ID: 948909517

View in Genome Browser
Species Human (GRCh38)
Location 2:240996125-240996147
Sequence CAAAAGGCCCCGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948909517_948909532 20 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909532 2:240996168-240996190 CCCGGCTGAAAATCTGCACAGGG No data
948909517_948909521 -3 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909521 2:240996145-240996167 TTGTTAACCCCCAGCTCCCCGGG No data
948909517_948909530 19 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909530 2:240996167-240996189 GCCCGGCTGAAAATCTGCACAGG No data
948909517_948909534 26 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909534 2:240996174-240996196 TGAAAATCTGCACAGGGTGCAGG No data
948909517_948909522 2 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG No data
948909517_948909520 -4 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909520 2:240996144-240996166 TTTGTTAACCCCCAGCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948909517 Original CRISPR CAAAAGGCCCCGCTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr