ID: 948912266

View in Genome Browser
Species Human (GRCh38)
Location 2:241010598-241010620
Sequence GGGTCAGAGCATCCCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948912259_948912266 9 Left 948912259 2:241010566-241010588 CCAGCAGCCCAAGAATCTCAGCC 0: 1
1: 0
2: 1
3: 20
4: 203
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912261_948912266 1 Left 948912261 2:241010574-241010596 CCAAGAATCTCAGCCTGCTCAGA 0: 1
1: 0
2: 0
3: 16
4: 228
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912258_948912266 24 Left 948912258 2:241010551-241010573 CCAGTTAGCAGCTGACCAGCAGC 0: 1
1: 0
2: 2
3: 8
4: 129
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912255_948912266 29 Left 948912255 2:241010546-241010568 CCTCCCCAGTTAGCAGCTGACCA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912256_948912266 26 Left 948912256 2:241010549-241010571 CCCCAGTTAGCAGCTGACCAGCA 0: 1
1: 0
2: 0
3: 11
4: 135
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912260_948912266 2 Left 948912260 2:241010573-241010595 CCCAAGAATCTCAGCCTGCTCAG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182
948912257_948912266 25 Left 948912257 2:241010550-241010572 CCCAGTTAGCAGCTGACCAGCAG 0: 1
1: 0
2: 0
3: 13
4: 99
Right 948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG 0: 1
1: 0
2: 3
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948912266 Original CRISPR GGGTCAGAGCATCCCCTCCA TGG Intronic