ID: 948904781

View in Genome Browser
Species Human (GRCh38)
Location 2:240973622-240973644
Sequence CACAGGTTCTAAAAGTTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948904777_948904781 7 Left 948904777 2:240973592-240973614 CCGCCTGTGGGGGCTCAACTCAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163
948904776_948904781 8 Left 948904776 2:240973591-240973613 CCCGCCTGTGGGGGCTCAACTCA 0: 1
1: 0
2: 3
3: 13
4: 104
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163
948904778_948904781 4 Left 948904778 2:240973595-240973617 CCTGTGGGGGCTCAACTCAGCGT 0: 1
1: 0
2: 1
3: 3
4: 59
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163
948904771_948904781 20 Left 948904771 2:240973579-240973601 CCTTGCAGGTCACCCGCCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163
948904770_948904781 24 Left 948904770 2:240973575-240973597 CCAGCCTTGCAGGTCACCCGCCT 0: 1
1: 0
2: 2
3: 14
4: 116
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163
948904769_948904781 30 Left 948904769 2:240973569-240973591 CCAGTGCCAGCCTTGCAGGTCAC 0: 1
1: 0
2: 4
3: 14
4: 179
Right 948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948904781 Original CRISPR CACAGGTTCTAAAAGTTTCC GGG Intronic
904636636 1:31886736-31886758 TACAGGTTCTTAAACATTCCTGG + Intergenic
905086498 1:35383624-35383646 ATCAGGTACTAAAAGTTACCTGG + Intronic
916008490 1:160683086-160683108 CAGAGGTGATAAAAGTTTCCTGG + Intronic
916428676 1:164706956-164706978 CACAGGTCCTAAATCTTCCCTGG - Intronic
919426314 1:197435882-197435904 CCCAGGGTCTAACAGTTTCAAGG + Intronic
921853513 1:219955458-219955480 CGCAGGTTTTAAAAATTTTCTGG + Intronic
923756702 1:236797423-236797445 TACAGCTTCTAAAAGTTTCTTGG + Intronic
924255983 1:242183527-242183549 CAGAGGTTCTCAAATTTTCTTGG + Intronic
1063766731 10:9150361-9150383 CCCTGCTTCTAAAACTTTCCAGG + Intergenic
1064899728 10:20281360-20281382 CACAGAGTGTAAAAGTTTCATGG - Exonic
1066638230 10:37528773-37528795 CACAGGGTGTGAAAGTCTCCAGG + Intergenic
1069414660 10:68187443-68187465 ATCAGGTTTTAAAAATTTCCAGG - Intronic
1069610471 10:69769330-69769352 CCCAGCTTCTAGGAGTTTCCTGG - Intergenic
1070397744 10:76026334-76026356 CACAGGTTCTAAATGTGGCCTGG + Intronic
1071879876 10:89885573-89885595 CAAAGGTTCTAGGATTTTCCTGG + Intergenic
1074016056 10:109535358-109535380 CAAAGGTTTAAAAAGTTTTCTGG + Intergenic
1075052614 10:119194048-119194070 CACAGCTTCTGAAGGTCTCCTGG + Intergenic
1079733312 11:23962641-23962663 CACAGGCCATAAAAGCTTCCGGG + Intergenic
1080841256 11:35985465-35985487 CCCAGGTACTAAAAGGCTCCAGG - Intronic
1087143954 11:94793482-94793504 CAGAGATTTTAAAAGTTTCTTGG + Intronic
1087876394 11:103363164-103363186 AACAGGTTGGAAAAGTTTCTTGG - Intronic
1089324992 11:117650934-117650956 TACAGGTAGTAAGAGTTTCCAGG + Intronic
1090069105 11:123528030-123528052 CACAGGATCTAACAGTATCAAGG - Intronic
1090516353 11:127432272-127432294 CCCAGGTTCAATAATTTTCCTGG + Intergenic
1092342864 12:7691193-7691215 CACAGGTTCCCAGAGATTCCTGG + Intronic
1095374277 12:41507594-41507616 TACAGCTTCTGAAAGTTCCCAGG - Intronic
1095454375 12:42366705-42366727 CACAGGTTTTAGAACTTTCCTGG + Intronic
1095761740 12:45846097-45846119 GACATATTCTAAAAGTTTCAAGG - Intronic
1097827996 12:64194201-64194223 CAGAGGTTCTGAGAGTTTTCAGG - Exonic
1099668932 12:85665763-85665785 CACAGGTTATAAATTTTTCCTGG + Intergenic
1100554142 12:95675433-95675455 CACAACTTCTAAAACTTTTCTGG + Intronic
1102392544 12:112561169-112561191 GACATGTGCTAAAAGGTTCCAGG - Intergenic
1102784043 12:115589455-115589477 AACAGGTTCTAAAAGGTATCTGG - Intergenic
1102929801 12:116853528-116853550 CAGAAGTCCTAAAAGATTCCAGG - Intronic
1104146435 12:126038192-126038214 CTCAGGTAATAAAAGTATCCAGG + Intergenic
1104314522 12:127684647-127684669 CAAAGGCTCTAAATTTTTCCAGG + Intergenic
1108231543 13:48348979-48349001 CATTGGTGCTAAAAGTTTCTTGG + Exonic
1108423704 13:50276736-50276758 TACAGGTTCTATGAGTTTGCAGG + Intronic
1108504055 13:51094112-51094134 CAGAGGTTCTCAAAGATACCAGG - Intergenic
1110384194 13:74889567-74889589 CACTGATACTAAAGGTTTCCTGG - Intergenic
1114500190 14:23162819-23162841 CACAGGTTGAAGAAGTTCCCAGG - Intronic
1120521459 14:85531566-85531588 CACACGCTCTAGGAGTTTCCCGG - Intronic
1121957792 14:98229728-98229750 TACAATTTCTAAATGTTTCCAGG - Intergenic
1125190255 15:36984012-36984034 TACTAGTTCTAAAAGTTTCTTGG + Intronic
1128073431 15:64811363-64811385 CAGAGGTTCTAAGAGCTTCTGGG + Intergenic
1128375348 15:67070378-67070400 CCAAGGTTCTAAATGTTCCCAGG - Intronic
1129422238 15:75438040-75438062 TACAGGTCCTAAAAGTCACCTGG + Intronic
1129469062 15:75740208-75740230 CACATGCTCTAAAAGGTTTCAGG + Intergenic
1131380034 15:91955902-91955924 GACAGGTTCTAAAACCATCCTGG + Intronic
1132284174 15:100648328-100648350 CACAGGTCCTGCAAGTTTCTGGG - Exonic
1133306901 16:4815582-4815604 AACAGGTTCTAAAAGTTTTAAGG + Intronic
1133687044 16:8175556-8175578 CACATCTTCTCAAAGTTCCCTGG - Intergenic
1138364847 16:56466639-56466661 AATAAGTTCTCAAAGTTTCCTGG - Intronic
1138898520 16:61240223-61240245 CACATGTTCTCAAGATTTCCTGG + Intergenic
1139441288 16:66968922-66968944 CAAAGCTTGTAAAAGTTTTCAGG + Intronic
1145356544 17:22160742-22160764 CACAGTTTAAAAAAGTTTTCTGG - Intergenic
1145833588 17:27937127-27937149 CAAAGGTTATCAAAGTTTGCCGG - Intergenic
1146549418 17:33767491-33767513 AACAGCTTCTGAAAGTTTCTTGG - Intronic
1146569791 17:33942344-33942366 CACAGGTTCTAAGACATTCTAGG - Intronic
1153476489 18:5504301-5504323 CTCAGGTTCTAGAAATTACCTGG - Intronic
1153597977 18:6748261-6748283 CCCTGGATGTAAAAGTTTCCCGG - Intronic
1155891038 18:31269488-31269510 CAAAGTATCTAAAATTTTCCAGG - Intergenic
1156753369 18:40489457-40489479 CCCAGGTTCAAGAAGTTTCTGGG + Intergenic
1156996348 18:43472432-43472454 CTTAGTTTATAAAAGTTTCCTGG + Intergenic
1158584118 18:58715267-58715289 CTAAGATTCTAAAATTTTCCTGG + Intronic
1158861032 18:61592606-61592628 CACAGAATCTAAAATATTCCTGG - Intergenic
1159830222 18:73268046-73268068 ATCAGCTTTTAAAAGTTTCCAGG + Intergenic
1161627935 19:5337985-5338007 CAGAGGCTCTCAAGGTTTCCTGG + Intronic
1163294256 19:16402076-16402098 AACAGGTTCTGAAAGGATCCAGG + Intronic
1163397179 19:17070423-17070445 CACAGGGTCCAGAAGGTTCCCGG - Intronic
1163904827 19:20143319-20143341 CACAGTATCTACAAGTCTCCTGG - Intergenic
927131692 2:20065628-20065650 CACAGGATCTTTAAGTTCCCTGG - Intergenic
931453318 2:62386792-62386814 CCCAGGTAATAAAAGTTGCCTGG - Intergenic
932413406 2:71560212-71560234 CACAGGTCCTAAATGTTTCTTGG + Intronic
932771669 2:74503813-74503835 CAAAGCTTCCAAACGTTTCCAGG - Intergenic
933128235 2:78638141-78638163 CACTTCTTCCAAAAGTTTCCAGG + Intergenic
933705041 2:85283426-85283448 CACAAGTACTCAAAGTTTGCTGG - Intronic
935284430 2:101551407-101551429 CACAGGGTCAAGATGTTTCCTGG - Intergenic
936245891 2:110827177-110827199 CACAGCCTCCAAAAGTTTGCAGG + Intronic
936846503 2:116841551-116841573 CATAGGTTCTCAAATTTTGCTGG + Intergenic
942580107 2:177409003-177409025 CAGAGGTTCTCAAACTTTCTGGG - Intronic
943344455 2:186721795-186721817 CAAAGGCTCTAAAACTTTCTTGG + Intronic
945262063 2:207852894-207852916 CACAGTTTCTAAAAGTATTAGGG - Intronic
945478036 2:210308988-210309010 CACAAGTTCTTGAAGTCTCCAGG - Intronic
947697552 2:232204643-232204665 CACAGGTTCTAAAAGCTGGCAGG + Intronic
948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG + Intronic
1171089541 20:22270900-22270922 AACATGTTCTGAAAGTTTCTGGG - Intergenic
1175602599 20:60287171-60287193 CACAGGTTACAAAATTTTCTGGG - Intergenic
1177477550 21:21644041-21644063 CAAAGGTTCTAACAGTTTGGAGG + Intergenic
1181298659 22:21863161-21863183 CAGTGGTTCTTAATGTTTCCAGG + Intronic
1184675933 22:46043583-46043605 GTCAGGTTCTGGAAGTTTCCAGG + Intergenic
1184883642 22:47328581-47328603 CACAATTTTTAAAAGTTTCCAGG + Intergenic
949704163 3:6796787-6796809 TACAGGTTCAGAGAGTTTCCAGG + Intronic
954404878 3:50340137-50340159 CAAAGGTTCTAAATTTTTCCAGG + Intronic
956259505 3:67323133-67323155 CAGGGTTTCTAAAAGTTTGCTGG - Intergenic
958820242 3:98965253-98965275 CACATTTTCTAATAGTTCCCTGG + Intergenic
960598682 3:119433187-119433209 GACAGCTTTAAAAAGTTTCCAGG + Intronic
961088576 3:124090853-124090875 CAGAGGTTCTCAAAGTTTAATGG - Intronic
961121219 3:124372944-124372966 CACATGTTTTAAAAGCTCCCAGG - Intronic
964043807 3:152297434-152297456 CCCAGGTTCTAAGTGATTCCAGG + Intronic
966557074 3:181274583-181274605 CGCAGTTTCCAAAATTTTCCGGG + Intergenic
970018194 4:11536230-11536252 CTTAGGATCTAAGAGTTTCCAGG + Intergenic
970801504 4:19977989-19978011 CAAAGGTTCTAAGAGTTTGGAGG + Intergenic
974595554 4:64011193-64011215 CACAGCTTAAGAAAGTTTCCTGG + Intergenic
977491073 4:97712193-97712215 CACAGTTTCTAAAATCTTTCAGG + Intronic
979960711 4:127017921-127017943 CACTAGTTATAGAAGTTTCCAGG - Intergenic
980334197 4:131449190-131449212 GACAGTTTCTAAGATTTTCCTGG + Intergenic
981901910 4:149875945-149875967 CAAAGGATCAAACAGTTTCCTGG - Intergenic
987320030 5:16760087-16760109 CACAGGTGCTGAAAGCTTTCAGG + Intronic
987595732 5:19996420-19996442 CACAGTTTATAAATCTTTCCTGG + Intronic
988149785 5:27363219-27363241 CACAGATTCTGGAAGTTCCCTGG + Intergenic
988444485 5:31270231-31270253 CAGAGGTTCCAAAACTTTCTTGG + Intronic
988726015 5:33927257-33927279 AACAGGATCTAAAAATTTCAAGG - Intergenic
989322144 5:40148219-40148241 GACAGGGTCAAATAGTTTCCTGG + Intergenic
989717601 5:44482738-44482760 CACATGTCCTGAAAGATTCCTGG - Intergenic
990309656 5:54525800-54525822 AACAATGTCTAAAAGTTTCCTGG - Intronic
992425312 5:76650933-76650955 CACAGGTGCTTTAATTTTCCTGG + Intronic
992530298 5:77645891-77645913 CACCTGTTCCAGAAGTTTCCTGG - Intergenic
993021604 5:82598012-82598034 CACAGGTACTAAGATTTTCTTGG - Intergenic
993097915 5:83502494-83502516 AAGAGGTTCTAAAAATTTCTGGG - Intronic
993427570 5:87787127-87787149 CACAAATTCTAAAAGATTCATGG - Intergenic
993580195 5:89651957-89651979 CAAAGGTTGGAAGAGTTTCCAGG + Intergenic
993683624 5:90910678-90910700 CACATGATCAAAAAGTTTTCAGG + Intronic
994993225 5:107025171-107025193 TATAGGTTCTAAAAGTTTGGTGG - Intergenic
998657657 5:144200072-144200094 CACAGGGTCTAAAATTTTTGCGG - Intronic
999216407 5:149939204-149939226 CTCAGGCCCCAAAAGTTTCCAGG + Intronic
1000892085 5:166812321-166812343 TACATTTTTTAAAAGTTTCCAGG - Intergenic
1001535275 5:172493653-172493675 CACAGGTTGTCCAAGGTTCCTGG - Intergenic
1005067072 6:21828814-21828836 AACAGGTTATAGAGGTTTCCTGG + Intergenic
1005574883 6:27181490-27181512 TACAGGTTTTAAAACTATCCTGG - Intergenic
1006660583 6:35639581-35639603 CACTGTTTCTAGAAGCTTCCTGG + Intronic
1008677847 6:53840399-53840421 ATTAGATTCTAAAAGTTTCCAGG - Intronic
1010837827 6:80612103-80612125 AACAGGCTCTGAAAGCTTCCTGG - Intergenic
1011977847 6:93328191-93328213 TACAGTTTTTAAAAATTTCCAGG - Intronic
1012001569 6:93661572-93661594 CAAAGCTTCTAAGAGTGTCCGGG + Intergenic
1014241307 6:119021029-119021051 CAGAGGTTCTCAAAGTACCCAGG + Intronic
1014832399 6:126118339-126118361 TACAAGTTCTAAAAGTTCCTGGG + Intergenic
1014848831 6:126314355-126314377 CACATGTTCTTAAGGTCTCCTGG + Intergenic
1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG + Intergenic
1019714621 7:2532862-2532884 CAGAGGCTCTAAAAGTTCCCAGG + Intergenic
1019741698 7:2678191-2678213 CAGAGGCTCTAAAAGTTCCCAGG - Intergenic
1019820215 7:3237143-3237165 CAGAGGTTTTAAGAGTTACCAGG - Intergenic
1021489644 7:21205032-21205054 AAAAGGTTCTAAAAGTTTTCTGG + Intergenic
1023177605 7:37448657-37448679 AGCAGGTTCGTAAAGTTTCCTGG - Exonic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027781669 7:82527984-82528006 AACAGGGTCTACAAGATTCCAGG + Intergenic
1029602688 7:101578347-101578369 CACAGATTTTAAAATTTTCTGGG - Intergenic
1032423289 7:131800517-131800539 CACAGGTTCTTAAACTTACCAGG - Intergenic
1033818176 7:145100950-145100972 TGCAGGTTTTAAAAGTTTTCGGG - Intergenic
1035518441 8:256346-256368 CAGAGGTTCTAACAGTTTGGAGG - Intergenic
1035550215 8:517452-517474 CCCAGGTTCTTGAAGCTTCCAGG - Intronic
1037426472 8:18761018-18761040 CAAAGGTTCTTCAAGATTCCAGG + Intronic
1038038676 8:23706465-23706487 CTCAGGTACTGAAAGTTTTCCGG + Exonic
1038163371 8:25061550-25061572 CACATGTGCTAGAAGTTGCCAGG - Intergenic
1039599763 8:38825616-38825638 CACAGGGTGTGAAAGTCTCCAGG + Intronic
1041407073 8:57511412-57511434 AACACTTTCTAACAGTTTCCTGG + Intergenic
1045533452 8:103005446-103005468 CACATGTTCTCAAGGTCTCCTGG - Intergenic
1045833436 8:106491975-106491997 CAGAGGTTCTCAAACTTTCTGGG + Intronic
1046478721 8:114784610-114784632 CACAGTTTCTACAATTTTCTAGG + Intergenic
1047924973 8:129673968-129673990 CTCAGCTTCTGTAAGTTTCCAGG + Intergenic
1052339023 9:27347248-27347270 CACAGGTTCTATAATTTGCTGGG - Intronic
1053865057 9:42428797-42428819 CTCAGGTTCTATTAGTTTACAGG - Intergenic
1056923798 9:90815120-90815142 CTCAGGTTCCAAATGTTTCAAGG - Intronic
1057149263 9:92781913-92781935 CACAGGTTTTCAAAGATGCCGGG - Intergenic
1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG + Intronic
1059624541 9:116048491-116048513 CACAGTTTCTAAAACTTAGCAGG - Intergenic
1061099189 9:128479170-128479192 CTCTGGTTCCCAAAGTTTCCTGG - Intronic
1185654942 X:1677183-1677205 CACAGGTTCTGATATCTTCCCGG - Intergenic
1186162304 X:6790581-6790603 CATATGTTCTAAATATTTCCTGG + Intergenic
1186372974 X:8966046-8966068 CAGAGGTTGGAAAAGTTTTCAGG - Intergenic
1187546493 X:20258399-20258421 CACAGGTTTTACAAGATTTCTGG + Intronic
1187807789 X:23140097-23140119 AACAGATTTTAAAAGGTTCCTGG + Intergenic
1190567364 X:51744012-51744034 AACAGGTTCTGAAAGTTCCATGG - Exonic
1191863771 X:65687488-65687510 AACGTGTCCTAAAAGTTTCCAGG + Intronic
1194050667 X:89063859-89063881 CACTTTTTCTAAAAGTTTTCAGG + Intergenic
1195369026 X:104155249-104155271 CCCGGGTTCTAAGAGATTCCAGG + Intronic
1196069514 X:111504902-111504924 TACAGGTTTTAAATTTTTCCTGG + Intergenic
1196540486 X:116901223-116901245 CACAGGTTGGAAAAGTTTGGAGG - Intergenic
1197596947 X:128476300-128476322 GACAGGTTTGAACAGTTTCCTGG + Intergenic