198215 CTCTGGAGCTGACAGTCTTGTGG + Intronic
1079954781 11:26849329-26849351 CTCTGGGTCTCCCTTTCATGGGG - Intergenic
1082685703 11:56236577-56236599 CTCTGACTCAAACAGTCATGTGG + Intergenic
1083594737 11:63913819-63913841 CTCTGGGACTCTGAGTAATGTGG - Intronic
1084406701 11:68978486-68978508 CTCTGGGACACACAGACCTGGGG + Intergenic
1084455335 11:69264976-69264998 CTCTGGGCCTCAGAGCCATGGGG - Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1088685071 11:112278141-112278163 CTCTGTTCCTCACAGTTATGTGG + Intergenic
1089940395 11:122410526-122410548 TTCTGTGTCTCACAGCCTTGGGG + Intergenic
1090464592 11:126922929-126922951 CACAGGGACTCAGAGTCATGAGG - Intronic
1090908050 11:131094610-131094632 CCCAGGGTCCCACAGGCATGGGG + Intergenic
1092249470 12:6884656-6884678 CTCTCGGTCCCGCAGCCATGAGG + Intronic
1094617346 12:32047673-32047695 AAATGGATCTCACAGTCATGGGG + Intergenic
1095813410 12:46395892-46395914 CTCTACCTCTCACAGTGATGGGG - Intergenic
1096564710 12:52469025-52469047 CTCTCGGTCCCACAGTCCTCAGG - Exonic
1096566632 12:52487683-52487705 CTCTCGGTCCCACAGTCCTCAGG - Exonic
1097439103 12:59587605-59587627 CTCTGGGTCTCACAATCTGGGGG - Intergenic
1097817239 12:64088812-64088834 CCCTGCGTCTCCCAGTCATGCGG + Intronic
1099413884 12:82363183-82363205 CTCTAGGTCTCCCAGGCATGTGG - Intronic
1099828970 12:87815665-87815687 TTCTGGGACTCACAGTCAAATGG - Intergenic
1102238793 12:111310789-111310811 CCCTGGGTCACACAGCCAGGTGG - Intronic
1103183845 12:118938704-118938726 ATGTGGGTCTCACAGCCATCCGG + Intergenic
1105214724 13:18277575-18277597 CTCTGGGTCACACAGCACTGGGG + Intergenic
1106770773 13:32958785-32958807 CAGTGGGTCTCATGGTCATGGGG + Intergenic
1109686487 13:65828455-65828477 CTATGGGTTTGACAGTGATGAGG + Intergenic
1110260590 13:73480583-73480605 CTATGGGTTTCACATTCCTGAGG - Intergenic
1112121357 13:96415539-96415561 CTCTGGCTATGCCAGTCATGAGG - Intronic
1120281749 14:82447461-82447483 CACAGGGACACACAGTCATGTGG + Intergenic
1121560702 14:94873409-94873431 GTCTGGGTGTCACACTCTTGGGG - Intergenic
1121942092 14:98080747-98080769 CTCTGTGTCTCACGTTAATGTGG + Intergenic
1122127236 14:99586019-99586041 TTCTGGGCCTAAGAGTCATGTGG - Intronic
1122406592 14:101504602-101504624 TTCTGGCTCCCACACTCATGTGG - Intergenic
1123201817 14:106673437-106673459 CTCTATGTCTCACAGAAATGTGG + Intergenic
1125215529 15:37269291-37269313 CTCTGGGTCTGACAGGCCAGGGG - Intergenic
1126658383 15:51005704-51005726 CTCAGTGGCTCACAATCATGAGG - Exonic
1131032489 15:89197797-89197819 CACTGGCTCCCACAGTCCTGGGG - Exonic
1134893706 16:17864708-17864730 GTCTGGGGCCCACAGTCGTGTGG - Intergenic
1135689718 16:24526488-24526510 CTCTGAGTCCCACTGTGATGGGG + Intergenic
1137860074 16:51837672-51837694 CTCTAGGTCCCACAGACAAGAGG - Intergenic
1141493677 16:84392123-84392145 CACTGGGTAACAGAGTCATGTGG - Intronic
1141913250 16:87075479-87075501 CCTTAGGTCTCACAGCCATGTGG - Intergenic
1141981315 16:87552024-87552046 CTCTCTTTCTCACAGTCCTGAGG - Intergenic
1142898755 17:2999264-2999286 CTCTTGGTATCACAGTGCTGTGG + Intronic
1145238108 17:21223247-21223269 CTCTGTGTCTCTCAGCCATGTGG - Intergenic
1146576258 17:33994457-33994479 CTGTGGGTCCCTAAGTCATGAGG + Intronic
1148863102 17:50614763-50614785 CTCTTGCTCTCACTGACATGAGG + Intronic
1150302453 17:64057720-64057742 GTCTGGATCTCACTGACATGAGG + Intronic
1153233859 18:2967259-2967281 CATTGGGTCTCAAGGTCATGTGG + Intronic
1153724320 18:7940008-7940030 CTCCAGGTGTCACTGTCATGGGG + Intronic
1157504376 18:48216363-48216385 CTCTGAGGCTCACAGTCTGGTGG + Intronic
1158963341 18:62604097-62604119 CTCTGCTCCTCACTGTCATGGGG - Intergenic
1159076439 18:63686700-63686722 CTCTGTGTCACATAGTCCTGTGG + Intronic
1159841824 18:73407055-73407077 CTGGGGCTCTCACACTCATGGGG - Intergenic
1159963106 18:74571029-74571051 TTCTGTGTTTCTCAGTCATGGGG - Intronic
1160272833 18:77403485-77403507 CTCCCTCTCTCACAGTCATGAGG - Intergenic
1160395074 18:78564763-78564785 GTCTGGGTTTCACAGTCCTCCGG + Intergenic
1163468599 19:17484029-17484051 CTCTGGGGTTCACAGTCCTCTGG - Intronic
1165061524 19:33207316-33207338 CTCTGGGTCTCGCAGGCCCGAGG - Exonic
1166186273 19:41141192-41141214 CAGTGGGGTTCACAGTCATGGGG - Intergenic
1167233347 19:48298600-48298622 GCCTGGATCTCACACTCATGAGG - Intronic
1168605745 19:57758819-57758841 CTGTGGGACTCACAGGCTTGTGG - Intergenic
925158292 2:1663605-1663627 CTCTGGGCTGCACAGTCAGGTGG + Exonic
926174720 2:10580413-10580435 CTTTAGGTCTGACAGCCATGGGG + Intronic
926770370 2:16367242-16367264 ATCTGGGTCTTACAGTTATCAGG + Intergenic
932002622 2:67898506-67898528 CTCTGGGCCTCAGATTCCTGTGG - Intergenic
934299598 2:91769163-91769185 CTCTGGGTCACACAGCACTGGGG - Intergenic
934514589 2:94978124-94978146 CCCAGGGTCTCACAGCGATGAGG - Intergenic
934615207 2:95766308-95766330 CTCTGGGCATCACAGTCACTGGG - Intergenic
934645696 2:96058175-96058197 CTCTGGGCATCACAGTCACTGGG + Intergenic
934839100 2:97614264-97614286 CTCTGGGCATCACAGTCACTGGG + Intergenic
935724874 2:106015106-106015128 TTCTGTGTCTCATAGTCCTGTGG - Intergenic
936102084 2:109590940-109590962 CTCTGGGTTTCATACTCAAGGGG - Intronic
944523736 2:200597550-200597572 CTCAGGGACTCAATGTCATGAGG - Intronic
946748722 2:222871519-222871541 GGCTGGGTCTCACAAACATGTGG + Intronic
948072996 2:235142498-235142520 CGCTGGGTCTCACTGCCTTGTGG + Intergenic
948844568 2:240676925-240676947 CTCTGGGTATGCCAGCCATGGGG + Intronic
948849292 2:240697954-240697976 CTCTGGGTATGCCAGCCATGGGG - Intronic
948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG + Intronic
1169161060 20:3378866-3378888 CCCTGGGCCTTACAGGCATGGGG - Intronic
1169180165 20:3557554-3557576 CTCTGGATTTCACTGTCAAGAGG - Intronic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1170554421 20:17504176-17504198 CTCTGGGCCTCATGGTCATGTGG - Intronic
1171321386 20:24247544-24247566 GTCTGGGTATCACATTCTTGAGG - Intergenic
1172612769 20:36264071-36264093 CTCTGGGTGTCAGAGTCTGGTGG + Intronic
1173214501 20:41067970-41067992 CTCTAAGTCCCACAGTGATGTGG + Intronic
1175154434 20:56960376-56960398 CTCTGAGTCCCAGAGACATGTGG + Intergenic
1175619652 20:60432822-60432844 CTTTGAGTCTGACAGTCATTTGG + Intergenic
1176152257 20:63597861-63597883 CTGTGGGGGACACAGTCATGTGG + Intronic
1177300230 21:19234609-19234631 CCTTGGGCCTCACAGTCTTGAGG - Intergenic
1178003593 21:28192254-28192276 CTCTGGCTTTGGCAGTCATGGGG + Intergenic
1179020638 21:37637643-37637665 CTCTGGGTCACATAGTGCTGTGG + Intronic
1179725664 21:43340123-43340145 CTCCTGGTCGCACACTCATGGGG - Intergenic
1180248918 21:46566602-46566624 CTCTGGAGCTCAGAGGCATGCGG + Exonic
1180593510 22:16959581-16959603 CCCTGGGGGTCACAGTCATGTGG + Intergenic
1181697955 22:24603262-24603284 CTCTGGGTCACACAGCACTGGGG - Exonic
1182939004 22:34255592-34255614 CTGTGGGTTTCACAGTTCTGTGG + Intergenic
1182986352 22:34721620-34721642 CTCTAGGTCTTTTAGTCATGAGG - Intergenic
1183015267 22:34981339-34981361 CGCAGGGTCTCATAGCCATGGGG + Intergenic
1185371101 22:50461347-50461369 CTCAGGGTACCACAGTTATGGGG + Intronic
1185393541 22:50575528-50575550 CTCTGGGTCTCCCAGCCACCTGG - Intronic
949750087 3:7342170-7342192 CTCTGGGTCCCTGAGTCATTGGG - Intronic
951825678 3:26865560-26865582 CTCTGTGTCTGACAGACAAGTGG - Intergenic
951978173 3:28537667-28537689 CTCTGGGTGGCACAGTTCTGAGG - Intronic
952886990 3:38018066-38018088 CTCTGGGAACCAGAGTCATGGGG + Intronic
955139061 3:56250862-56250884 CACTGGGTCTCACTGTTATAAGG - Intronic
955879657 3:63530059-63530081 CACTGGCCCTCACAGGCATGGGG - Intronic
956185833 3:66561040-66561062 CTCTGGGTCTCTCCCACATGTGG + Intergenic
957322420 3:78649384-78649406 CTCTGGGTCCCTAAGTGATGCGG + Intronic
960124623 3:113985099-113985121 TCCTGGGGATCACAGTCATGGGG + Intronic
960172123 3:114474149-114474171 CTCTGGGTCTCTCCCACATGTGG + Intronic
961243673 3:125433699-125433721 CTCTGGGTCACACAGACAGATGG - Intergenic
961507177 3:127377896-127377918 CTCAGGGTCTGAGAGTCAGGTGG - Intergenic
962252241 3:133842390-133842412 CTCTGGGCCTCACAGGCACCCGG + Intronic
963358299 3:144238219-144238241 CTCTGTATCTCACAGTAAAGAGG - Intergenic
965542146 3:169880930-169880952 TTCTGGGTAGCACAGTTATGTGG - Intergenic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
967469121 3:189842424-189842446 CTCTGGGTCTCTCATTTATCGGG + Intronic
969063052 4:4454499-4454521 CACTGGGTCTCACACTCACCAGG - Intronic
969310350 4:6349304-6349326 CTCAGGGTCACACAGCCAGGAGG - Intronic
969844103 4:9905894-9905916 CTCTGGGTCACACAGTCAGCTGG - Intronic
970091556 4:12414133-12414155 CTCTCAGTCTTATAGTCATGAGG - Intergenic
974015305 4:56643670-56643692 GCCTGGGTCTAACTGTCATGGGG + Intergenic
975186397 4:71409066-71409088 TTCTGGGCCTCCCAGGCATGTGG + Intronic
976743659 4:88382382-88382404 ATCTGCCTCTCACACTCATGAGG + Intronic
976997412 4:91452345-91452367 CTCTGACTCTTACAGTCACGTGG - Intronic
982417271 4:155150455-155150477 CTCTCAGTCACACAGTCATAAGG - Intergenic
985008557 4:185559590-185559612 CTATGGGTCTCTCAGCCACGGGG + Intergenic
986307499 5:6526417-6526439 GTCTGAGTCTCACAGTGATCTGG - Intergenic
986307521 5:6526608-6526630 GTCTGAGTCTCACAGTGATCTGG - Intergenic
988317492 5:29649476-29649498 CTCTAGGTGTCAAATTCATGAGG + Intergenic
988961684 5:36377400-36377422 CTCTGGGTCTCACACTTTTGGGG - Intergenic
993458739 5:88157444-88157466 CTCTGGGACTCACAGTCTTTTGG - Intergenic
996213700 5:120842354-120842376 CTCAGGCTTTCACAGTCTTGAGG - Intergenic
996570572 5:124928969-124928991 CTCTGGAGCTCAGAGTTATGGGG + Intergenic
997349536 5:133220785-133220807 CTCTGGATCTCACAGTCCACAGG + Exonic
1000978539 5:167791841-167791863 CCATGTGTCTCAGAGTCATGTGG + Intronic
1000997398 5:167973474-167973496 CTCTGGGAATCACAGTCTAGTGG + Intronic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1001514807 5:172347942-172347964 CTCTGGGTCTCAGGGCCAGGAGG + Intronic
1001555071 5:172631583-172631605 CTGTGGGCATCACAGTCCTGCGG - Intergenic
1004383592 6:15153077-15153099 CTTTGTGGCTCATAGTCATGAGG + Intergenic
1004743160 6:18483079-18483101 CTCTGAGTGTCACAGTTAGGAGG + Intergenic
1004802905 6:19170662-19170684 CTCTGTTTCACACAGTCATTTGG - Intergenic
1006305777 6:33217631-33217653 ACCTGGGTATCATAGTCATGTGG + Intergenic
1006505515 6:34486327-34486349 ATGTGGTTCTCACAGCCATGGGG + Intronic
1011494028 6:87921193-87921215 CTCTGGGTGCCACAATCCTGAGG + Intergenic
1013442360 6:110183230-110183252 CCCAGGGTCTCACAGTCCAGAGG - Intronic
1014411308 6:121125372-121125394 ATCTGGGGCTTACAGTCATCTGG - Intronic
1019622102 7:1997651-1997673 CTCTGGGTCACACAGAGAAGGGG + Intronic
1020288771 7:6706624-6706646 CCCTGGGGCTCACCGTCCTGCGG + Exonic
1022515757 7:30974217-30974239 CTCTGGGCCTCAGAGTGAGGTGG - Intronic
1022519595 7:30997607-30997629 CTCTGGAGCTCACAGCCTTGGGG + Intergenic
1023836734 7:44073055-44073077 CCCAGGGTCACACAGTGATGAGG + Exonic
1024847290 7:53661627-53661649 CTCTGTGTTGCACAGTCCTGCGG + Intergenic
1025022096 7:55488270-55488292 CCCTGGGTCTCACAGACCTCAGG + Intronic
1029348581 7:99996956-99996978 CTCAGGGTCTCACAGTGATCCGG - Intergenic
1029625809 7:101719441-101719463 CTCTGTGTCCCTCTGTCATGGGG + Intergenic
1029715713 7:102324378-102324400 CACTGGGTGTCGCAGACATGGGG + Intergenic
1030015291 7:105213263-105213285 CTCTGAGTTTCACAGGCAAGTGG + Intronic
1032839326 7:135701856-135701878 CTCTGGTTCCCACAGTGCTGAGG - Intronic
1035418900 7:158710907-158710929 CTGTGGATTTTACAGTCATGTGG - Intergenic
1036950555 8:13135043-13135065 CTCCGGCTCCCACACTCATGAGG - Intronic
1038411414 8:27362342-27362364 CTCTGGGTCTCACCAGCATAAGG - Intronic
1038661143 8:29498091-29498113 CTCAGGGGCTCACAGGCTTGGGG + Intergenic
1040978257 8:53217749-53217771 CTGTGTGCCCCACAGTCATGGGG + Intergenic
1041187658 8:55317688-55317710 CTCTGTCACTCACAGTAATGGGG - Intronic
1042671218 8:71265491-71265513 GTCTGTGTCTCACAGTGATTTGG - Intronic
1043857606 8:85279423-85279445 AACTGGGTCTCACAATCATTTGG - Intronic
1044817967 8:96132236-96132258 CTTTGGGTCTGACAGGCTTGTGG - Intergenic
1045393596 8:101738733-101738755 CTCAGGGTCACACAGCCACGAGG - Intronic
1047313808 8:123714196-123714218 CACTGGGGCTGTCAGTCATGAGG + Intronic
1047472582 8:125191907-125191929 CCCAGTGTCTCACAGTCAAGAGG + Intronic
1047940207 8:129822093-129822115 CTCTTGGTCTTGCTGTCATGGGG - Intergenic
1048359942 8:133689148-133689170 ATCTGGGTCACACCATCATGTGG - Intergenic
1048992184 8:139766961-139766983 TCCAGGGGCTCACAGTCATGTGG - Intronic
1049635231 8:143684618-143684640 CGCTGGGTCTCACAGCCCTGGGG - Intronic
1050150145 9:2611709-2611731 CTCATGTTCTCACACTCATGAGG - Intergenic
1055763802 9:79639169-79639191 CTCTGGGTCCCTGATTCATGTGG - Intronic
1056806327 9:89731835-89731857 CTCTAGGTCTCACCCTAATGTGG + Intergenic
1057759014 9:97857906-97857928 CTCAGGATCCCACAGTCACGCGG - Intergenic
1058567248 9:106299427-106299449 CTCTGGCTCACATAGTGATGTGG + Intergenic
1058915280 9:109558999-109559021 CACTGCCTCCCACAGTCATGGGG - Intergenic
1059085526 9:111298340-111298362 CTCTGAGTCTCACATTAATGAGG - Intergenic
1060530370 9:124344158-124344180 CTCTCGGGCTCCCTGTCATGAGG + Intronic
1062555880 9:137113271-137113293 CTCTGGCCCTCAAAGTCCTGGGG + Exonic
1062711116 9:137975668-137975690 CTCTGGGTCTCAGAGGCACTAGG + Intronic
1186564218 X:10645174-10645196 CTCAGGGTCTCCAAGTCCTGAGG + Intronic
1196859479 X:120014260-120014282 CTCTGGGACTCCAAGTCAGGAGG - Intergenic
1199690087 X:150302971-150302993 CTCTTGGCCTCAAAGTCTTGAGG - Intergenic