ID: 948909522

View in Genome Browser
Species Human (GRCh38)
Location 2:240996150-240996172
Sequence AACCCCCAGCTCCCCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948909518_948909522 1 Left 948909518 2:240996126-240996148 CCAGCAGCAGCGGGGCCTTTTGT No data
Right 948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG No data
948909517_948909522 2 Left 948909517 2:240996125-240996147 CCCAGCAGCAGCGGGGCCTTTTG No data
Right 948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948909522 Original CRISPR AACCCCCAGCTCCCCGGGCC CGG Intergenic
No off target data available for this crispr