ID: 948910262

View in Genome Browser
Species Human (GRCh38)
Location 2:240999130-240999152
Sequence CAAGTGGCTGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 397}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948910262_948910280 27 Left 948910262 2:240999130-240999152 CCGCCGCCGCCGCCAGCCACTTG 0: 1
1: 0
2: 0
3: 34
4: 397
Right 948910280 2:240999180-240999202 GGACAGCGCTTCCTCCTCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 112
948910262_948910276 6 Left 948910262 2:240999130-240999152 CCGCCGCCGCCGCCAGCCACTTG 0: 1
1: 0
2: 0
3: 34
4: 397
Right 948910276 2:240999159-240999181 GGGCGGCCCGAGGTGGAATGAGG 0: 1
1: 0
2: 1
3: 6
4: 102
948910262_948910273 -4 Left 948910262 2:240999130-240999152 CCGCCGCCGCCGCCAGCCACTTG 0: 1
1: 0
2: 0
3: 34
4: 397
Right 948910273 2:240999149-240999171 CTTGGCACCGGGGCGGCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 115
948910262_948910274 -1 Left 948910262 2:240999130-240999152 CCGCCGCCGCCGCCAGCCACTTG 0: 1
1: 0
2: 0
3: 34
4: 397
Right 948910274 2:240999152-240999174 GGCACCGGGGCGGCCCGAGGTGG 0: 1
1: 0
2: 3
3: 30
4: 277
948910262_948910279 24 Left 948910262 2:240999130-240999152 CCGCCGCCGCCGCCAGCCACTTG 0: 1
1: 0
2: 0
3: 34
4: 397
Right 948910279 2:240999177-240999199 TGAGGACAGCGCTTCCTCCTCGG 0: 1
1: 0
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948910262 Original CRISPR CAAGTGGCTGGCGGCGGCGG CGG (reversed) Intronic
900244515 1:1631094-1631116 CAAGCAGCTGGCGGCGGCCGCGG - Intergenic
900386287 1:2412476-2412498 CGGGGGGCTGGCGGCGGCCGGGG + Exonic
901633065 1:10657259-10657281 CAGGTTCCTGGCGGTGGCGGCGG - Intronic
901743820 1:11359552-11359574 CATGTGTGTGGGGGCGGCGGTGG - Intergenic
902154922 1:14477576-14477598 CAAGTGGCTGGCAGCCCCGAGGG - Intergenic
902550930 1:17219221-17219243 CAAGGGGGTGGCCGCAGCGGGGG + Intronic
902784189 1:18722402-18722424 CAAGAGGCTGGGGACGGTGGTGG - Intronic
902950983 1:19882634-19882656 CCGGAGTCTGGCGGCGGCGGCGG + Exonic
903907302 1:26696204-26696226 CTCCGGGCTGGCGGCGGCGGAGG - Exonic
903907378 1:26696420-26696442 CAGGCTGCTGGCGGCGGCGGGGG - Exonic
903907451 1:26696641-26696663 AATGGGGGTGGCGGCGGCGGCGG + Exonic
904029020 1:27522496-27522518 CAGGGCGGTGGCGGCGGCGGTGG + Intergenic
904454867 1:30641506-30641528 GGAGAGGCTGGCGGGGGCGGGGG - Intergenic
904587600 1:31588760-31588782 CCACTGGCTGGAGGTGGCGGCGG - Intergenic
904618939 1:31764112-31764134 CAAGGAGGCGGCGGCGGCGGCGG - Intronic
904719957 1:32500482-32500504 CTGGTAGCGGGCGGCGGCGGCGG + Intronic
904822729 1:33256164-33256186 CCAGGCGGTGGCGGCGGCGGCGG + Intergenic
905584339 1:39105323-39105345 GCAGCGGCGGGCGGCGGCGGCGG - Intronic
906079395 1:43074385-43074407 CAGGTGGATGGCGGGGTCGGGGG - Intergenic
906319725 1:44808539-44808561 TGGCTGGCTGGCGGCGGCGGCGG - Exonic
908062488 1:60367023-60367045 CAGGTAGCTGGGGGCGGTGGCGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
908836233 1:68231934-68231956 CAAGAGGGGGGCGGCGGGGGTGG - Intronic
909622499 1:77683474-77683496 GGACTGGCGGGCGGCGGCGGCGG + Intergenic
912627161 1:111215061-111215083 CAGATGGTCGGCGGCGGCGGGGG - Intronic
912746839 1:112252294-112252316 CAAGTGGCTGGCAGGGAGGGCGG - Intergenic
913147640 1:116007958-116007980 CAAATGGCTGGCGGTGGCAGAGG - Intronic
915393273 1:155562883-155562905 GGGGGGGCTGGCGGCGGCGGCGG - Intergenic
915517187 1:156420472-156420494 GGAGGTGCTGGCGGCGGCGGCGG - Intronic
915980922 1:160419567-160419589 GAAGCGGCTGGCGCCGTCGGTGG - Exonic
918511367 1:185317245-185317267 CGAGCGGTCGGCGGCGGCGGAGG - Exonic
919831053 1:201540144-201540166 CGAGTGGCGGGTGGCGGGGGCGG + Intergenic
919926348 1:202193847-202193869 CTATTGGGCGGCGGCGGCGGCGG - Intergenic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
921325315 1:213982734-213982756 CAACAGGCGGGCGGCGGGGGAGG + Intergenic
921326300 1:213988762-213988784 CTGGTGGCTGGGGGTGGCGGTGG + Intronic
922779220 1:228238105-228238127 CAGGTGGATGGGGGCGGCAGAGG - Intronic
1064442901 10:15370407-15370429 CTAGTGGCTAGTGGCGGCAGCGG + Intronic
1065023092 10:21516898-21516920 CAAGGCGGCGGCGGCGGCGGCGG - Exonic
1065024203 10:21526066-21526088 CCCGGGGCTGGCGGCGGGGGCGG - Intergenic
1065114899 10:22476023-22476045 GAAGAGGCTGGCGGCTGCGGCGG + Intergenic
1065619400 10:27565026-27565048 CCAGAGGCTGGCGGCGGGGAGGG - Intergenic
1069673939 10:70233600-70233622 CACGTGGCTGCCGCCGGCGCTGG + Intronic
1069789944 10:71013123-71013145 CAAGTGGGTGGGGGTGGGGGAGG - Intergenic
1072263245 10:93702535-93702557 CGGGTTGCGGGCGGCGGCGGCGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1072722603 10:97789995-97790017 CAAGTGGGTGGTGGTGGTGGGGG + Intergenic
1072731574 10:97850212-97850234 CAGGTGGGCGGCGGCGGTGGCGG - Intergenic
1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG + Exonic
1074703760 10:116113922-116113944 CGAGTGGATGGCGGTGACGGTGG - Intronic
1075748521 10:124744340-124744362 CAGGCGGCGTGCGGCGGCGGCGG + Intronic
1076900651 10:133335909-133335931 CAGATGGATGGCGGGGGCGGGGG + Intronic
1077309701 11:1882902-1882924 CAAGGGGCTGCCGGCTGCGGGGG - Intronic
1077368212 11:2169802-2169824 CAAGGAGCGGGAGGCGGCGGTGG - Exonic
1079296726 11:19241328-19241350 CGGGAGGGTGGCGGCGGCGGCGG - Intronic
1079353686 11:19713646-19713668 CACGTCCCTGGCAGCGGCGGCGG - Exonic
1080123401 11:28703105-28703127 CAAATGGCAGGCGGGGGAGGAGG - Intergenic
1082916907 11:58446908-58446930 CAAGTAGCTGGGGGCTGGGGTGG - Intergenic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083752246 11:64767022-64767044 CCACTGGGAGGCGGCGGCGGCGG + Exonic
1084175268 11:67419500-67419522 TCAGTGGCTGGCGCTGGCGGGGG + Exonic
1084313449 11:68330226-68330248 CAAGGGGCTGGGGGCGGGGTGGG - Intronic
1084385416 11:68840770-68840792 CTGTTGGCTGGCCGCGGCGGTGG + Intronic
1085863114 11:80257661-80257683 CCAGGGGCTGGCGGGGCCGGCGG - Intergenic
1086397416 11:86431354-86431376 CAAGGGGCTCCCGTCGGCGGCGG + Intergenic
1086434167 11:86764880-86764902 CAAGTTCCTGGGGGCGGGGGTGG - Intergenic
1089243115 11:117098400-117098422 CAACAAGATGGCGGCGGCGGCGG - Exonic
1091225747 11:133955908-133955930 GAGCTGGCTGGGGGCGGCGGCGG - Intronic
1091226075 11:133957031-133957053 CAATAGGCGGGCGGCGGGGGCGG - Intergenic
1091262524 11:134245646-134245668 CCAGCGGCTGGGGGCGGGGGCGG + Exonic
1091558756 12:1594670-1594692 CAAGTGGCCGCGGACGGCGGGGG - Intronic
1091616536 12:2054157-2054179 CAGGTGGCGGGTGGGGGCGGCGG + Intronic
1091844510 12:3645498-3645520 CAAGGGGCTGGGGGTGGTGGGGG + Intronic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1092162624 12:6324300-6324322 GAAGAGGCTGGAGGAGGCGGCGG - Intronic
1096536118 12:52275907-52275929 CCAGTGGCTGACGGTGGAGGTGG + Exonic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1096784406 12:54009030-54009052 CGAGCGGGCGGCGGCGGCGGCGG - Intronic
1098141519 12:67454575-67454597 CAAATGACTGGCGGAGGAGGGGG + Intergenic
1099256675 12:80323171-80323193 CAAGTGGTTGGAGGAGGCTGAGG - Intronic
1099413379 12:82358914-82358936 CAGGTGCGTGGCGGCGGAGGCGG + Intronic
1101764362 12:107684351-107684373 CAAGTTGGTGGGGGCGGGGGGGG + Intergenic
1103800349 12:123533715-123533737 CGAGTGGGCGGCGGCGGCGGCGG + Exonic
1103899138 12:124294594-124294616 CCTGTGGGTGGGGGCGGCGGGGG - Intronic
1103927668 12:124432849-124432871 CAAGTGGCGGCGGGGGGCGGGGG + Intronic
1104461741 12:128962080-128962102 CAAGTGGCGGGAGGTGGAGGGGG - Intronic
1104939851 12:132389998-132390020 CAGGTGGGGGGCGGGGGCGGGGG - Intergenic
1105571185 13:21604183-21604205 CAAGCGGTAGGCGGCGGCGCCGG - Exonic
1106269363 13:28138711-28138733 CTCCTCGCTGGCGGCGGCGGTGG + Exonic
1107058544 13:36131365-36131387 CCAGAGGAGGGCGGCGGCGGCGG + Intergenic
1108607202 13:52051634-52051656 GAAGTGGCTGACAGCGGCTGCGG + Intronic
1112216365 13:97434429-97434451 TATGTCGCGGGCGGCGGCGGCGG + Exonic
1112505134 13:99970808-99970830 CCTGGGGCTGGCGGCGGCAGCGG - Exonic
1113878202 13:113607749-113607771 CCAGTGGGTGGCGGTGACGGGGG + Intronic
1113992398 14:16037970-16037992 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1115399160 14:32938868-32938890 CAGGCGACCGGCGGCGGCGGCGG - Intronic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118575930 14:67241331-67241353 GGAGTTGCTGGCGGCTGCGGCGG + Exonic
1119410342 14:74426249-74426271 CGAGAGGGAGGCGGCGGCGGCGG - Intergenic
1119959205 14:78835341-78835363 GTGGTGGCTGGTGGCGGCGGTGG + Intronic
1122066138 14:99175559-99175581 CTCTTGGCTGGCGGCTGCGGGGG + Exonic
1122162371 14:99793581-99793603 CTGGTGGCGGGCGGCGGCGACGG + Intronic
1122264579 14:100540647-100540669 CAAGTGGCCAGCGGGGGCAGTGG + Intronic
1122418064 14:101559873-101559895 CGGGACGCTGGCGGCGGCGGCGG + Intergenic
1122530905 14:102426171-102426193 CAAGTGGCGGCCGGGCGCGGCGG - Intronic
1122558017 14:102592024-102592046 CGCGGGGCTGGCGGGGGCGGGGG - Intergenic
1122786571 14:104166905-104166927 CGGGTGGCTGGAGGCGGTGGCGG - Exonic
1122943103 14:104991914-104991936 CATGTGCGTGGCGGCGGCAGTGG - Intronic
1124929148 15:34101897-34101919 CAAGCCGCCAGCGGCGGCGGTGG - Exonic
1127763693 15:62164857-62164879 CAAGGGGCCGGCAGCCGCGGCGG + Exonic
1127905232 15:63371464-63371486 CAGGTGGCTGGCTGTGGCTGTGG - Intronic
1128797858 15:70478275-70478297 CAGGTGGCTGGCAGGGGCTGGGG - Intergenic
1129033190 15:72632970-72632992 CATGTGGCAGGCGGAGGCTGGGG - Intergenic
1129216694 15:74104260-74104282 CATGTGGCAGGCGGAGGCTGGGG + Intronic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129407980 15:75331825-75331847 CATGTGGCAGGCGGAGGCTGGGG - Intergenic
1129471144 15:75754604-75754626 CATGTGGCAGGCGGAGGCTGGGG - Intergenic
1129733860 15:77948573-77948595 CATGTGGCAGGCGGAGGCTGGGG + Intergenic
1129841724 15:78747430-78747452 CATGTGGCAGGCGGAGGCTGGGG - Intergenic
1130052220 15:80493344-80493366 CAAGTGGCGGGGGGTGGGGGTGG + Intronic
1130097647 15:80867844-80867866 CAAGTGGCAGATGGAGGCGGTGG + Intronic
1131094796 15:89648429-89648451 CAAGAGGCTGTAGGCGGCGTCGG + Exonic
1131692814 15:94845084-94845106 GAAGCAGCGGGCGGCGGCGGCGG - Intergenic
1131827204 15:96331273-96331295 CCCGGGGCAGGCGGCGGCGGCGG + Exonic
1131859487 15:96637246-96637268 CAGGTGGGTGGGGGCGGTGGCGG + Intergenic
1132055556 15:98648537-98648559 CCAGTGTGTGGCAGCGGCGGCGG + Intergenic
1132586194 16:706596-706618 CTGGAGGCTGGAGGCGGCGGCGG + Intronic
1132607289 16:798884-798906 CACCTGCCTGTCGGCGGCGGTGG + Intronic
1133212871 16:4272860-4272882 CCAGATGCTGGCGGCGGCGGCGG + Exonic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1134588653 16:15434505-15434527 CCGGGCGCTGGCGGCGGCGGAGG + Exonic
1134696985 16:16232533-16232555 GCGGCGGCTGGCGGCGGCGGTGG + Exonic
1134717331 16:16363493-16363515 CAAGAGCCAGGCCGCGGCGGGGG - Intergenic
1134957421 16:18388666-18388688 CAAGAGCCAGGCCGCGGCGGGGG + Intergenic
1135438900 16:22449663-22449685 AAAGTGGGGGGGGGCGGCGGTGG - Intergenic
1136110889 16:28063194-28063216 CGAGGCGGTGGCGGCGGCGGCGG + Exonic
1136911779 16:34149877-34149899 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1140223248 16:73058688-73058710 CGCGCTGCTGGCGGCGGCGGCGG + Intronic
1141292019 16:82727076-82727098 CAAGGGGATGAGGGCGGCGGCGG + Intronic
1141538487 16:84700017-84700039 CGAGAAGATGGCGGCGGCGGGGG + Exonic
1141608644 16:85169438-85169460 CAAGTTGGGCGCGGCGGCGGCGG + Intergenic
1141633848 16:85303473-85303495 CAAGCGGCGGACAGCGGCGGGGG - Intergenic
1142423283 16:89986601-89986623 CAAGTGTCGGCCGGGGGCGGTGG - Intergenic
1143030200 17:3963614-3963636 GATGTGGCTGGCGGAGTCGGTGG - Intronic
1143371638 17:6444240-6444262 CACGAGGCTGGCGGCGGGGCGGG + Intergenic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1144500955 17:15786471-15786493 CCTGCGGCTGACGGCGGCGGGGG + Intergenic
1145041281 17:19579897-19579919 GGAGCGGCTGGCGGCGGCGCGGG - Intergenic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146492351 17:33292124-33292146 CCCGCGGCTGGCGGCAGCGGCGG + Exonic
1147559249 17:41498945-41498967 CAAGTGGGTGGCGGGGTCTGGGG + Intergenic
1147646550 17:42037854-42037876 CAGGGGGCTGGGGGCGCCGGAGG + Exonic
1147719827 17:42532209-42532231 CACCTGGGCGGCGGCGGCGGCGG - Intergenic
1148122660 17:45222005-45222027 GCAGCGGCTGGCGGTGGCGGCGG - Exonic
1148337551 17:46851691-46851713 GAAGTAGGAGGCGGCGGCGGCGG - Exonic
1148553473 17:48564318-48564340 GATGCGGCTGGCTGCGGCGGCGG - Intronic
1148558665 17:48593485-48593507 AAAGTGGCTGGAGGAGGCCGAGG + Exonic
1148786835 17:50149729-50149751 GACGGGGCGGGCGGCGGCGGCGG + Exonic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1149024517 17:52010983-52011005 CAAGCAGTTGGCGGGGGCGGGGG + Intronic
1149507885 17:57211153-57211175 CAAGTGCCTGACGGAGGGGGAGG + Intergenic
1150124636 17:62628145-62628167 GATGTGGCGGGCGGCGGGGGAGG + Intronic
1150250053 17:63700132-63700154 TAAGGCGGTGGCGGCGGCGGTGG - Exonic
1150407927 17:64919012-64919034 GGTGGGGCTGGCGGCGGCGGCGG + Intronic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1151419082 17:73985650-73985672 CAAGGGGCTGGAAGCGGTGGGGG - Intergenic
1151557182 17:74852438-74852460 CACGTGGCTGGCGTCGGCGACGG + Exonic
1151755337 17:76072454-76072476 CAGGTCCCAGGCGGCGGCGGCGG - Exonic
1152049219 17:77959198-77959220 CGCGGGCCTGGCGGCGGCGGCGG - Intergenic
1152069878 17:78129126-78129148 CAGGAGGCTTGCGGGGGCGGCGG - Intronic
1152364966 17:79850206-79850228 CACGTGGCTGAGGGCGGAGGAGG + Intergenic
1152433103 17:80260507-80260529 CGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1153270891 18:3320105-3320127 CAAGAGGCTGGAGGTGGCAGTGG - Intergenic
1153596449 18:6729913-6729935 CGGGTGGCTGGCTGCGGCGCGGG - Intronic
1153814272 18:8779409-8779431 CAAGAGTCTAGCGGAGGCGGGGG - Intronic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1155507844 18:26549208-26549230 GATGGGGCTGGCGGCGGCGGCGG + Exonic
1156325534 18:36071507-36071529 CAAGGGGCTGGGGGCGGGGGGGG + Intergenic
1160385240 18:78492915-78492937 CAAGGGGGTGGCGGCGCAGGTGG - Intergenic
1160688159 19:446927-446949 CCGGTGGCTGGCGTGGGCGGTGG - Intronic
1160961907 19:1725833-1725855 CCATTGGCTGGCGGCGGCCCGGG + Intergenic
1160991834 19:1863301-1863323 GAAGCGGCGGGGGGCGGCGGGGG + Exonic
1161350071 19:3786399-3786421 GGAGGGGCCGGCGGCGGCGGCGG - Intronic
1161379917 19:3959466-3959488 CAAGGTGCTGGAGGAGGCGGCGG - Exonic
1161396914 19:4049540-4049562 CTCGAGGCTGGCGGCGGCCGAGG + Intronic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1162549667 19:11351494-11351516 CAGGTGGCTGGTGGGGGCGGGGG + Intronic
1162572459 19:11481055-11481077 TAAAGGGCTGGGGGCGGCGGCGG - Intronic
1162784323 19:13024806-13024828 CAAGTGGCTGGCGAAGCTGGTGG + Intronic
1162972230 19:14187665-14187687 ATAGGGGCTGGTGGCGGCGGCGG - Intronic
1163138816 19:15332518-15332540 CAGTGCGCTGGCGGCGGCGGCGG - Intronic
1163303781 19:16464398-16464420 CCAGTGGCTGGTGGGGGCTGAGG - Intronic
1163464042 19:17455814-17455836 CAACTGGCAGGAGGCGGCCGAGG - Exonic
1164254738 19:23517506-23517528 CAAGTGGCCGGGGGTGGGGGGGG + Intergenic
1164498809 19:28794068-28794090 CGAGTGGGCGGCGCCGGCGGCGG + Intergenic
1165008282 19:32824026-32824048 CAAGTGCCTGGTGGCTGCAGTGG - Intronic
1165743094 19:38215201-38215223 CAAGGGGCTGGGTGCTGCGGTGG + Intronic
1166883008 19:45940361-45940383 CAGGAGGTTGGCGGCGGCGGCGG + Exonic
1166995296 19:46717077-46717099 TAAGTCGGCGGCGGCGGCGGCGG + Exonic
1167072954 19:47231151-47231173 CGGGCGCCTGGCGGCGGCGGCGG - Intronic
1167081040 19:47276140-47276162 AGAGTGGATGGCGGCGGCGGTGG + Intergenic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
1167593278 19:50415668-50415690 CAGGTGGGTGGCGGGGGTGGGGG - Intronic
1168244648 19:55105970-55105992 CAAGGGGCTGGCGGAGAGGGAGG - Intronic
1168339690 19:55615868-55615890 CAACGGGCTGGCGGGGGAGGTGG + Exonic
1168719091 19:58545044-58545066 CGAGCTGTTGGCGGCGGCGGGGG - Exonic
925156548 2:1652593-1652615 CTCGTGGCTGGGGGCGGGGGTGG - Intronic
925714324 2:6771006-6771028 CAGGTGGATGGCTGCGCCGGGGG - Intergenic
926060800 2:9803481-9803503 CAAGTGGGTGGCAGGGGCAGGGG - Intergenic
926323032 2:11762226-11762248 CAAGGCGGTGGAGGCGGCGGTGG + Intronic
927215829 2:20667357-20667379 CCAGGGGGCGGCGGCGGCGGCGG + Exonic
927966896 2:27275885-27275907 CTAGAGCCTGGCGGGGGCGGGGG - Intronic
928421117 2:31138395-31138417 CAAGGCGGCGGCGGCGGCGGCGG - Intronic
931730826 2:65151896-65151918 CAGGTGGGTGGCGGGGGCAGGGG + Intergenic
931866679 2:66419933-66419955 CATGTGGTGGGCGGGGGCGGGGG - Intergenic
932036704 2:68252803-68252825 CATGTGGCTGGAGGCGGGCGGGG + Intronic
932152635 2:69387104-69387126 CGAGTGGCTGGCGGGATCGGGGG + Exonic
932231501 2:70087562-70087584 GCAGGGGCGGGCGGCGGCGGCGG - Exonic
932625212 2:73291866-73291888 AAAGGGGTGGGCGGCGGCGGCGG + Exonic
932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG + Exonic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934856344 2:97732683-97732705 CAAGTGGCAGAGGGCGGTGGAGG - Intronic
935046640 2:99489527-99489549 CATGGGGCTGGCGGCGGCGCGGG + Intronic
935240253 2:101171629-101171651 CATGTGGCTGGGGGGGGCAGGGG - Intronic
935592549 2:104855589-104855611 GCAGGGGCTGGCGGCGGCGGGGG + Exonic
935649208 2:105367662-105367684 CAATTGGCTGCTGGCAGCGGTGG + Exonic
938292935 2:130159936-130159958 CATGTGACTGCCGGCGGCAGGGG - Intronic
938440852 2:131331147-131331169 GCAGCAGCTGGCGGCGGCGGCGG + Intronic
938784190 2:134610270-134610292 CAAGTGGCTGGCGGCCACAGTGG - Intronic
939693238 2:145292156-145292178 CATGGGGGTGGGGGCGGCGGAGG - Intergenic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
942046520 2:172102303-172102325 CACCCGGCGGGCGGCGGCGGCGG - Exonic
942241043 2:173964490-173964512 GACGTGGATAGCGGCGGCGGCGG - Exonic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
944221766 2:197310558-197310580 CAGGTAGCGGGCGGCGGCGCCGG - Exonic
944933632 2:204545556-204545578 GGAGTGGGCGGCGGCGGCGGCGG - Intergenic
946694010 2:222333762-222333784 CAAGTGGGTGGCAGCTGTGGTGG - Intergenic
948176255 2:235945880-235945902 CACATGGCTGGCGGTGGTGGTGG + Intronic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
1168757150 20:325692-325714 CAACTTGCCGGAGGCGGCGGGGG + Exonic
1168943902 20:1735817-1735839 CAGGAGGCTGGCAGCGGCGTGGG + Intergenic
1168965106 20:1894284-1894306 CGAGAGGCTGGAGGCGGCGAAGG - Exonic
1169129701 20:3159746-3159768 CAGGTGAGTGGCGGCGGCCGGGG - Exonic
1170884226 20:20325137-20325159 TAAGTGGCTGGGGGTGGAGGAGG - Intronic
1171128738 20:22628275-22628297 CCAGTGTCTGGCGGTGGTGGAGG + Intergenic
1171769449 20:29311175-29311197 CCAGAGGCTGGCTGCGGCTGAGG - Intergenic
1171907100 20:30908218-30908240 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1172073666 20:32277728-32277750 AAAGCGGGCGGCGGCGGCGGCGG - Exonic
1172277229 20:33686287-33686309 CGGGTGACAGGCGGCGGCGGCGG + Exonic
1172587287 20:36093512-36093534 GCGGTGGGTGGCGGCGGCGGGGG + Intronic
1173610611 20:44364617-44364639 AAAGTAGCTGGCCGCGGTGGTGG - Intronic
1174174536 20:48636513-48636535 CAAGTGGCTGGAGCAGGTGGCGG - Exonic
1174365226 20:50052785-50052807 CAAGAGACTGGCGGCAGTGGTGG + Intergenic
1175340938 20:58228608-58228630 GATGCGGCGGGCGGCGGCGGGGG - Exonic
1176551802 21:8226361-8226383 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1176570711 21:8409360-8409382 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1176578620 21:8453507-8453529 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1177157357 21:17513025-17513047 CGACTGGCTCGCGGCGGCGGCGG - Exonic
1177609306 21:23424351-23424373 CAAGAGTCTGTCGGGGGCGGGGG + Intergenic
1178530296 21:33370274-33370296 CAAGTGGCTGGTAGCAGCTGGGG + Intergenic
1178853308 21:36231030-36231052 CAGGTGGCAGGCGGCGGCAAAGG - Exonic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180314873 22:11269547-11269569 CCAGAGGCTGGCTGCGGCTGAGG - Intergenic
1180340506 22:11614156-11614178 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1180962190 22:19767022-19767044 CAAGGGGCTGGGGGTGGCGAGGG - Exonic
1181766873 22:25098614-25098636 CAACTGGGTGGAGGGGGCGGGGG + Intronic
1181988200 22:26816444-26816466 CAAGTGGGTGGCCGTGGAGGGGG + Intergenic
1182153454 22:28047652-28047674 CAAGTGGGTGGCAGAGGAGGTGG + Intronic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182469933 22:30542331-30542353 CGAGAGGCTGGAGGCGGCGAAGG - Intronic
1183744792 22:39686148-39686170 CCGGGGGCTGGCGGCGGGGGCGG - Exonic
1184390339 22:44200089-44200111 CAGGGGCCTGGCGGGGGCGGAGG - Intronic
1184412250 22:44331946-44331968 GAAGTGGGCAGCGGCGGCGGCGG - Intergenic
1185167461 22:49270317-49270339 CAAGTGCATGGGGGGGGCGGGGG + Intergenic
1203256824 22_KI270733v1_random:143283-143305 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
951611381 3:24495301-24495323 GCGATGGCTGGCGGCGGCGGCGG - Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
953912192 3:46898838-46898860 CACGTAGCCGGCAGCGGCGGTGG - Exonic
954249617 3:49357963-49357985 GTAGTGGCTGGGGGCGCCGGCGG - Intronic
954715576 3:52525137-52525159 CCAGTTGCTGGGGGCGGGGGGGG + Intronic
955238977 3:57163801-57163823 GAAGGGGGTGGCGGGGGCGGAGG + Intronic
956420795 3:69085000-69085022 CCAGAATCTGGCGGCGGCGGCGG - Exonic
962793906 3:138834707-138834729 ATAGTAGCAGGCGGCGGCGGCGG - Intronic
963835153 3:150050722-150050744 CAAGATGGCGGCGGCGGCGGCGG + Intronic
965558295 3:170038732-170038754 CCAGTGGCGGGCGCGGGCGGGGG - Intronic
966711954 3:182980534-182980556 CGAATGGACGGCGGCGGCGGCGG + Exonic
966866112 3:184260006-184260028 GGAGTGCCTGGCGGCGGCGGCGG + Exonic
967858256 3:194134273-194134295 CACGTGGCACCCGGCGGCGGCGG + Intergenic
967880326 3:194297183-194297205 CAGCAAGCTGGCGGCGGCGGCGG - Intergenic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
967976088 3:195035538-195035560 CCAGTTTCTGGCGGGGGCGGTGG - Intergenic
968323334 3:197791132-197791154 CAAGCGCCTGGCTGCGCCGGGGG + Intergenic
969326916 4:6449523-6449545 CAGGGGCCAGGCGGCGGCGGGGG - Intronic
969353918 4:6614113-6614135 GAAGTGGCTGGCAGGGGCAGGGG + Intronic
969676090 4:8615108-8615130 GAAGTGGCTGGCAGAGGCTGGGG + Intronic
970058506 4:12002336-12002358 CAAGAGGCTGGGGGTGGGGGTGG + Intergenic
970141635 4:12989321-12989343 TAAGTGGCCGGCGGCGGGGATGG + Intergenic
972960546 4:44447925-44447947 CACGGTGGTGGCGGCGGCGGCGG - Exonic
973644583 4:52937259-52937281 CAAGTGGCTGGCTGAGGGGTAGG + Intronic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
975986118 4:80202702-80202724 CAGGACGCTGGCGGCGGCGGCGG + Exonic
977176960 4:93829596-93829618 CAGGAGGCTGGAGGCGGCGGTGG - Exonic
978072611 4:104491494-104491516 CATGGCGGTGGCGGCGGCGGCGG + Exonic
978576698 4:110196726-110196748 GGCGTGGCTGGTGGCGGCGGTGG - Intronic
983577007 4:169271021-169271043 AAAGTGGGAGGCGGCGGCGGCGG - Exonic
983940161 4:173529185-173529207 GCAGCGGCTGGCGGCGGCGGCGG + Exonic
985121197 4:186643790-186643812 CAAGTGGGTGGGGGTGGGGGGGG - Intronic
985782463 5:1878374-1878396 CAGGGAGGTGGCGGCGGCGGCGG + Exonic
986297079 5:6448716-6448738 CAAGGCGCCGGCGGCTGCGGCGG + Exonic
990545249 5:56815637-56815659 CCTGAGGCAGGCGGCGGCGGAGG + Exonic
992010607 5:72522656-72522678 CAAGTGTCTGGCAGAGGCAGAGG + Intergenic
992105597 5:73447445-73447467 CGGGTGGAAGGCGGCGGCGGCGG + Exonic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
995199396 5:109409939-109409961 GAAGCGGCTGGCGGCTGTGGCGG + Exonic
998366656 5:141636833-141636855 GGAGGGGCTGGCGGCGGCCGCGG - Exonic
998811634 5:145972464-145972486 CAAGTGGGTGGTGGTGGTGGTGG - Intronic
1000974967 5:167754817-167754839 CATTTGGCTGGCAGCGGGGGAGG + Intronic
1001733063 5:173974198-173974220 CAAGAGGCTGGTGGTGGTGGTGG + Intronic
1002186812 5:177458406-177458428 AATGAGGCTGGTGGCGGCGGGGG + Exonic
1002352040 5:178590127-178590149 AATGCGGCGGGCGGCGGCGGCGG - Exonic
1002415099 5:179116263-179116285 CAAGTGGCGGGGGGTGGGGGGGG - Intronic
1002442777 5:179272992-179273014 GAAGGGGCTGGCGGCGCAGGAGG - Exonic
1003974515 6:11329752-11329774 CAACTGGGTGGGGGGGGCGGTGG + Intronic
1003995813 6:11538224-11538246 CGGGTGCCGGGCGGCGGCGGCGG - Intergenic
1004193976 6:13487714-13487736 CCCGGAGCTGGCGGCGGCGGGGG - Intergenic
1004396123 6:15248128-15248150 CCCGTGGCTGGCGGCGGCTGCGG + Intronic
1005040307 6:21595030-21595052 CATGGGGGCGGCGGCGGCGGCGG + Exonic
1005040333 6:21595138-21595160 AAAGTGGCGGGCGGCGCGGGCGG + Exonic
1007095000 6:39207634-39207656 CAGGTGGGTGGCGGGGGTGGGGG + Intronic
1007680323 6:43629163-43629185 CGGGGGGCTGGCGGCAGCGGCGG - Intergenic
1007751095 6:44072609-44072631 CAAGTGGGTGGCCGGGGGGGGGG - Intergenic
1007901700 6:45419895-45419917 GCAGTGGCAGGCGGCGGCTGTGG + Intronic
1007906609 6:45467605-45467627 TGAGTGGCTGGGGGCGGTGGGGG - Intronic
1008369183 6:50714132-50714154 CGTGTGTGTGGCGGCGGCGGCGG + Intronic
1009808828 6:68635558-68635580 GAAGTGACCGGCGGCGGCGGCGG - Exonic
1011931792 6:92723601-92723623 CCCGGGGCTGGCGGCGACGGAGG - Intergenic
1013099457 6:106974815-106974837 GAGGCGGCGGGCGGCGGCGGAGG - Intronic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1014122361 6:117740061-117740083 GAGCTGGCTGGTGGCGGCGGTGG - Intergenic
1017672412 6:156779288-156779310 CCAGTCCCAGGCGGCGGCGGCGG + Exonic
1018686128 6:166306748-166306770 CAGGTGGGTGGCCGCGACGGTGG - Exonic
1018696699 6:166396573-166396595 CCAGTGGCTGGGGGCGGGGGTGG + Intergenic
1018790309 6:167143235-167143257 AACGTGGCTGGCGGCGGGGCTGG + Intergenic
1018876656 6:167827301-167827323 CGGCTGGCGGGCGGCGGCGGGGG - Intronic
1018930963 6:168239988-168240010 CTTGTGGCTGGGGGCTGCGGAGG + Intergenic
1018986387 6:168640358-168640380 CATGGGGCAGGCTGCGGCGGGGG + Intronic
1019325695 7:437117-437139 CAAGGGGCTGGGGGCCGCTGTGG - Intergenic
1019341668 7:511415-511437 CCAGTGGCTGGGGGAGGAGGGGG + Intronic
1019536130 7:1530786-1530808 CGAGCGCCAGGCGGCGGCGGCGG + Exonic
1020246679 7:6434921-6434943 CAGGTGGCTGGGGCCGGCAGAGG + Exonic
1020999623 7:15312526-15312548 CCAGTGCATGGCGGGGGCGGTGG + Intronic
1022698067 7:32728898-32728920 CCTGAGGATGGCGGCGGCGGCGG + Intergenic
1022943747 7:35262102-35262124 GGTGTCGCTGGCGGCGGCGGGGG + Intergenic
1023881709 7:44324892-44324914 CGAGCGGCAGGCGGCGGGGGTGG - Intronic
1024639354 7:51316836-51316858 GGAGGGGCTGGCGGCGGCGCGGG + Intergenic
1025069776 7:55887831-55887853 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069785 7:55887854-55887876 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1026657937 7:72273434-72273456 AAAGCGGCGGGCGGGGGCGGTGG + Intronic
1026960481 7:74404457-74404479 CAAGGTGTTGGCGGGGGCGGAGG + Exonic
1027590306 7:80111253-80111275 CAAGTGTCTGGCAGAGGCTGCGG - Intergenic
1027687510 7:81295440-81295462 CAAGATGCTGGCTGCAGCGGGGG - Intergenic
1032345162 7:131110037-131110059 CAAGAAGGAGGCGGCGGCGGCGG + Intergenic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1033899300 7:146116206-146116228 ACAGGAGCTGGCGGCGGCGGCGG + Intergenic
1035602142 8:902937-902959 CAGGTGGGTGGGGGCGGGGGCGG + Intergenic
1036731780 8:11271824-11271846 GAAGATGCGGGCGGCGGCGGGGG + Intergenic
1036789547 8:11708842-11708864 GAAGGGGCCGGCGGAGGCGGCGG - Exonic
1038266764 8:26044225-26044247 CCAGAGGGTGGCGGCGGCGAGGG - Intronic
1039454609 8:37698433-37698455 CAGATGGCAGGAGGCGGCGGCGG - Exonic
1039921318 8:41896289-41896311 CAAGTGGCTGCTGGGGGCAGGGG - Intronic
1040841566 8:51790674-51790696 GAAGGGCCTGGAGGCGGCGGAGG + Intronic
1040866133 8:52050623-52050645 CAAGTGTCAGGCAGAGGCGGTGG + Intergenic
1041167208 8:55102141-55102163 CCTGCTGCTGGCGGCGGCGGCGG + Intergenic
1041502392 8:58553259-58553281 CCAGTGACCGGAGGCGGCGGCGG + Exonic
1044761153 8:95519039-95519061 AAAGTGGCGGGGGGCGGCGGTGG + Intergenic
1045141901 8:99294917-99294939 CATGTGGCTGGTGGTGGCTGTGG + Intronic
1048980895 8:139703096-139703118 CAACTTGGAGGCGGCGGCGGCGG - Intergenic
1049192692 8:141297305-141297327 CAAGTGGATGCTGGCGGGGGAGG + Intronic
1049276955 8:141724789-141724811 AGAGTGGCTGCCGGTGGCGGAGG - Intergenic
1049612615 8:143562467-143562489 CAAGCTGCTGGCGGAGGCGCTGG + Exonic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1049668388 8:143858950-143858972 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049668804 8:143860549-143860571 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669219 8:143862151-143862173 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669634 8:143863753-143863775 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670044 8:143865346-143865368 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049828616 8:144685821-144685843 CACTGGGCCGGCGGCGGCGGCGG - Intergenic
1049989408 9:977320-977342 TGAGAGGCTGGCGGCGGCTGCGG - Exonic
1050437928 9:5629198-5629220 CGAGTCGGCGGCGGCGGCGGCGG - Exonic
1052693104 9:31840893-31840915 CAAGTGGCGGGTGCTGGCGGGGG + Intergenic
1052884331 9:33629052-33629074 CAGGTTGCTGACGGGGGCGGGGG + Intergenic
1053690492 9:40584417-40584439 GGAGAGGCGGGCGGCGGCGGCGG - Intergenic
1056643351 9:88388840-88388862 TAAGGGGCCGGCGGCGGCCGGGG - Intronic
1057290149 9:93801246-93801268 CCAGGGGCTGGGGGCGGTGGGGG + Intergenic
1057509936 9:95669664-95669686 CAAGGGGGAGGCGGGGGCGGGGG + Intergenic
1057708074 9:97412144-97412166 AAAGTGGGCGGCGGCCGCGGCGG + Exonic
1057772981 9:97983897-97983919 CAAGTGGCCGGCGGCGAGAGAGG + Intronic
1058467547 9:105244590-105244612 AAAGGGGCGGGCGGCGGCGGCGG - Intergenic
1058697814 9:107574521-107574543 CAGGTGGATGGCGGTGGTGGGGG + Intergenic
1059668604 9:116472768-116472790 CATGTTGGTGGTGGCGGCGGCGG + Intronic
1060301338 9:122376131-122376153 CCTGTGGCTGGGGGAGGCGGGGG + Intronic
1060359433 9:122941057-122941079 CGAGCGGCGGGCGGCGGAGGAGG + Exonic
1060405616 9:123371580-123371602 TAAGTGTCTGGTGGCGGTGGTGG + Intronic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1062214264 9:135380656-135380678 CCAGGGCCTGGGGGCGGCGGGGG - Intergenic
1062560410 9:137139202-137139224 AAAGGGCCCGGCGGCGGCGGCGG - Intronic
1062566002 9:137164268-137164290 CAAGGGGCTTGGGTCGGCGGAGG - Intronic
1062586372 9:137251683-137251705 CATGTGGCTGGGAGCGGCCGGGG + Intronic
1203472981 Un_GL000220v1:124965-124987 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic
1203363181 Un_KI270442v1:235560-235582 CCAGAGGCTGGCTGCGGCTGAGG - Intergenic
1186285996 X:8044864-8044886 CATGTGGCTGGGGGCTGGGGAGG + Intergenic
1186768058 X:12791458-12791480 CGAGGGGCGCGCGGCGGCGGAGG - Exonic
1187518157 X:19990959-19990981 CGAGGGGCCGGCGGCGGCGGCGG - Intergenic
1187883144 X:23864835-23864857 CAAGTGGATGGGGGCAGGGGAGG - Intronic
1188003524 X:25002640-25002662 CGACTGGCCGGCGGCGGCGGCGG + Intergenic
1188506432 X:30889261-30889283 AAAGGGGGCGGCGGCGGCGGCGG - Intronic
1190337283 X:49270080-49270102 CAAGATGGCGGCGGCGGCGGCGG + Exonic
1190873071 X:54440737-54440759 CAAGTGGCTGGGGGGTGCAGTGG + Exonic
1192220984 X:69197200-69197222 CAGGTGGCTGGCGGGGGAGCTGG - Intergenic
1195105446 X:101598841-101598863 GAAGGGGCTGGAGGCGGGGGTGG + Intergenic
1195107436 X:101614926-101614948 GAAGGGGCTGGAGGCGGGGGTGG - Intergenic
1196047804 X:111274452-111274474 CAAGTGGTTGGCAGGGGCGGGGG + Intergenic
1196762856 X:119215415-119215437 CCAGAGGCTGGGGGTGGCGGTGG + Intergenic
1198158506 X:133985346-133985368 CAGGTGGCGTCCGGCGGCGGCGG + Exonic
1199757068 X:150874554-150874576 CAAATGGGGGGCGGGGGCGGGGG + Intronic
1199772730 X:150984353-150984375 CGACGGGCGGGCGGCGGCGGCGG + Intronic
1200064310 X:153497302-153497324 CGAGGGGCTGGGGGTGGCGGTGG + Intronic
1200126184 X:153816119-153816141 CGAGGGGCTGGGGGTGGCGGTGG - Intronic
1201075146 Y:10181229-10181251 CCAGAGGCTGGCTGCGGCTGAGG + Intergenic