ID: 948917011

View in Genome Browser
Species Human (GRCh38)
Location 2:241039528-241039550
Sequence CGGTGAGGAGGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1215
Summary {0: 1, 1: 0, 2: 7, 3: 97, 4: 1110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948916996_948917011 25 Left 948916996 2:241039480-241039502 CCTGGGATGTGTGGGCCAGGTGC 0: 1
1: 0
2: 2
3: 25
4: 232
Right 948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG 0: 1
1: 0
2: 7
3: 97
4: 1110
948916999_948917011 10 Left 948916999 2:241039495-241039517 CCAGGTGCTCTGGACTCAAGGAG 0: 1
1: 0
2: 1
3: 11
4: 173
Right 948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG 0: 1
1: 0
2: 7
3: 97
4: 1110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948917011 Original CRISPR CGGTGAGGAGGGAGGGCAGA GGG Intronic
900384008 1:2401196-2401218 GGAGGAGGAGGGAGGACAGAGGG - Intronic
900531855 1:3157825-3157847 CGGTGCTGGGGGAGGCCAGATGG - Intronic
900576327 1:3384260-3384282 AGGGCAGGAGGGAGGGCAGGGGG - Intronic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
901138504 1:7012864-7012886 CGGTGAGTTGGGAGCTCAGACGG - Intronic
901258988 1:7857264-7857286 GGGAGAGGAAGGAGGGAAGAGGG - Intergenic
901425315 1:9178966-9178988 GGGTGAGGTGGGATGGCTGAGGG + Intergenic
901640556 1:10690989-10691011 CGGGAAGGGGGGAGGGGAGATGG - Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901672621 1:10865111-10865133 AGGGGAGCAGGGAGGGGAGAAGG + Intergenic
901686496 1:10946403-10946425 GGAGGAGGAGGGAGCGCAGAGGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901800493 1:11705364-11705386 CAGTGTGGAGGGAGGGCACTGGG + Intronic
901910917 1:12457281-12457303 GGCAGAGGAGGGAGAGCAGAAGG - Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902232373 1:15036234-15036256 GGGCGAGCAGGCAGGGCAGAGGG - Intronic
902662233 1:17913263-17913285 GGGTGAGAAAGGAGGGCAGTAGG - Intergenic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
903140786 1:21338059-21338081 GAGGGATGAGGGAGGGCAGAGGG - Intronic
903190371 1:21652548-21652570 TGGTGAGGAGGAAGAGCAAAGGG + Intronic
903232745 1:21931745-21931767 GGCTCAGGAGGGAGGGCAGGAGG - Intronic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903455640 1:23484672-23484694 CGGGGGGGTGGTAGGGCAGAAGG - Intergenic
903671567 1:25038992-25039014 CAGGGAAGAGGCAGGGCAGATGG + Intergenic
903743703 1:25573090-25573112 CGGGGCGGGGGGAGGTCAGATGG + Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903844711 1:26271954-26271976 CGGTGAGGACAGAGGGCAAGGGG - Intronic
904322742 1:29707612-29707634 AGGGGAGGAGGGAGGGGGGACGG + Intergenic
904770094 1:32876263-32876285 CGGGGAGGGGGGAAGGGAGAAGG + Intergenic
904836475 1:33340731-33340753 CGGGGAGGAGGGAGGGGAACAGG + Intronic
904938570 1:34149246-34149268 CGGGGAGCAGGCAGGGTAGAAGG - Intronic
905295474 1:36951785-36951807 CGAGGAGGAGGGAGAGGAGAGGG + Intronic
905673293 1:39807613-39807635 GGGAGAGGGGAGAGGGCAGAGGG - Intergenic
905811305 1:40915407-40915429 TGGTTTGGAGGGAGGGCTGATGG - Intergenic
905815752 1:40949446-40949468 AGGTAAGGAGGGAGGGCAAAGGG + Intergenic
905909456 1:41643836-41643858 GGGTGAGGGGGGTGGGCAGAGGG - Intronic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906521159 1:46467623-46467645 CAGGGAGGAGGCAGGGGAGAGGG + Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906987263 1:50696815-50696837 GGGGGTGGAGGGAGGGCAGTAGG - Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907423721 1:54365039-54365061 GGGGCAGGAGGGAGGGAAGAGGG + Intronic
907560003 1:55379555-55379577 TGGTGAGGAAGGAGGGCAAAGGG - Intergenic
908370028 1:63472465-63472487 TGGAGAGGAGAGAGGGGAGAGGG - Intronic
909959559 1:81823335-81823357 AGGGAAGGAGGGAGGGAAGAAGG - Intronic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910324880 1:85995574-85995596 CCCTGAGGAGGGAGGGGGGAAGG + Intronic
911050407 1:93666051-93666073 GGATGAGGAGGGAAGGCAGGAGG - Intronic
911729995 1:101282973-101282995 GGGCGAGGAGGGAGAGAAGAGGG - Intergenic
912203625 1:107485895-107485917 GGGTGATGAGAGAAGGCAGAGGG - Intergenic
912386748 1:109274596-109274618 CGGTGAGGGGCCAGGGCAAAGGG + Exonic
912511208 1:110191360-110191382 CTGTCAGGTGTGAGGGCAGATGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912844456 1:113066811-113066833 AGGAGAGGAGGGGGAGCAGAGGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913251741 1:116917474-116917496 CAGAGAGGAGGGAAGGGAGAGGG + Intronic
913451333 1:118994572-118994594 CAGAAAGGAGGGAGGGGAGAGGG + Intergenic
913653754 1:120942305-120942327 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914519446 1:148402435-148402457 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914643946 1:149636471-149636493 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG + Intronic
914920709 1:151845639-151845661 AGGTGAGGAGGGAGGGGGAAAGG - Intergenic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
915100691 1:153497193-153497215 AGGTGAGGAGGGAGGTTGGAGGG - Intergenic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915597791 1:156905280-156905302 CGGACAGCAGGGAGGGCTGAGGG + Intronic
915731324 1:158056367-158056389 CTGTGAGGAGGAATTGCAGATGG - Intronic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
916320682 1:163499795-163499817 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
916516135 1:165518303-165518325 GGGAGAGGAGGGAGGGAATAAGG - Intergenic
916668485 1:166989537-166989559 GGGTGAGGCGGGAGGGCAGAAGG + Intronic
917349911 1:174066102-174066124 GGGCGAGGAGGGCGGGCGGATGG + Intergenic
917461509 1:175234490-175234512 CCATCAGGAGGGAGGCCAGAAGG + Intergenic
918339064 1:183552255-183552277 AGCTGAGAAGGGAAGGCAGATGG + Intronic
919745029 1:201003505-201003527 GGGTGAGGCTGCAGGGCAGAGGG + Intronic
919924125 1:202183490-202183512 AGGAGAGGAGGCATGGCAGAGGG + Intergenic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920044513 1:203124783-203124805 TGGGGAAGAGGGAGGGCTGAAGG - Intronic
920219205 1:204383948-204383970 AGATGAGGATGGAGGGTAGAGGG + Intergenic
920335921 1:205245077-205245099 TGGTCAGGAAGGAGGGCAGCAGG + Intronic
920372313 1:205486871-205486893 GGCTGAGGAGTGAGGGCAAAGGG - Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921293868 1:213683837-213683859 GGGTGAGGAGGGAGGGAGGCTGG - Intergenic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
921343551 1:214158427-214158449 GGGTGAGGAGGCAGGGTAGGTGG - Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
921813864 1:219544958-219544980 GGGAGAGGGGGGAGGGGAGAGGG - Intergenic
922579634 1:226687420-226687442 GTGTGATGTGGGAGGGCAGATGG - Intronic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
922934275 1:229411479-229411501 AGGGGAGGGGGGAGGGGAGAGGG - Intergenic
923073430 1:230587435-230587457 AAGTGAGGAGGGTGGCCAGAAGG + Intergenic
923081607 1:230662020-230662042 AGGAGAGGAGGGAGAGGAGAGGG - Intronic
923140047 1:231153758-231153780 AGGTGAGGAGGGAGGGCTGAGGG - Intergenic
923146600 1:231202862-231202884 GGGTGTGGAGGGAGGGCTTAGGG + Intronic
923150212 1:231226347-231226369 CGCTCATGAGGGAAGGCAGAGGG - Intronic
923482628 1:234397826-234397848 AGGGGAGGAGGGAGGGGAGGGGG + Intronic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
923723647 1:236487738-236487760 CGGGAAGGAGGGCGGGCAGGGGG - Intergenic
924005134 1:239600720-239600742 AGGGAAGGAGGGAGGGAAGAAGG - Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924219168 1:241855570-241855592 GGCTGAGGAGTGCGGGCAGACGG - Intronic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924279519 1:242422203-242422225 CCATGAGGAGGGAGGGCAGGAGG + Intronic
924365286 1:243286444-243286466 AGGCGAGGAGAGAGGGCAGAAGG - Intronic
924444812 1:244119356-244119378 AAGTGAGGAGGGAGAGGAGATGG + Intergenic
924943580 1:248829747-248829769 GGGAGAGGAGAGAGGGGAGAGGG - Intergenic
1062972469 10:1659735-1659757 AGGAGAGGAGGGAAGGCAGGCGG - Intronic
1063185760 10:3649945-3649967 GGGTGAGGAGAGAGGGCAATGGG - Intergenic
1063390895 10:5649298-5649320 CGCTGAGGACGGAGGGCTCAAGG + Intronic
1064014596 10:11762578-11762600 CGGTGAGGAGGGAGGGAGCTGGG + Intronic
1065204520 10:23344256-23344278 AGGTGTGGAGGGAAGGAAGAGGG + Intronic
1065395653 10:25234257-25234279 TGATCAGGAGGGAAGGCAGAGGG - Intronic
1065485190 10:26230266-26230288 GGAAGAGGAGGGAAGGCAGAGGG + Intronic
1065502732 10:26398154-26398176 TGGAGAGGACGGAGGGCTGAGGG - Intergenic
1066087828 10:31988477-31988499 GGGTGAGGAGGGAGAGCATCAGG + Intergenic
1066294880 10:34045227-34045249 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
1066375875 10:34857281-34857303 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
1067339576 10:45390996-45391018 GGGAGAGGAGAGAGGGGAGAGGG - Intronic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067575089 10:47403928-47403950 GGGGAAGGAGGTAGGGCAGAGGG - Intergenic
1067582222 10:47452897-47452919 AGGGAAGGAGGCAGGGCAGAGGG + Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067921676 10:50464815-50464837 AGGGGAGGAGGGAGGGAAGAAGG + Intronic
1067974517 10:51008883-51008905 GGAGAAGGAGGGAGGGCAGATGG - Intronic
1068092918 10:52455003-52455025 CTGTGAGGAGGGGGCACAGAGGG - Intergenic
1068244309 10:54343646-54343668 GGGGGAGGTGGGAGGGGAGAGGG + Intronic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1069169838 10:65212862-65212884 AAGTAAGGAGGGAGGGAAGAAGG + Intergenic
1069183466 10:65392429-65392451 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1069471207 10:68691223-68691245 AGGTGAGGAAGGAGGGCTGGTGG - Exonic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069785965 10:70988143-70988165 TGGTGAGGAGTGAGGAGAGAAGG - Intergenic
1069916525 10:71790225-71790247 AGGGGAGGTGGGAGGGCAGGGGG + Intronic
1070288721 10:75101076-75101098 CAGTGAGGAGTGTGGGGAGAAGG + Intronic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071525689 10:86356826-86356848 CTGGGAAGAGGCAGGGCAGAAGG + Intronic
1071526602 10:86363136-86363158 CAGAGAGGAGGGAAAGCAGAGGG + Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1073194020 10:101673373-101673395 GGATGAGGAGGGAGACCAGAAGG - Intronic
1073435344 10:103512885-103512907 AGGCCAGGAGGGAGGGAAGAGGG - Intronic
1073441198 10:103553770-103553792 CGGGCAGGTGGGAGGACAGAGGG - Intronic
1073485542 10:103815990-103816012 GGGTGAGGAGGTAGGGAAAATGG + Intronic
1073597778 10:104817568-104817590 GGGGGAGGGGGGAGGGGAGAAGG - Intronic
1073847529 10:107575345-107575367 CGGTAAGGAGGGTAGGAAGAGGG - Intergenic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075047363 10:119156657-119156679 CGGTGAGCAGGAAGGGCTGGAGG - Exonic
1075073272 10:119333279-119333301 TGGTGAGGATGGTGGGCAGGGGG - Intronic
1075105575 10:119538127-119538149 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
1075238139 10:120750395-120750417 AAGTGAGGAGGCAGGGGAGAAGG - Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1075552501 10:123402426-123402448 GAGGGAGGAGGGAGGGAAGAGGG + Intergenic
1075670489 10:124260984-124261006 AGGGGAGGAGGCAGGGCTGAAGG - Intergenic
1075713440 10:124542785-124542807 AGGGGAGGCGAGAGGGCAGAGGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076019919 10:127064380-127064402 CATTGAAGAGGGAGGGCAGGAGG + Intronic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076749510 10:132535591-132535613 GGGGGAGCAGGGAGGGCACAAGG + Intergenic
1076794283 10:132791205-132791227 AGGTGGGGTGGGAGGGGAGAGGG + Intergenic
1076989908 11:267470-267492 GGGCGAGGAGGGAGGGGAGGGGG + Intergenic
1077141987 11:1028808-1028830 GGGTGGGGAGGGAGCCCAGACGG - Intronic
1077281755 11:1749181-1749203 CGCTGCGGAGGGAGCGCAGGCGG - Intronic
1077332161 11:1988507-1988529 GGGTGAGGAGGGAGAGGAGGGGG + Intergenic
1077358608 11:2129969-2129991 CGGGGAGTAGGGAGGTCAGGCGG - Intronic
1077385979 11:2269695-2269717 CAGGGAGGAGGGAGGGCCGGGGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077553889 11:3216811-3216833 AGGGGAGGAGGGAGGGAGGAAGG - Intergenic
1077644600 11:3912206-3912228 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1079129515 11:17739091-17739113 GGGGGAGGAGGGCGGGCAGGCGG - Intronic
1079574724 11:21989304-21989326 CAGTGAGTAGGGAGGACAAAAGG - Intergenic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1080132665 11:28815096-28815118 GGGTGAGGAAAGAGGGGAGATGG - Intergenic
1080561755 11:33470527-33470549 GGGTGAGGAGGGAGAGGTGAAGG - Intergenic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1081292078 11:41338548-41338570 TGGTGAGGAGGGAGAGCATCAGG + Intronic
1081572959 11:44302850-44302872 GGGTGAGGAGGGAAGACAAAGGG + Intronic
1081668340 11:44929499-44929521 CAGTGAGGAGAGAGGGCCCAGGG - Exonic
1081729042 11:45355601-45355623 CGGTGAGGAGGGTGGGGGGAGGG + Intergenic
1081739893 11:45431375-45431397 GGGTGAGGAGTGAGGGGTGAGGG + Intergenic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1082770092 11:57201187-57201209 CAGAGATGAGGGTGGGCAGAAGG - Intergenic
1082957065 11:58881728-58881750 TGGGGTGGAGGGAGGGCGGAGGG - Intronic
1083036780 11:59645309-59645331 CGGGGTGGTGGCAGGGCAGAGGG + Intronic
1083117441 11:60475782-60475804 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1083310094 11:61779575-61779597 GGGTGAGCAGGGATGGCAGGCGG + Intronic
1083366008 11:62141796-62141818 AGGGGAGGAGGGAGGGAAGGTGG - Intronic
1083609079 11:63996647-63996669 CGGTGAGAAGGGTGGGCACTGGG + Exonic
1083855434 11:65390822-65390844 TGGTGAGGAGGGAGTGGAGACGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083922694 11:65788969-65788991 AGGTGAGGGTGGAGGGCGGAGGG - Intronic
1083960502 11:66012540-66012562 CGGGGAGGAGGGAAGGCAGGTGG + Intronic
1084196340 11:67525140-67525162 TGGGGAGGAGGGAGGGAAGGAGG - Intergenic
1084196357 11:67525183-67525205 TGGGGAGGAGGGAGGGAAGGAGG - Intergenic
1084295696 11:68212681-68212703 CGGGGAGGAGGGTGGGCTGCAGG + Intronic
1084363962 11:68685743-68685765 AGGTCAAGAGGGAGGCCAGAGGG - Intronic
1084418771 11:69049735-69049757 AGGGCAGGAGGGAGTGCAGAGGG - Intronic
1084433380 11:69123743-69123765 GGGCCAGGAGGGAGGGCAGGGGG - Intergenic
1084455254 11:69264572-69264594 CAGTAAGGAGGGAGGGAACAAGG + Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084794023 11:71492125-71492147 GGGAGGGGAGGGAGAGCAGATGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085011220 11:73142642-73142664 CGTGGGGGAGGGAGGGCAGGAGG - Intergenic
1085193506 11:74650285-74650307 AAGTGAGGAGGGAGGGCTAATGG + Intronic
1085259193 11:75194543-75194565 GGGGGAGGAGGGAGGGGAGATGG - Intronic
1088079553 11:105894652-105894674 GGAGGAGGAGGGAGGGAAGAGGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088977879 11:114831912-114831934 TGGAGAGGAGGGTGGGCAGAGGG - Intergenic
1089059879 11:115617805-115617827 AGGGCAGGTGGGAGGGCAGAAGG + Intergenic
1089200927 11:116724426-116724448 TGGGGAGGAGGGAGGGGAGATGG - Intergenic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1089395037 11:118131204-118131226 TGGTAAGGAAGGAGGGTAGATGG - Intergenic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089628794 11:119770534-119770556 CACAGAGGAGGAAGGGCAGAGGG + Intergenic
1089671438 11:120059865-120059887 CGGAGATGAGGGAGGCCATAAGG - Intergenic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1089773976 11:120823443-120823465 CGGGGAGGAGGGAGGTAAAATGG - Intronic
1089887753 11:121844875-121844897 GGGAGTGGAGGGAGGGGAGAGGG - Intergenic
1089958750 11:122597225-122597247 AGGCGGGGAGGGAGGGCAGGAGG + Intergenic
1089968820 11:122676061-122676083 GGGTGAGGTGGGAGAGCTGAGGG - Intronic
1090089430 11:123681772-123681794 CAGGAAGGAGGGAGGGAAGAAGG + Intergenic
1090173102 11:124622711-124622733 AGGAGAGGAGGGAGGGCCGGCGG - Intergenic
1090378517 11:126308718-126308740 GGGTGGGGAGGGTGGGTAGAGGG - Intronic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1202815142 11_KI270721v1_random:43683-43705 GGGTGAGGAGGGAGAGGAGGGGG + Intergenic
1091387348 12:103551-103573 CGGTGGGGAGGCAGGGCTCAGGG + Intronic
1091387391 12:103664-103686 CGGTGGGGAGGCAGGGCTCAGGG + Intronic
1091527912 12:1323965-1323987 CAGGGAGGTGGGAGGGCAGGGGG - Intronic
1091546483 12:1504612-1504634 GGGTGCCGAGGGAGGGCAGGCGG - Intergenic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091641565 12:2241072-2241094 AGGTGAGGGGGGTGGGAAGAGGG + Intronic
1091661567 12:2387801-2387823 CTGTGAGGAGTGACAGCAGAGGG + Intronic
1091697940 12:2640598-2640620 CTGGGAGGAGGGGGGCCAGAAGG + Intronic
1091714750 12:2768793-2768815 GAGTGAGGAGGGAGGGCCGAGGG - Intergenic
1092566726 12:9673772-9673794 TGGTGAGGAGGGATGGCTCAGGG + Intronic
1092632491 12:10397411-10397433 GGGTGTGGTGGGTGGGCAGAAGG - Intronic
1092726514 12:11491537-11491559 CGGTGGGGAGGGAGAGCATCAGG + Intronic
1092789622 12:12060063-12060085 CGAGGAGGAGAGAGGTCAGATGG - Intronic
1092854270 12:12657917-12657939 CGGTGAGGAGGGAAGGGACAGGG - Intergenic
1092909049 12:13129180-13129202 GGGAGAGGAAGGAAGGCAGAAGG - Intronic
1092964294 12:13626821-13626843 TGGTGAGGGGGGAGGGGGGAGGG - Intronic
1093940357 12:25047598-25047620 AGGTGAGGAGGGAGAGCATCAGG - Intronic
1094058060 12:26286309-26286331 CTGAGAGCAGGGATGGCAGATGG + Intronic
1094739110 12:33268422-33268444 TGGTTAGGAGGGAGGGAAAAAGG + Intergenic
1095571327 12:43685795-43685817 CGGTGTGGTGGCCGGGCAGAGGG - Intergenic
1096082642 12:48842763-48842785 CGGGGTGGTGGGCGGGCAGAGGG - Intronic
1096230461 12:49894003-49894025 GGGTCTGGAGGAAGGGCAGAGGG + Intronic
1096529259 12:52233097-52233119 CGGCGGGGCGGGCGGGCAGAGGG + Exonic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096615754 12:52832609-52832631 GGGTGAGGAGGCAGGCAAGACGG + Intronic
1096708399 12:53437756-53437778 CGGGGTGGCGGCAGGGCAGAGGG - Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1097222691 12:57460200-57460222 AGGTGAGAAGGGGGGGCAGGCGG + Exonic
1097324948 12:58265994-58266016 TGGTGAGGAGGTAGGGAAGAGGG + Intergenic
1098217000 12:68231300-68231322 AGGGAAGGAGGGAGGGAAGAAGG + Intergenic
1099915757 12:88891296-88891318 TGGTGTGGGGGGAGGGCAGTGGG - Intergenic
1101641392 12:106587593-106587615 CGGAGAGGAGGGAGGGAGCAAGG - Intronic
1101905374 12:108820867-108820889 CGATGAGGTCGGAAGGCAGAGGG - Intronic
1102035130 12:109766610-109766632 AGGTGAGGAAGGAAGGCATACGG + Intronic
1102201206 12:111059251-111059273 CGGGGAGGTGGGAGGGGAGGAGG + Intronic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102454959 12:113065528-113065550 AGAGGAGGAGGGAGGGAAGAAGG - Intronic
1102789847 12:115635932-115635954 AGGGGAGGAGGGAGGGAAGGGGG + Intergenic
1102853089 12:116269397-116269419 CGGGGAGGAGGGAGAGCATCAGG - Intronic
1102992047 12:117322496-117322518 GGGGAAGGAGGGAGGGAAGAAGG - Intronic
1103030124 12:117606384-117606406 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103030158 12:117606464-117606486 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103581388 12:121918218-121918240 CGGTGAGGAGGCAGGCAGGACGG + Exonic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103859958 12:124004238-124004260 CTGGGTGGAGGGAGGGCATAAGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1104426785 12:128684499-128684521 TGGGGAGGAGGAAGGGGAGATGG - Intronic
1104544411 12:129698552-129698574 AGGGGAGAAGGGAGGGGAGAAGG + Intronic
1104544417 12:129698564-129698586 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1104798076 12:131533501-131533523 CGGGGAGGAATGTGGGCAGAGGG - Intergenic
1104985831 12:132596478-132596500 CGGTGAGTAGGACGGGCAGCGGG + Intergenic
1105534637 13:21254007-21254029 CGGGAAGGAGAGAGGGAAGAGGG + Intergenic
1106188088 13:27426079-27426101 CGGGCAAGAGGAAGGGCAGAGGG - Intronic
1106346665 13:28886123-28886145 TGGTCAGGAGTGAGGTCAGAGGG + Intronic
1106415855 13:29545305-29545327 GGGTGAAGGGGGTGGGCAGAGGG - Intronic
1107219368 13:37963181-37963203 CAGTCAGGAGAGAAGGCAGAGGG + Intergenic
1107389719 13:39951454-39951476 GGGGGAGGAGGGAGGGCAGGGGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1107836183 13:44413945-44413967 GGCTGAGGAGTGAGGGCACACGG + Intergenic
1108243694 13:48493594-48493616 CGGTGTGGAGGGAGCACAGTGGG - Intronic
1108459110 13:50647357-50647379 TGGTGAGAGGGGAGGGCAGTAGG + Intronic
1108777222 13:53781436-53781458 CGGTGAGCAGGGAGGCACGAAGG - Intergenic
1108856476 13:54799713-54799735 CGCTGAGGAGTGCGGGCACACGG - Intergenic
1109211787 13:59543704-59543726 AGGGAGGGAGGGAGGGCAGAAGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110650615 13:77937756-77937778 CGATGAGGGGAGAGGTCAGATGG + Intergenic
1110846510 13:80195832-80195854 AGGATGGGAGGGAGGGCAGAAGG + Intergenic
1111856176 13:93640700-93640722 TGGGGAGGAGGGAGGACTGAGGG - Intronic
1112441370 13:99426979-99427001 AGGGGAGGAGGGAGGAGAGAGGG + Intergenic
1112569102 13:100577835-100577857 AGGAAAGGAGGGAGGGCAGCAGG + Intronic
1112601069 13:100856483-100856505 GGGAGAGGGGGCAGGGCAGATGG + Intergenic
1113146052 13:107208866-107208888 GGGGGAGGAAGGAGGGAAGAGGG - Intronic
1113329199 13:109311850-109311872 CGGGGTGGCGGTAGGGCAGAGGG - Intergenic
1113954364 13:114089291-114089313 CGGGGAGGAGGGGGGGAGGAGGG + Intronic
1114535879 14:23422142-23422164 TGGGGAGGAGGAAGGGCAGCAGG + Intronic
1115433568 14:33348315-33348337 GGGTGAGGAGGCAGGGAGGATGG + Intronic
1116704233 14:48276266-48276288 AAGAGAGGAGGGAGGGAAGAAGG - Intergenic
1116840939 14:49820620-49820642 GGGGGAGGAGAGAGGGGAGAGGG - Intronic
1118187619 14:63551521-63551543 GGGGGAGGAGGGAGGGAAGAGGG - Intergenic
1118693766 14:68364220-68364242 CGATGAGGAGTGGGCGCAGAGGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118980200 14:70710083-70710105 CTGGGAGGTGGGTGGGCAGACGG - Intergenic
1118989284 14:70783259-70783281 CGGTAAGGTGGGAAGGAAGACGG + Intronic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1119754466 14:77105271-77105293 AGGAGAAGAGAGAGGGCAGAAGG - Intronic
1119931453 14:78551656-78551678 AGGTGAGGAGGGAGGGGAGGAGG - Intronic
1120521482 14:85531713-85531735 CGGGGAGGAGGGAGCGCGGCTGG - Intronic
1120535641 14:85691802-85691824 CGGGAAGGAGTGAGGGCAAATGG + Intergenic
1120571955 14:86129661-86129683 CTGTGAGGAGGGAAGGCCAAGGG + Intergenic
1120881370 14:89417258-89417280 CGGGGAGGGAGGAGGGCGGAGGG + Intronic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121242577 14:92440916-92440938 CAGGGAGGAGGGAGGACAGGAGG + Intronic
1121280968 14:92697644-92697666 TGGTGAGGAGGCAGGGCATGAGG + Intergenic
1121284556 14:92725216-92725238 AGATTAGGAGGGAGGACAGAGGG - Intronic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121469228 14:94139001-94139023 TGGAGAGGAGAGGGGGCAGAGGG - Intergenic
1121473404 14:94174112-94174134 CGGCGAGGAGCGGGCGCAGAAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121592355 14:95125664-95125686 GGGGGAGGAGGGAGGGGACAGGG + Intronic
1121592367 14:95125688-95125710 GGGGGAGGAGGGAGGGGAGAGGG + Intronic
1122128460 14:99591662-99591684 CGGTGGGGAGGGTGGGGAGGTGG + Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122276838 14:100594984-100595006 TGGTGAGGAAGGAGCCCAGATGG - Intergenic
1122781867 14:104147176-104147198 CGGCGAGGTGGGGTGGCAGAGGG - Intronic
1122805418 14:104253927-104253949 GGGTGAGAAGGGAGGGGAGCAGG + Intergenic
1122852288 14:104543110-104543132 AGGTGGGGAGGGAGGGCTAAGGG - Intronic
1122985453 14:105209631-105209653 CATCGAGGAGGGAGGGCAGACGG - Exonic
1123025717 14:105422794-105422816 TGGTGAGCAGGGAGGGAACAGGG + Intronic
1124256498 15:28146896-28146918 AGGGGAGGAAGGAGGGAAGAAGG + Intronic
1124308940 15:28603508-28603530 CGGTGCGGAGGGATGGAAAAAGG + Intergenic
1124567732 15:30832197-30832219 AGGGGAGGAAGGAGGGAAGAAGG - Intergenic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1124687346 15:31793419-31793441 CAGTGAGGAGAGAGGACACAGGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125675205 15:41498515-41498537 CAGTGAGGAGGGCTGGCAGGTGG - Intronic
1125720639 15:41843571-41843593 GGGAGAAGAGGGAGGGCAGTAGG + Intronic
1125832768 15:42728383-42728405 GGGTGGGGCGGGAGGGCAAACGG - Intronic
1125903126 15:43367538-43367560 GGGAGATGAGGGAGGGCTGACGG - Intronic
1126552032 15:49942038-49942060 AAGTGAGGAGGGTGGGAAGAGGG + Intronic
1127088941 15:55447792-55447814 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127088949 15:55447813-55447835 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127088957 15:55447834-55447856 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127560582 15:60132522-60132544 AGGAAAGGAGGGAGGGAAGAAGG + Intergenic
1127560602 15:60132591-60132613 AGGAAAGGAGGGAGGGAAGAAGG + Intergenic
1127606460 15:60592314-60592336 CGGGGAGGAGGGCGCGCAGGGGG - Intronic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1128084966 15:64879529-64879551 AGGTGAGGAGGGAGGAGAGATGG + Intronic
1128162587 15:65434099-65434121 AGCTGAGGAGGGAGAGCAGGAGG - Intergenic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1128304181 15:66587107-66587129 GGGGGAGGAGGAAGGGGAGAAGG - Intronic
1128343869 15:66841898-66841920 CGGTGAGAAGACAGGGCACACGG - Intergenic
1128541476 15:68537629-68537651 CGGTGGGGAGGGAGAGCATTGGG - Intergenic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128729235 15:70009574-70009596 TGTTCAGGAGGGAGGGCAGTGGG - Intergenic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129263998 15:74384247-74384269 TGGTGAGCAGGGGGTGCAGAGGG - Intergenic
1129326731 15:74803738-74803760 GGTTGAGGATGCAGGGCAGAGGG + Intergenic
1130096590 15:80860801-80860823 TGGTGAGGTCAGAGGGCAGAGGG - Intronic
1130225974 15:82058749-82058771 TGGGGAGGAGGAAGGGGAGAAGG - Intergenic
1130908180 15:88254359-88254381 GGGTCAGCAGGGAGGGCAGGAGG - Intronic
1130908680 15:88256796-88256818 AGGGGAGGAGGGAGGGAGGAAGG - Intergenic
1131090668 15:89622681-89622703 CGGGGAGGGGTGAGGCCAGAGGG - Intronic
1131577257 15:93604407-93604429 TGGGGAGGTGGGAAGGCAGATGG - Intergenic
1131665654 15:94568551-94568573 AGAGGAGGAGGCAGGGCAGAGGG + Intergenic
1131683171 15:94744975-94744997 AGGAAAGGAGGGAGGGAAGAAGG + Intergenic
1131764472 15:95660439-95660461 GGGGCAGGAGGGAGGGCAGGGGG - Intergenic
1132078588 15:98845378-98845400 CGAGGAGGAGGGAGGGGAGGAGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132491543 16:234599-234621 CGGAGAGGAGCGAGGACGGAGGG + Exonic
1132716486 16:1292639-1292661 GGGAGAGGAGAGAGGGGAGAGGG - Intergenic
1132745627 16:1435021-1435043 CGGGGAGGCGGCAGGGCTGAGGG + Intronic
1133025926 16:2988925-2988947 GGGAGAGGAGGGAGGGGACAAGG + Intergenic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133419970 16:5637800-5637822 TGGTGAGGAGGGAGGGCCACAGG + Intergenic
1133964197 16:10519331-10519353 GGGAGAGGAGGGAGGGGAGGGGG - Intergenic
1133964215 16:10519363-10519385 GGGAGAGGAGGGAGGGGAGGGGG - Intergenic
1134179607 16:12036979-12037001 CGGTGGTGAGGGACGACAGATGG - Intronic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134765953 16:16758131-16758153 TGGGGAGGAGGGAGAGCACAGGG - Intergenic
1134980095 16:18601083-18601105 TGGGGAGGAGGGAGAGCACAGGG + Intergenic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1135302853 16:21345796-21345818 AGGGGAGGAGGGAGGGGAGGGGG - Intergenic
1135306347 16:21370748-21370770 CGGTGCTGAGGGATGACAGATGG - Intergenic
1135518623 16:23156277-23156299 AGGGGAGGAGGGAGAGGAGAGGG + Intergenic
1136050342 16:27645739-27645761 CGGTCAGGAAGAAGGGTAGAAGG + Intronic
1136103506 16:28012230-28012252 AGGGGTGGTGGGAGGGCAGAGGG - Intronic
1136230525 16:28882993-28883015 GGGGAAGGAGCGAGGGCAGAAGG + Intronic
1136299601 16:29324990-29325012 AGGGGAGGAGGGAGGGAAGGGGG - Intergenic
1136303091 16:29349892-29349914 CGGTGCTGAGGGATGACAGATGG - Intergenic
1136396368 16:29994697-29994719 CAGTGATGAGGAACGGCAGAGGG - Exonic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136910433 16:34140833-34140855 CGGTGGGGCGGGGAGGCAGAGGG + Intergenic
1137439231 16:48483892-48483914 CGGAGAGGGGGAAGGGGAGAGGG + Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138242227 16:55436287-55436309 GAGAGAGGAGGGAGGGGAGAGGG + Intronic
1138277435 16:55746028-55746050 GGGAGAGGAGGGCAGGCAGAAGG + Intergenic
1138281994 16:55779397-55779419 AGGTGAAGAGGAAGGGGAGAGGG + Intergenic
1138419792 16:56891913-56891935 CGGGCAGGAGGCAGGTCAGAGGG + Intronic
1138463414 16:57168048-57168070 GGGAGAGGAGGGAGGGCTGGTGG - Intronic
1138548058 16:57731069-57731091 CGGTGAGCAGGCAGGGCAGGTGG + Exonic
1138555081 16:57766236-57766258 GGGTGAAAAGGGAGGGCAGGTGG - Intronic
1139954352 16:70686116-70686138 CCGCGAGGAGGGAGGGAAGGAGG + Intergenic
1141033736 16:80610986-80611008 TGGTGAGGATGGTGGGGAGAGGG - Intronic
1141157916 16:81609970-81609992 CAGTGTGGTGGCAGGGCAGAGGG + Intronic
1141343919 16:83228069-83228091 CCGTGAGAAGGGAGGCCAGATGG + Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141570225 16:84929604-84929626 TGGAGAGGAGGAAGGGGAGAAGG + Intergenic
1141610578 16:85178855-85178877 CGGTGAGGAGGGAGGTGCGGGGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1142012767 16:87725170-87725192 CGGAGGGGAGGGTGGGCAGCGGG + Intronic
1142030869 16:87837892-87837914 TGGAGAGGATGGAGGGCAGGTGG + Exonic
1142251374 16:88993573-88993595 GGAGGAGGAGGGAGGGAAGAGGG - Intergenic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143013204 17:3877564-3877586 TGGAGAGGAGGGAGGAGAGAAGG + Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143379916 17:6489589-6489611 CTCTGAGGAGGCAGGGCTGAGGG - Intronic
1143494020 17:7300672-7300694 CAGTGAGGAGGGAGAACGGAGGG - Intergenic
1144143676 17:12376371-12376393 GGGGGAGGAGGGAGGGGGGAGGG + Intergenic
1144155502 17:12496607-12496629 AGGTCAGGAGGGAAGGCAGCAGG - Intergenic
1144215968 17:13055822-13055844 AGCTGATGAGGGAGGGGAGATGG + Intergenic
1144316805 17:14069552-14069574 CCGTGAGGAGAGAGGACACAGGG + Exonic
1144536201 17:16094567-16094589 AGGGGAGGAGAGAGGGGAGAGGG - Intronic
1144771450 17:17761862-17761884 CACTGAGGAGCGAGGGCAGGTGG + Intronic
1144826207 17:18107129-18107151 GGGTGAGGAATGGGGGCAGAGGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145059968 17:19726696-19726718 CGAGGAGGAGGGGGGGGAGAAGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145158887 17:20560963-20560985 GGGTGAGGAGGGAGAGGAGTGGG - Intergenic
1145786509 17:27597323-27597345 CGGTGAGGAGGGTGTGGAGGAGG - Exonic
1146501498 17:33368743-33368765 TGGTGAGGAGAGAGGAAAGATGG - Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146670797 17:34736313-34736335 AGGTGAGGAGGGAGAGGAGGAGG + Intergenic
1147120854 17:38334371-38334393 GGCTGAGGAGTGAGGGGAGAAGG + Intronic
1147429234 17:40361614-40361636 TGGTGAAGGGGGAGGGCAGACGG + Intronic
1147717187 17:42516405-42516427 TGGGGAGGAGGGAGGCCAGGAGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148739013 17:49881305-49881327 AGATGATGAGGGAGGGGAGAAGG - Intergenic
1148746276 17:49920111-49920133 CGGACAGGTAGGAGGGCAGAGGG - Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148869724 17:50649686-50649708 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149912305 17:60577764-60577786 AGCTGAGGAGGGAGGGTGGATGG + Intronic
1150124477 17:62627616-62627638 CCGGGCGGAGGGAGGGCGGAGGG - Exonic
1150265860 17:63832141-63832163 TGGTGAGGAGGGTGGGCCTAGGG - Exonic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150947790 17:69765895-69765917 AGGGGAGCAGGGAGGGGAGAAGG - Intergenic
1150993157 17:70284418-70284440 GGGTGAGGAGGAAGGGAATAGGG - Intergenic
1151300816 17:73224003-73224025 AGGAAAGGAGGGAGGGAAGAAGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151364025 17:73605508-73605530 AGGAGAGGAGGGAGTGGAGAGGG + Intronic
1151599720 17:75098810-75098832 TGGAGAGGATGCAGGGCAGAAGG + Intronic
1151622105 17:75252460-75252482 GGATGAGGAGAGAGGGAAGAAGG - Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152266237 17:79296669-79296691 AGGGGAGGAGGGAGGGGAGGAGG - Intronic
1152296024 17:79467361-79467383 CGGGGAGGAGGGAGAGAAGGTGG + Intronic
1152322428 17:79615420-79615442 GGGAGAGGAGGGAGGGCAGGAGG + Intergenic
1152336579 17:79702531-79702553 GGGTCAGGAGGGAGGAGAGAGGG + Intergenic
1152625698 17:81387039-81387061 GGGCGCGGAGGGAGGGCCGAGGG + Intergenic
1152635838 17:81430198-81430220 CGGTGGGGAGGGAGGGGACCAGG - Intronic
1152790390 17:82275469-82275491 CGGTGACGAGGGAGGGATGCGGG + Intergenic
1152915517 17:83032700-83032722 GGGTCAGGAGAGAGGGCTGAAGG + Intronic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1152926385 17:83089632-83089654 CGGTGGGGAGGGTCGGCAAAGGG - Intronic
1153914568 18:9734097-9734119 CGGGGAGGAGGGAGGGAGGGAGG + Intronic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1155276193 18:24189829-24189851 CTGTGAGGACTGAGGACAGAAGG - Intronic
1155590412 18:27420992-27421014 AGGAGAAGAGGAAGGGCAGAGGG - Intergenic
1155724486 18:29062639-29062661 AGGTGTGGAGGTAGGGGAGAGGG - Intergenic
1155966060 18:32036607-32036629 AGGGAAGGAGGGAGGGGAGAGGG + Intronic
1156292409 18:35759464-35759486 GGGGGAGGGGGGAGGGGAGAGGG + Intergenic
1156381405 18:36564714-36564736 TGGGGAGGAGGGAGGGGAGACGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156490212 18:37491634-37491656 GAGTGAGGAGGGAAGGGAGAAGG + Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157475382 18:48020684-48020706 AGGAGAGGAGGGAGGGGAGGAGG - Intergenic
1157475407 18:48020762-48020784 AGGAGAGGAGGGAGGGGAGGAGG - Intergenic
1157475430 18:48020837-48020859 AGGAGAGGAGGGAGGGTAGGAGG - Intergenic
1157475505 18:48021098-48021120 AGGAGAGGAGGGAGGGGAGGAGG - Intergenic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157955992 18:52098319-52098341 TGGAGAGGAGGGAAGGGAGATGG + Intergenic
1158406575 18:57165412-57165434 GGGAGAAGAGGGAGGGAAGAAGG - Intergenic
1158453354 18:57586387-57586409 CGCGGAGAAGGGAGGGCTGAGGG - Intronic
1158468731 18:57714577-57714599 GGGAGAGGAGGGAGGGGGGAAGG + Intronic
1159093389 18:63874153-63874175 AGGAAAGGAGGGAGGGAAGAAGG - Intronic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160024741 18:75208559-75208581 GGGGGAGGAGGGAGGGCTGGAGG + Intronic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160557906 18:79738024-79738046 CGGTGAGCAGGGCGGGCGGGGGG - Intronic
1160659550 19:291619-291641 AGGGGAGGAGGGAGGGGGGACGG + Intergenic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1160745351 19:708844-708866 CGGGGAGGTGGGAGGGGAGCGGG + Intergenic
1160872190 19:1282517-1282539 AGGGGAGGAGGGAGGGAGGAGGG + Intergenic
1160872213 19:1282569-1282591 AGGGGAGGAGGGAGGGAGGAGGG + Intergenic
1160872232 19:1282620-1282642 AGGGGAGGAGGGAGGGAGGAGGG + Intergenic
1160944165 19:1633463-1633485 GGATGAGCAGGGAGGGCAGGGGG - Intronic
1161022363 19:2016066-2016088 AGGGGAGGAGGGAGGGGAGAAGG + Intronic
1161035784 19:2083627-2083649 CGGGGAGGAGGGAGGTGAGTGGG - Intronic
1161139744 19:2640118-2640140 AGGGGAGGAGGGAGGGAGGAGGG + Intronic
1161151468 19:2712317-2712339 CGGTCATGGGGGAAGGCAGAGGG - Intergenic
1161245604 19:3249912-3249934 GGGTGAGGGGAGTGGGCAGAGGG - Intronic
1161258846 19:3324535-3324557 CTGTGAGGGGTGAGAGCAGAGGG - Intergenic
1161282065 19:3451299-3451321 AGGTGAGGAGTGACGGCTGATGG + Intronic
1161309756 19:3586993-3587015 CGGTGAGGCGGGTGGGCTGGCGG + Exonic
1161313482 19:3607333-3607355 GGGTGGGGTGGGAGGACAGAGGG + Intergenic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162088005 19:8260063-8260085 CAGGGAGGAGGGAGGGCTGCTGG + Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162286520 19:9743107-9743129 GGGGGAGGAGAGAGGTCAGAGGG - Intergenic
1162738956 19:12763125-12763147 TGGTGGGGAGGGAGGGCGGGAGG - Exonic
1162818140 19:13208244-13208266 CAGGGAGGAGGGAGGGGAGGAGG + Intronic
1162948513 19:14057496-14057518 CGCGGAGGAGGGAGGGGAAAGGG - Intronic
1163103684 19:15111452-15111474 GGGTGAGCAGGCAGGGGAGAGGG - Intronic
1163500707 19:17674533-17674555 AGGGGAAGAGGGAGGACAGAGGG + Intronic
1163816271 19:19466425-19466447 CGGTGAGGAGAGAGAGCAACGGG - Intronic
1163886128 19:19966320-19966342 CAGTGAGGAGGGATGGGTGAGGG + Intergenic
1163888339 19:19989158-19989180 CAGTGAGGAGGGATGGGTGAGGG - Intergenic
1163945672 19:20531221-20531243 AGGGGAGGAGAGAGGGGAGAGGG + Intergenic
1164588810 19:29494853-29494875 GGGTGAGGAGGGAGGGAGGGAGG + Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165944934 19:39436315-39436337 CGGGGAGGAGGGAGTCCAGAGGG - Intronic
1166200452 19:41234105-41234127 TGGGGAGGAGTGGGGGCAGATGG - Intronic
1166214278 19:41325431-41325453 CGGTGAGGGAGGAAGGCAGAGGG - Intronic
1166228793 19:41413669-41413691 AGATGAGGAGGGAGAGGAGATGG - Intronic
1166326466 19:42053936-42053958 GGGTGGGGAGGTGGGGCAGAGGG + Intronic
1166326518 19:42054218-42054240 GGAAGAGCAGGGAGGGCAGAGGG + Intronic
1166329593 19:42070246-42070268 CAGGGAGGAGGGCGGGCAGGAGG + Intronic
1166547314 19:43640962-43640984 CGGGGAGGGGGGAGGGGGGAAGG - Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166800076 19:45451195-45451217 CGGGGAGGAGGGGGCGCAGACGG - Intronic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
1167112805 19:47471906-47471928 CGGGGAGGAGGGGAGGGAGAGGG + Exonic
1167284149 19:48589309-48589331 AGGGGAGGAGGGAGGGGAGCAGG + Intronic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1168008343 19:53509212-53509234 CACAGAGGAAGGAGGGCAGATGG - Intergenic
1168349891 19:55669724-55669746 CGGAGAAGAGGAGGGGCAGAGGG - Intronic
1168354118 19:55691576-55691598 GGATGAGGAGGGAGGCCAGGTGG + Intronic
1168636100 19:57998764-57998786 TGGTGAGGAGGCTGGGCAGGAGG + Intronic
925167824 2:1729342-1729364 GGGTCAGGAGGGAGGGCTGAAGG - Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
925618714 2:5769164-5769186 CAGTGAAGAGGGAGGAGAGAGGG + Intergenic
925721443 2:6832031-6832053 AGGTCAGGGAGGAGGGCAGAAGG + Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926240461 2:11081122-11081144 GGGGGAGGGGGGAGGCCAGAGGG - Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927178492 2:20427112-20427134 GGGTGAGGGGGGAGTGTAGAGGG + Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
928105596 2:28468732-28468754 GGGGGAGGAGGGAGGGAAGGGGG + Intronic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928466513 2:31527736-31527758 CTGTGAGGAGGGGTGGCAGAGGG - Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929030960 2:37649570-37649592 CAGTGAGGAGGAAGAGCAAAGGG + Intronic
929278994 2:40057579-40057601 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929787169 2:45001319-45001341 TGGTGAGCAGGAAGGGAAGAAGG - Intergenic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
930357780 2:50344190-50344212 GGGTGAGGTGTGAGTGCAGAGGG - Intronic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
931232100 2:60383607-60383629 CGTTGGGGAGGGAGGGAACACGG - Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
932091813 2:68812486-68812508 CGGTGAGGAGTTAGGGCATGAGG - Intronic
932476846 2:72011653-72011675 AGGAGAGGAGGAAGGGCAGGTGG + Intergenic
932493729 2:72136544-72136566 AGGGAAGGAGGGAGGGCAGGAGG + Intronic
933124920 2:78593202-78593224 AGGAGAGGAGGGAGGGAGGAAGG - Intergenic
933554372 2:83813445-83813467 CTGTGAGAAGGGATGGCAGGAGG - Intergenic
933704097 2:85277072-85277094 CGGTGAGGGTGGAAGCCAGAAGG + Intronic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934622865 2:95826173-95826195 CAGTGAGGAGGGATGGGTGAGGG + Intergenic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934793008 2:97078896-97078918 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
934813179 2:97301589-97301611 GGGTGAGGAGGGAGAGCATCAGG + Intergenic
934824516 2:97406891-97406913 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
934856084 2:97731269-97731291 CAGTGAGGAGGGAGGGCTATTGG - Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935131660 2:100265311-100265333 CTGTGGGGAGGGAGGGCTTAGGG - Intergenic
935489393 2:103698263-103698285 TGGTGAGGAGGGATGGCTGTGGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936090345 2:109498139-109498161 CGGGAAGGAAGGAGGGCAGGCGG - Intronic
936342982 2:111654057-111654079 CAGATAGGAGGGAGGGCAGAGGG - Intergenic
936528013 2:113255217-113255239 AGGGGAGGAGGGAGGGGAGGAGG + Intronic
936528019 2:113255229-113255251 AGGGGAGGAGGGAGGGGAGGAGG + Intronic
936528025 2:113255241-113255263 AGGGGAGGAGGGAGGGAGGAGGG + Intronic
936528036 2:113255264-113255286 AGGGGAGGAGGGAGGGGAGGAGG + Intronic
936528042 2:113255276-113255298 AGGGGAGGAGGGAGGGAGGAGGG + Intronic
936528053 2:113255299-113255321 AGGGGAGGAGGGAGGGGAGGAGG + Intronic
936674856 2:114702992-114703014 GGGTGAGCAGGGTGGGAAGAAGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936985508 2:118308684-118308706 AGGAGAAGAGGGAGGGAAGATGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937123032 2:119453736-119453758 CGGGGAGGAGGAAGTGGAGAAGG + Intronic
937228020 2:120380912-120380934 AGTTGAGGAGGGAAGGCTGAGGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937845364 2:126573440-126573462 AGGTGAGGAGGAAGGGCAGGAGG - Intergenic
937988203 2:127648051-127648073 CGGTGAGGGCGGAGAGCTGAGGG - Exonic
938055228 2:128209306-128209328 CGGGGTGGCGGCAGGGCAGAGGG - Intergenic
938112488 2:128578392-128578414 TGGAGAGGAGGGAGGGAGGAAGG - Intergenic
938778494 2:134562757-134562779 TGGTGAGGAGAGAGGACAAAAGG - Intronic
939720627 2:145645988-145646010 TGGTGACCAGGGAGGGCAGAAGG + Intergenic
939945833 2:148409440-148409462 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
939998910 2:148947806-148947828 CAGTGATGATGGAGGCCAGAGGG - Intronic
939999734 2:148955087-148955109 AGGGAAGGAGGGAGGGCAGGAGG - Intronic
941827903 2:169920316-169920338 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
942168370 2:173264836-173264858 CGGTCAGGGGGCAGGGGAGAAGG + Intronic
942685257 2:178523815-178523837 GGCTGAGGAGGGATGGAAGAGGG - Intergenic
942947446 2:181685127-181685149 GGGTGAGGAGCGTGAGCAGAGGG + Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945677628 2:212875116-212875138 AGGCAGGGAGGGAGGGCAGAAGG - Intergenic
945869211 2:215208244-215208266 GGGTGAGGAGTGCGGGCACATGG + Intergenic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946194886 2:218027018-218027040 CAGGGAGGAGGAAGGGCAGCCGG + Intergenic
947029919 2:225782538-225782560 AGGAAGGGAGGGAGGGCAGAAGG - Intergenic
947179421 2:227399014-227399036 GAGGGAGGAGGGAGGGAAGAAGG + Intergenic
947341854 2:229148761-229148783 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
947367314 2:229410019-229410041 TGGTGAGGAGGGCAGGAAGAGGG - Intronic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
947621675 2:231594797-231594819 CGGTGAGCTGGGGGTGCAGAGGG + Intergenic
947661190 2:231869946-231869968 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
947749727 2:232525964-232525986 GGGTGGGGAGGGAGGGCCGGGGG - Intergenic
948425717 2:237885677-237885699 CGGTGGGCAGGGAGGTCAGTAGG - Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948724203 2:239921869-239921891 AGGGAAGGAGGGAGGGAAGAGGG - Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1169118290 20:3081314-3081336 AGGTCAGGAGGGAGTGCAGGAGG - Intergenic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1169636931 20:7702774-7702796 CAATGAGGAGGGAGAGCAGCAGG - Intergenic
1169659202 20:7959384-7959406 AGGTGAGGAGGGAGAGAAAAGGG - Intergenic
1169744110 20:8926340-8926362 AGGTGAAGAGGGAGTGTAGAAGG + Intronic
1170021822 20:11845047-11845069 TGGGGAGGAGGGAGAGCACATGG + Intergenic
1170522087 20:17197174-17197196 AGGGAAGGAGGGAGGGCAGGAGG + Intergenic
1170758091 20:19222750-19222772 AGGGGAGGAGGGAAGGAAGAAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171011039 20:21509714-21509736 CAGTGAGGAGGCCGGGCAAAAGG - Intergenic
1171179568 20:23082720-23082742 GGGTAAGGAGGGAAGGAAGAGGG - Exonic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171769598 20:29312215-29312237 GGCTGAGGAGGGAGGAAAGAAGG + Intergenic
1172180610 20:33001191-33001213 AGGTGAGCAGGGAAGGCAGGGGG - Exonic
1172230848 20:33334492-33334514 TGGATAGGAGGGTGGGCAGATGG + Intergenic
1172270872 20:33655094-33655116 CGGGCAGGTGCGAGGGCAGAAGG - Intergenic
1172307147 20:33888905-33888927 CATGGAGGAGGGAGGGCACAGGG + Intergenic
1172468080 20:35171922-35171944 CGGGGCAGAGGGAGGGCAGGAGG + Intergenic
1172694013 20:36809269-36809291 TGGTGATAAGGGAGGGCACAAGG + Intronic
1172829910 20:37824875-37824897 TGGGGAGAAGGAAGGGCAGAAGG + Intronic
1172841051 20:37903037-37903059 AGGGGAGGAGGGAGGGGAGGAGG + Intergenic
1173187366 20:40850695-40850717 TGGAAAGGAGGGAGGGAAGAAGG + Intergenic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173225520 20:41160267-41160289 GGGCCAGGAGGGTGGGCAGAAGG + Intronic
1173362188 20:42354850-42354872 CCTTGAGGAGAGAGGTCAGACGG + Intronic
1173869349 20:46331810-46331832 GGCAGAGGAGGGAGGGCAGCTGG + Intergenic
1174339834 20:49888775-49888797 TGGTGGGGAGGGAGATCAGATGG - Exonic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1174817285 20:53697702-53697724 GGGAGAGGAGGGAGGGAAGGAGG + Intergenic
1175204220 20:57299326-57299348 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
1175300193 20:57937646-57937668 TGGTGAGCGGGGTGGGCAGAGGG + Intergenic
1175325291 20:58121923-58121945 AGGTGAGGAGGGAGGGAATGGGG + Intergenic
1175892956 20:62323390-62323412 CGGGGAGGAGGGAGGCCTGCTGG - Intronic
1175916508 20:62428429-62428451 CGGGGAGGAGGGAGTGGGGAGGG - Intergenic
1175998801 20:62822819-62822841 TGGTGAGGAGGGTGGGAAGGGGG - Intronic
1176035711 20:63035518-63035540 AGGTGAGGAGGGTGGCCTGAGGG - Intergenic
1176057093 20:63154700-63154722 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176057110 20:63154752-63154774 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176173669 20:63707827-63707849 CGGTGAGGCGCGAGGCCCGAGGG - Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176284547 21:5012517-5012539 GGGTGAGGGGGCAGGGCTGAGGG - Intergenic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1176348157 21:5770335-5770357 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1176349281 21:5778335-5778357 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176354971 21:5890919-5890941 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1176356095 21:5898919-5898941 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1176496670 21:7554120-7554142 CGGGGTGGTGGCAGGGCAGAGGG - Intergenic
1176542478 21:8168405-8168427 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1176543602 21:8176405-8176427 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176561429 21:8351450-8351472 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1176562553 21:8359450-8359472 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1177119473 21:17123119-17123141 CGATGAGGGGAGAGGTCAGATGG - Intergenic
1177400265 21:20594558-20594580 TGGGGTGGAGGGAGGGGAGAGGG - Intergenic
1177736204 21:25092919-25092941 GGGGGAAGAGGGAGGGAAGAGGG - Intergenic
1177869221 21:26550312-26550334 CAGGGAGGAGGGAGGCCTGAGGG - Intronic
1178050948 21:28746801-28746823 GGGTGAGAAGGGAAGGGAGAGGG + Intergenic
1178640019 21:34338043-34338065 ATGTGAGGAGGGTGGGCACACGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178930903 21:36818175-36818197 CGGTGAGGGGGGCGGCCAGAAGG + Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179023058 21:37657028-37657050 TGGAGAGGAGGGAGGGGACAGGG + Intronic
1179116688 21:38499752-38499774 GGAGGAGGAGGGAGGGAAGAGGG + Intronic
1179170882 21:38971898-38971920 CGGAGAGTAGGGAAGGGAGAGGG - Intergenic
1179478043 21:41660279-41660301 TGGTGGGGAGTGGGGGCAGAGGG - Intergenic
1179603912 21:42499659-42499681 CAGGGAGGAGGGAGGGCCGAGGG + Intronic
1179628630 21:42663429-42663451 CAGCTCGGAGGGAGGGCAGAAGG + Intronic
1179629224 21:42666357-42666379 GGGGAAGGAGGGAGGGCAGCTGG + Intronic
1179631723 21:42682950-42682972 TGGGGAGGAAGGAGAGCAGATGG + Intronic
1179646944 21:42781985-42782007 GGGAGAGGAGGAAGGGGAGAGGG - Intergenic
1179661626 21:42879492-42879514 CGGTGAGGCGGGCGGGTACATGG - Exonic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1179872634 21:44250958-44250980 GGGTGAGGGGGCAGGGCTGAGGG + Intronic
1179925922 21:44533970-44533992 GGGTGCGGGGGCAGGGCAGATGG + Intronic
1180008955 21:45037167-45037189 TGGTGGGGAGGAAGGGCAGGAGG + Intergenic
1180104255 21:45607578-45607600 AGGGGAGGAGGGAGGGGAGAAGG + Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180141936 21:45898287-45898309 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141940 21:45898313-45898335 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141950 21:45898365-45898387 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141955 21:45898391-45898413 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141960 21:45898417-45898439 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180142021 21:45898645-45898667 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180142034 21:45898689-45898711 CCGTGAGGACGGCGTGCAGAGGG - Intronic
1180142047 21:45898733-45898755 CCGTGAGGACGGCGTGCAGAGGG - Intronic
1180142072 21:45898821-45898843 CCGTGAGGACGGCGTGCAGAGGG - Intronic
1180142084 21:45898865-45898887 CTGTGAGGACGGCGTGCAGAGGG - Intronic
1180142092 21:45898909-45898931 CCGTGAGGACGGCGTGCAGAGGG - Intronic
1180600285 22:17010834-17010856 TGGGTAGGAGGAAGGGCAGAGGG + Intergenic
1180653670 22:17400644-17400666 CAGAGAAGAGGGAGGTCAGAGGG + Intronic
1180702847 22:17791070-17791092 CACTGAGGAGGCAGGGCAGGAGG + Exonic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1181545212 22:23598609-23598631 CTAGGAGGAGGGAGGGCAGCTGG - Intergenic
1181602406 22:23960267-23960289 CGGTGAGGGGTGAGGGAAGGAGG + Intronic
1181606105 22:23981040-23981062 CGGTGAGGGGTGAGGGAAGGAGG - Intronic
1181801313 22:25349331-25349353 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1181811219 22:25404996-25405018 CGGTGAGGAGGGCGCGCGGGCGG - Intronic
1181815098 22:25431272-25431294 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1182027780 22:27134088-27134110 CAGTCACCAGGGAGGGCAGAGGG + Intergenic
1183344319 22:37298771-37298793 CGGTGAGCAGGGGATGCAGACGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183373821 22:37450689-37450711 CGGGGAGGAAGGAGGGCGGGTGG - Intergenic
1183395344 22:37568247-37568269 CGCTGAGGAGTGAGGGCCCAAGG - Exonic
1183640079 22:39087297-39087319 CGGAGAGGAGGGAGGGATGTGGG - Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1184014803 22:41777979-41778001 GGAGGAGGAGGGAGGGGAGAAGG - Intronic
1184035301 22:41915137-41915159 GAGAGAGGAGGGAGGGCGGAAGG + Intergenic
1184172048 22:42765634-42765656 TGGAGAGGAGGGACGGCAGTGGG - Intergenic
1184236357 22:43185347-43185369 AGGTGAGGCAGGAGGGCTGATGG + Intronic
1184538149 22:45101525-45101547 GGGTGAGGGGGGAGGGGAGAAGG - Intergenic
1184589277 22:45470843-45470865 CGGGGAGGGGGGAGGGGGGAGGG - Intergenic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
1185215986 22:49600241-49600263 CGTGGTGGAGGGAGGGCAGGTGG - Intronic
1203247417 22_KI270733v1_random:84823-84845 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1203248471 22_KI270733v1_random:92624-92646 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
949551332 3:5114690-5114712 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
949608969 3:5684186-5684208 AGGTGGGGTGGGAGGGCAGGTGG + Intergenic
950128838 3:10527943-10527965 CGGTGAGGAGGGAGGTGGGGTGG + Intronic
950483644 3:13260164-13260186 CGTGGAGGAGGAAGGGAAGAGGG + Intergenic
950947415 3:16964163-16964185 TGGGGAGGGGGGAGGGGAGAGGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952343650 3:32465477-32465499 TGGTGAGGGGAGAGGTCAGATGG + Intronic
952930817 3:38359885-38359907 GGGTGAGGTGGGTGGGGAGAGGG + Intronic
952969019 3:38639025-38639047 GGGTGAGGTGGGAGGCCAGGCGG - Intronic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953508395 3:43509218-43509240 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
953526243 3:43691642-43691664 CGGGAAGGAGGGAGGGGAGAAGG + Intronic
953878470 3:46679512-46679534 GGGTGAGGAGCCAGGGCGGAGGG - Intronic
954361899 3:50126574-50126596 CCTTGGGGAGGGAGGACAGATGG - Intergenic
954633659 3:52059922-52059944 CGATGAGAAGGGATGGCAGGAGG - Intergenic
954638043 3:52082167-52082189 GGGTGAGGAGGGAAGGAAGAGGG + Intronic
954787329 3:53103617-53103639 GGGTGAGGGAGGAAGGCAGAGGG - Intronic
955012014 3:55026704-55026726 GGGTGAGGAGAGATGACAGAGGG + Intronic
955085029 3:55694293-55694315 CGGGAAGTAGGAAGGGCAGATGG - Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956465979 3:69521123-69521145 CAGTGAGGAGGGACCCCAGATGG + Intronic
956621006 3:71221501-71221523 AGGAAAGAAGGGAGGGCAGAAGG - Intronic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956834668 3:73086827-73086849 CCATGAGGAGGAAGGGGAGAGGG + Intergenic
957327827 3:78718881-78718903 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
960345980 3:116533638-116533660 TGGGGAGAAGGGAGGGGAGAGGG + Intronic
960357784 3:116674832-116674854 CAGTGAAGAGGGAGGACAAAAGG - Intronic
960388718 3:117050944-117050966 CGGGGTGGAGGCCGGGCAGAGGG - Intronic
961651361 3:128418184-128418206 AGGTGAGGAGGGGGTGCTGAGGG - Intergenic
961651553 3:128419069-128419091 TGGTGAAGAGTGAGGGCAGTGGG + Intergenic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
961954299 3:130785436-130785458 CTCTGAGGAGGTAGGGCAGGTGG - Intergenic
962265475 3:133941535-133941557 AGGACAGGAGGGAGGGCAGTGGG + Intronic
962848414 3:139290126-139290148 CAGGGAGGTGGGAGGGCAAAAGG - Intronic
964225048 3:154388964-154388986 AGGTGAGGAGGAAGAGCAAATGG + Intronic
965373888 3:167897609-167897631 AGGAGAGGAGGGAGGGGAGGGGG + Intergenic
965373902 3:167897633-167897655 AGGGGAGGAGGGAGGGGAGGGGG + Intergenic
965652238 3:170946824-170946846 GAGAGAGGAGGGAGGGAAGAGGG + Intergenic
965652262 3:170946902-170946924 GAGAGAGGAGGGAGGGGAGAGGG + Intergenic
966315993 3:178645779-178645801 AGGTGGGGAGGGAGAGCATATGG + Intronic
966886492 3:184380279-184380301 TGGGGAGGAGGGAGGGAGGAGGG - Exonic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
967977661 3:195044509-195044531 GGGTGAGGAGGGACTTCAGAGGG - Intergenic
968118915 3:196110730-196110752 CTGTGAGGAGGCAGGGCTGCAGG - Intergenic
968602521 4:1517072-1517094 CCCTGAGGAGGGGTGGCAGAGGG - Intergenic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968647811 4:1749026-1749048 CGGTGGGGAGGGAGAGCGGTGGG - Intergenic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968889335 4:3359287-3359309 AGGGGAGGAGGGAGAGGAGAGGG - Intronic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969093746 4:4717002-4717024 CGGGGAGGTGGGTGGGCAGCTGG + Intergenic
969310366 4:6349521-6349543 GGAGGAAGAGGGAGGGCAGATGG - Intronic
969454742 4:7294775-7294797 AGGGGAGGAGGGAGGGGAGGGGG - Intronic
969454840 4:7295015-7295037 GGGGGAGGAGGGAGAGGAGAAGG - Intronic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969495309 4:7523026-7523048 GAGGGAGGAGGGAGGGAAGAGGG - Intronic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
969670061 4:8585177-8585199 TGGAGACGGGGGAGGGCAGATGG + Intronic
969690456 4:8701439-8701461 GGGTGAGGAGAGAGGGAGGAGGG - Intergenic
969936520 4:10687525-10687547 GGAAGAGGAGGGAGGGGAGAAGG + Intergenic
970021607 4:11575411-11575433 AGGTGAGGAGGAAGAGCAGAGGG + Intergenic
970444508 4:16112677-16112699 AGGGGAGGAGGGAGGGGAGGAGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970960991 4:21871235-21871257 CGGGGAGGGGGGAGGGGGGAGGG - Intronic
971594742 4:28514723-28514745 CGGGGTGGTGGGCGGGCAGAGGG + Intergenic
972304813 4:37820755-37820777 CGGGGTGGTGGCAGGGCAGAGGG - Intergenic
972378604 4:38497841-38497863 AGGGAAGGAGGGAGGGAAGAAGG + Intergenic
972662620 4:41130776-41130798 TGGAGAGAAGGGAGGGCGGATGG - Intronic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
972904652 4:43729673-43729695 GGGTCGGGAGGGAGGGGAGAGGG + Intergenic
973113647 4:46427599-46427621 AGGAAAGGAGGGAGGGAAGAAGG - Intronic
974021138 4:56693386-56693408 CGGGGTGGAGGCCGGGCAGAGGG + Intergenic
974409240 4:61517529-61517551 CGGTGGGGAGAGAGGGCTGGGGG + Intronic
975139343 4:70903393-70903415 CGTGGAGGGGGAAGGGCAGAAGG + Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977023390 4:91786166-91786188 TGGGGTGGAGGGAGGGCGGAGGG - Intergenic
977293867 4:95191527-95191549 TGGTGGGGAGGGTGAGCAGAGGG - Intronic
977805157 4:101288600-101288622 GGGGAAGGAGGAAGGGCAGAAGG + Intronic
977919214 4:102625171-102625193 AGGTGAGGAGGAAGGGTGGAAGG - Intergenic
978147997 4:105399707-105399729 CTGTTAGGAGGCAGGGGAGAGGG + Intronic
978431220 4:108635057-108635079 CAGTGAGGAGGGTGGCCATAAGG + Intergenic
978633314 4:110773205-110773227 CTTTGAAGAGGGAGGGCAAAAGG - Intergenic
979402224 4:120262451-120262473 GGGTGAGGAGGAAGGGTAGTGGG + Intergenic
979468986 4:121072588-121072610 CGGTGAGGCGGGAGGGGTTAGGG - Intronic
979679522 4:123444424-123444446 TGGGGAGGAAGGAGGGCAAAAGG - Intergenic
980243510 4:130206911-130206933 GGGAGAGGAGGGAGGGGAGAGGG - Intergenic
980472532 4:133267766-133267788 CGAGGAGGAGAGAGGTCAGATGG + Intergenic
980987557 4:139710535-139710557 CGGGGTGGAGGGAGGGCACAGGG - Intronic
981785237 4:148470190-148470212 GAATGAGGAGGCAGGGCAGACGG + Intergenic
982169082 4:152643912-152643934 GGGAGAGGAGGGAGGGAAGGAGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982816632 4:159893933-159893955 CGGTGAGGTTGGAGGGCAAAAGG + Intergenic
982916500 4:161216704-161216726 TGGTGAGGAGGTAGGGAAAATGG + Intergenic
983525144 4:168753325-168753347 GGGGAAGGAGGGAGGGAAGAAGG - Intronic
985637079 5:1041344-1041366 CAGTGATGAGTGAGGGCTGAGGG + Intergenic
985658048 5:1142282-1142304 GGGCGAGGGGGGAGGGGAGAGGG - Intergenic
985658064 5:1142315-1142337 GGGAGAGGAGAGAGGGGAGAGGG - Intergenic
985937198 5:3106432-3106454 GGGAGGGGAGGGAGAGCAGAGGG - Intergenic
986015200 5:3751542-3751564 GGGTGAGAAGGGAGGGTGGAGGG + Intergenic
986037006 5:3950182-3950204 CGGGGAGGAGGCAGGGCTGCAGG + Intergenic
986263674 5:6173804-6173826 GGGGGAGGAGGGAGGGGGGAGGG - Intergenic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
987116093 5:14728120-14728142 AAGTGCGGAGGGAAGGCAGAGGG + Intronic
987219812 5:15779196-15779218 AGGTGAGGAAGGAGGGATGAAGG + Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989136496 5:38161189-38161211 AGGGAAGGAGGGAGGACAGAAGG + Intergenic
990626138 5:57613359-57613381 AGGGCAGGAGGGAGGGAAGAAGG + Intergenic
990717666 5:58656716-58656738 AGGTGAGGAGAGGGGACAGAGGG + Intronic
990822430 5:59857847-59857869 AGGAAAGGAGGGAGAGCAGAAGG + Intronic
991724141 5:69519294-69519316 CTGAGAGGTGGGAGGGCAGGAGG - Intronic
992029312 5:72705213-72705235 GGGTGGGGAGGGAGGGTAAAGGG + Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
992705433 5:79386909-79386931 AGGGGAGGAGGGAGGGAGGAAGG - Intronic
993525737 5:88963448-88963470 GGGGGAGGGGGGAGGGGAGAGGG + Intergenic
994860616 5:105187692-105187714 TGGGGTGGGGGGAGGGCAGAAGG + Intergenic
996050805 5:118930866-118930888 TGGAGAGGACGGAGGGCATAGGG + Intronic
996087368 5:119318714-119318736 TGGTGAGGAGGAAGGGGAGGAGG - Intronic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996810074 5:127506781-127506803 CGGTAGGGAGTGAGGGCTGAAGG + Intergenic
997284306 5:132667538-132667560 TGGGGAGGAGGCAGGGGAGAGGG - Intergenic
997499142 5:134357741-134357763 AGGAGAGGAAGGATGGCAGAGGG - Intronic
997887522 5:137643873-137643895 AAGGGAGGAGGGAGGGGAGATGG - Intronic
998136313 5:139676337-139676359 TGGGGAGGAGGGTGGGGAGAAGG - Intronic
998136743 5:139678085-139678107 GGGTGAGGGGAGAAGGCAGAAGG - Intronic
998203989 5:140146242-140146264 CGGAGGGGAGGGAGGGGAGCTGG - Intergenic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998393282 5:141801647-141801669 GACTGAAGAGGGAGGGCAGAGGG - Intergenic
998490089 5:142539411-142539433 AGGGGAGGAGGGAGGGGAGGAGG - Intergenic
998954901 5:147428812-147428834 CGGGGAGGAGGGAGAGCATCAGG + Intronic
999205857 5:149847425-149847447 GGGTGAAGAGGCAGGGAAGAGGG - Intronic
1000820648 5:165979047-165979069 GGGTTGGGAGGGAGGACAGAAGG - Intergenic
1000984876 5:167855796-167855818 AGGAAAGGAGGGAGGGAAGAAGG + Intronic
1001035076 5:168291734-168291756 CGGAGAGGAGGGACGGCACCCGG + Intronic
1001313021 5:170624724-170624746 CGGGGAGGTGGGGGGGGAGAGGG + Intronic
1001316281 5:170643430-170643452 CAGAGAGGAGGGAGGGCATCAGG - Intronic
1001698531 5:173690283-173690305 CCGTGATGTGGGAGGGCAAAGGG + Intergenic
1001806504 5:174591313-174591335 CGGAGAGGAGAGAAGGCAGGTGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002239634 5:177829406-177829428 CGAAGAGGAAGGAGGGCAGGAGG - Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1003376655 6:5584542-5584564 CGGGAAGGAGAGAGGGAAGAGGG - Intronic
1003458440 6:6306660-6306682 AGGTGGGGTGGGAGGGTAGAAGG + Intronic
1003812230 6:9796910-9796932 AGGGGAGGAGGGAGGGAAGGAGG + Intronic
1004396292 6:15248673-15248695 GGGGGCGGAGGGAGGGAAGAAGG - Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004653077 6:17630742-17630764 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005599463 6:27411860-27411882 AAGTGAGGAGGGAGGGCGGCTGG - Intergenic
1005765280 6:29005349-29005371 CTGGGAGGAGGTAGGGCAAATGG + Intergenic
1005824552 6:29624925-29624947 CAGTGGGGAGCCAGGGCAGAGGG + Intronic
1006088863 6:31616079-31616101 GGGTGAGGGGAGAGAGCAGAAGG - Intronic
1006132492 6:31877823-31877845 CACTGAGGAGGGAGAGCCGAGGG + Intronic
1006620758 6:35362416-35362438 TGGTGAGTAGGCAGAGCAGATGG - Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006908084 6:37546278-37546300 TGGTGAGGGGGAAGGGAAGAGGG - Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007139484 6:39556290-39556312 TGGTGAGGTGGGAGTGGAGAAGG + Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1007732320 6:43954692-43954714 GGGGGAGGGTGGAGGGCAGAGGG - Intergenic
1008362335 6:50635541-50635563 AGGGGAGAAGGGAGGGGAGAAGG + Intergenic
1008679333 6:53855840-53855862 TGATGAGGAGGAAGAGCAGAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009783209 6:68296887-68296909 TGGGGAGGAGTGAGGGCATAAGG + Intergenic
1009804010 6:68578779-68578801 AGGGGAGGAGGAAGGGCGGAAGG + Intergenic
1010342368 6:74769337-74769359 TGGGTAGGAGTGAGGGCAGAGGG + Intergenic
1011297413 6:85839149-85839171 CGGGGTGGTGGCAGGGCAGAGGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1013612972 6:111812261-111812283 CTGGGAGGAGGCAGGGCAGATGG + Intronic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1015876879 6:137831339-137831361 TTGTGAGGAGGGGGAGCAGAGGG + Intergenic
1016984608 6:149885589-149885611 AGGTCAGGAGGGAGGGCATCAGG - Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017505426 6:155064813-155064835 CGATGAGGAGGGAAGGGAAAGGG - Intronic
1017706807 6:157131409-157131431 AGGTGTCGAGGGAGGGCTGAGGG + Intronic
1017927834 6:158925289-158925311 AGGGAAGGAGGGAGGGAAGAAGG + Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018368453 6:163145903-163145925 CGGTGAGGAGAGAGAGCTGCTGG + Intronic
1018400477 6:163415123-163415145 CGGAGAGGAGGGAGGGGCGGGGG - Exonic
1018681618 6:166270185-166270207 GGGTGAGCAGGGAGGACAGGAGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018747440 6:166773250-166773272 GGGTGAGGAGAGGGGGAAGAGGG + Intronic
1018767368 6:166944909-166944931 GGGTGAGGGGGCAGGGCTGACGG - Intronic
1018873329 6:167799453-167799475 CTGTCAGGAGGGAAGCCAGATGG - Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1019040039 6:169096153-169096175 GGGTGAGGAGGGAGGAGGGATGG - Intergenic
1019267055 7:123529-123551 CGGGGTGGAGGGACGGCATAGGG + Intergenic
1019299201 7:295131-295153 AGGTGAGGATGGTGTGCAGAGGG + Intergenic
1019313924 7:376020-376042 AGGGGAGGAGGGAGGGCACCGGG + Intergenic
1019521649 7:1463407-1463429 AGGGGAGGAGGGAGGGGAGAAGG + Intergenic
1019564962 7:1674591-1674613 CAGTGAGGGGGGTGGGGAGAGGG + Intergenic
1019573622 7:1725450-1725472 CGGGAGGGAGGGAGGGCAGCAGG + Intronic
1020007416 7:4789987-4790009 AGGGGAGGGGGGAGGGGAGAGGG - Intronic
1020011346 7:4807519-4807541 GAGAGAGGAGGGAGGGGAGACGG - Intronic
1020011379 7:4807621-4807643 GCGGGAGGAGGGAGGGGAGACGG - Intronic
1020092894 7:5351187-5351209 TGGGGAGGAGGGAGGGGAGGAGG + Intronic
1020227020 7:6288444-6288466 AGGGGAGGAGGGAGGGAAGAAGG - Intergenic
1020320339 7:6935015-6935037 CGGTGAGCAGGGTGGGCTCATGG - Intergenic
1020372662 7:7451046-7451068 AGGAGAGAAGGGAGGGCAGTGGG + Intronic
1020666272 7:11047799-11047821 AGAAGAGGAGGGAGGGCAGGAGG + Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021747930 7:23762227-23762249 CGGGGTGGAGGGAGGGGGGAGGG - Intronic
1022427417 7:30282705-30282727 GGGTGAGGAGAGAGGAAAGAAGG + Intergenic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023619473 7:42055327-42055349 TGGGGAGGAGGAAGAGCAGATGG - Intronic
1024116380 7:46197658-46197680 AGGGCAGGAGGAAGGGCAGAGGG - Intergenic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1024245001 7:47462794-47462816 CGGGGAGGAATCAGGGCAGAGGG - Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024331201 7:48156995-48157017 GTGTCAGGAGGGAAGGCAGATGG + Intergenic
1024814517 7:53253259-53253281 CACTGATGTGGGAGGGCAGAAGG + Intergenic
1026023739 7:66729471-66729493 AGGTGAGGATGGAGAGCAGGAGG - Intronic
1026112105 7:67466477-67466499 CGGGAAGGAGGGAGGGAGGAAGG - Intergenic
1026375108 7:69742127-69742149 TTTTGAGGGGGGAGGGCAGATGG + Intronic
1026569951 7:71520745-71520767 GCTTGAGGTGGGAGGGCAGATGG + Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026930208 7:74219639-74219661 GGATGAGGAGGGAAAGCAGAGGG - Intronic
1026984435 7:74546080-74546102 GGGTGAGGGCGGAGGGCTGAGGG - Intronic
1027231221 7:76273846-76273868 AGGTGAAGAAGGAGGGGAGATGG - Intronic
1027253043 7:76411092-76411114 AGGGGAGGAGGGAGGGAGGAAGG - Intronic
1027902630 7:84136943-84136965 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029274708 7:99397235-99397257 TGGTGAGGAGGCAGGACAGATGG + Intronic
1029316220 7:99716996-99717018 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029321880 7:99769587-99769609 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029412820 7:100426791-100426813 GGGGGAGGAGGGAGGGAAGAGGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029598665 7:101551028-101551050 CGGGGAGGGGGGTGGCCAGAGGG + Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029941463 7:104484748-104484770 CCATGAGGGGGGAAGGCAGAAGG + Intronic
1030121201 7:106112281-106112303 CGGTGGCGAGGAAGGGCAGGCGG + Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1031049959 7:116934994-116935016 CAGGGAGGAAGAAGGGCAGAGGG - Intergenic
1031056470 7:116997985-116998007 TGCTGAGGAGCGAGGGCACACGG - Intronic
1031866152 7:127040036-127040058 GGGTGAGGAGGGTGGGGAGGAGG + Intronic
1031866170 7:127040077-127040099 GGGGGAGGAGGGAGGGGAGGAGG + Intronic
1031966702 7:128032309-128032331 CGGGGAGGGGGGAGGGGGGAGGG - Intronic
1032016552 7:128383833-128383855 GGGGCAGGAGGGAGGTCAGAGGG + Intergenic
1032464881 7:132137868-132137890 AGGAGAGAAGGGAGGGCAGGTGG + Intronic
1032665356 7:134030672-134030694 GGGTGAGCTGGGGGGGCAGAGGG - Intronic
1032746316 7:134790141-134790163 GGAAGAGGAGGGAGGGGAGAAGG + Intronic
1032928414 7:136636803-136636825 GGGTGAGGGGAGAGGGGAGAGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033405937 7:141072024-141072046 TGCCGAGGAGGGAGGGCAGGTGG + Intergenic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1034889756 7:154829462-154829484 GAGGGAGGAGGGAGGGAAGAAGG + Intronic
1034942890 7:155243348-155243370 TAGTAAGGAGGGAGTGCAGAAGG + Intergenic
1035087035 7:156269103-156269125 TGGGGAGGAGGGATGGGAGAGGG + Intergenic
1035174025 7:157037733-157037755 GGGAGAGGGGAGAGGGCAGAGGG + Intergenic
1035181565 7:157093113-157093135 CGGTGAGGACAGAGGTAAGATGG - Intergenic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035435891 7:158858912-158858934 AGGGGAGGGGGGAGGGGAGAGGG - Intronic
1035902383 8:3471536-3471558 GGGAGAGGAGGGAGGGATGAAGG - Intronic
1036197517 8:6733327-6733349 AGGAGAGGAGGGAAGACAGAGGG - Intronic
1037085764 8:14847696-14847718 AGGAGAGGAGGGAGGGGAGGAGG + Intronic
1037098014 8:15008706-15008728 AGGGGAGGAGGGAGGGGAGGAGG + Intronic
1037772414 8:21810349-21810371 CAGTGAGGGGGGTGGGCAGAGGG - Intronic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1037901801 8:22693078-22693100 GGGGGAGGGGGGAGGGAAGAAGG + Exonic
1038412498 8:27369131-27369153 TGGGGAAGAGGGAGGGCATAAGG - Intronic
1038450005 8:27633855-27633877 CGGGAAGGAGGGAGGGAGGAAGG + Intronic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1038911240 8:31967249-31967271 CGTGGAGGAGGGAGGGGAGAAGG - Intronic
1038942000 8:32315232-32315254 CTGTCAGGGGGGTGGGCAGAGGG - Intronic
1039669945 8:39584628-39584650 CAGTGAGGAGGGCGAGGAGAAGG - Exonic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043322686 8:79009443-79009465 GGGGAAGGAGGGAGGGAAGAGGG - Intergenic
1043844977 8:85152988-85153010 GGCTGAGGAGTGCGGGCAGATGG + Intergenic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1045026035 8:98087606-98087628 GGGAGGGGAGGGAGGGCAAAAGG - Intronic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045507447 8:102788813-102788835 AGGTGAACAGGGAGGGAAGAGGG - Intergenic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1046320189 8:112564326-112564348 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1048222264 8:132552759-132552781 GACTGAGGCGGGAGGGCAGAGGG + Intergenic
1048336182 8:133504107-133504129 AGGTGGGGAGGGAGGGCATCTGG + Intronic
1048575976 8:135690446-135690468 GGCTGAGGAGTGAGGGCACACGG - Intergenic
1048764331 8:137828894-137828916 CGGGGAGGTGAGAGGTCAGATGG + Intergenic
1048979671 8:139696638-139696660 AGGGAAGGAGGGAGGGAAGAAGG + Intronic
1049047376 8:140163555-140163577 CGGAGAGGGTGGCGGGCAGATGG + Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049256720 8:141618102-141618124 CGGGGAGGACGGAGCACAGATGG + Intergenic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049674027 8:143881846-143881868 GGGGGAGGAGGAAGGGGAGAAGG + Intergenic
1050100456 9:2113742-2113764 AGGTGAGGAAGCAGGGCACATGG - Intronic
1050151303 9:2621874-2621896 GGGAGAGGAGGGAAGGGAGAGGG - Exonic
1050710909 9:8462177-8462199 AAGTGAGGAGGAAGGGAAGAAGG - Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051615145 9:18999636-18999658 CGGTGTGGCGGCCGGGCAGAGGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052727083 9:32242041-32242063 AGGAGAGGAGGGAGGGCAGTGGG + Intergenic
1052942160 9:34138205-34138227 CGGGGAGGTGGCCGGGCAGAGGG - Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053329192 9:37188557-37188579 AGGTGAGGGGGGAGGGTAGGGGG - Intronic
1053605322 9:39652523-39652545 GGGGCAGGAGGGAGGGGAGATGG - Intergenic
1053886837 9:42650027-42650049 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054188168 9:61969050-61969072 GAGGGAGGAGGGAGGACAGAGGG - Intergenic
1054225856 9:62457477-62457499 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054248221 9:62689893-62689915 GGGGCAGGAGGGAGGGGAGATGG + Intergenic
1054562336 9:66724418-66724440 GGGGCAGGAGGGAGGGGAGATGG + Intergenic
1054903898 9:70397819-70397841 TGGTGAGGAGAGAAGCCAGATGG - Intronic
1055183661 9:73422775-73422797 AGGGGAGGAGGCAGGGGAGATGG + Intergenic
1055451234 9:76433216-76433238 CGAAGAGGGGGCAGGGCAGAGGG - Intronic
1055730308 9:79273930-79273952 AGGTAAGGAGGGAGGGAGGAAGG + Intergenic
1055796081 9:79976151-79976173 TGGCGTGGAGGAAGGGCAGAGGG + Intergenic
1055824501 9:80307147-80307169 AGGAGAGGAGGGAGGGAGGAGGG - Intergenic
1056137750 9:83646583-83646605 AGGGGAGGAGGGAGGGAAGGGGG + Intergenic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056869731 9:90266319-90266341 GGAGGAGGAGGGAGGGGAGAAGG - Intergenic
1056897693 9:90566350-90566372 TGGTGATGGGGGAGGGGAGATGG - Intergenic
1057723745 9:97554077-97554099 AGGTGGGGAGGGAGTGCACAAGG - Intronic
1057797510 9:98169390-98169412 TGGGGAGGAGGCAGGGCAGGAGG - Intronic
1058618979 9:106863544-106863566 GGGGGAGGAGGGAGAGCAGGAGG + Intronic
1059216063 9:112563705-112563727 GGGTGAGGAGGGAGGAGAAAAGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059283071 9:113151098-113151120 CGGTGAAGAGGGTGGGCGGTTGG + Intronic
1059372350 9:113852660-113852682 AAGTGAGGAGGGAGGGCCAATGG - Intergenic
1059719476 9:116945617-116945639 AGGAAGGGAGGGAGGGCAGAAGG - Intronic
1059774998 9:117465535-117465557 GGGTGAGGAGTGAGGGGAGAAGG + Intergenic
1059803498 9:117774032-117774054 AGGGGAGAAGGGAGGGGAGAAGG - Intergenic
1059910915 9:119043198-119043220 TGGTGAGGAGGGAAAGAAGAAGG - Intergenic
1060348524 9:122837636-122837658 CGGTCAGGAGAGAGGCCAGCTGG + Intergenic
1060551097 9:124485836-124485858 TGGTGGGGAGCGAAGGCAGATGG - Intronic
1060686873 9:125622808-125622830 CGGAGAGGGGAGAGGGGAGAGGG - Intronic
1060851803 9:126883368-126883390 CAGTGAGGAGGGAGGGCACCTGG + Exonic
1060960861 9:127679630-127679652 CGGAGAGGAGGGGGAGCAAAAGG - Intronic
1061181201 9:129026300-129026322 CAGTCAGGAGGGATGGGAGAGGG - Intronic
1061294100 9:129667609-129667631 GGGTGAGGAGGGAAGGAAGGGGG + Intronic
1061380007 9:130250069-130250091 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
1061588706 9:131584433-131584455 CCGTGAGGCAGGAGGGCAGGCGG + Intronic
1061774045 9:132948794-132948816 TGGTGCGGAGGGAGAGGAGACGG - Intronic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062121889 9:134838345-134838367 AGGTGTGAAGGGAGCGCAGAGGG + Intronic
1062144574 9:134981884-134981906 CAGGGAGGAGGGACGGCAAAAGG + Intergenic
1062216843 9:135393914-135393936 CGGTGCAGTGGGAGGGCACAGGG - Intergenic
1062238532 9:135524026-135524048 GAGGGAGGAGGGAGGGCAGGTGG - Intronic
1062328270 9:136023115-136023137 GGGGGAGGAGGGAGGGAGGAAGG + Intronic
1062389175 9:136327355-136327377 CGGGGAGGGGGGAGGGGGGAGGG - Intergenic
1062421123 9:136483228-136483250 CGGCGAGGGGCGGGGGCAGAGGG - Intronic
1203463749 Un_GL000220v1:67883-67905 CGGGGTGGTGGCAGGGCAGAGGG + Intergenic
1203464872 Un_GL000220v1:75875-75897 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186374293 X:8981685-8981707 CGGTGAGGAGGAAGAGTAGTAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187173047 X:16870216-16870238 CGGGGAGGAGGCAGGAAAGAAGG - Intronic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1188368153 X:29335273-29335295 CGGAGAGGGGAGAGGGGAGAGGG + Intronic
1188727800 X:33607156-33607178 CAGGGAGCAGGGAGGGCTGAGGG - Intergenic
1188945028 X:36290051-36290073 CGGGGAGGAGGAAGAGAAGAGGG - Intronic
1189251292 X:39602261-39602283 CGGGGAGGAGGGAGGCTGGAAGG + Intergenic
1189446372 X:41085212-41085234 CGGGGTGGAGGGAGAGAAGAGGG + Intergenic
1189534428 X:41922824-41922846 GGGGAAGGAGGGAGGGCAGGGGG + Intronic
1192149223 X:68701635-68701657 GGGTGGGGAGGGAGTGCAGGAGG + Intronic
1192770635 X:74185943-74185965 CAGTGAAGAGGAAGGGCAAAAGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1195543206 X:106086694-106086716 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195636702 X:107125105-107125127 GGGTGAGGAGGAAGAGGAGAGGG - Intronic
1195679492 X:107533568-107533590 CAGTCAGGAGGAAGGGCAGATGG - Intronic
1195923247 X:110002844-110002866 CGGGGAGGAGGGAGGGGGGCCGG + Intronic
1196237554 X:113299998-113300020 AGGGGAGAAGGGAGGGGAGACGG - Intergenic
1196363588 X:114897545-114897567 CGGTGAGGACGGAGGGCATTAGG - Intronic
1196381792 X:115098850-115098872 CGGTGAGGAGGGATGGGTCAGGG - Intergenic
1196738355 X:119000889-119000911 AGGAGAGGAGGGAGGGGAGAAGG - Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197732438 X:129822460-129822482 GGGTGAGGAGGGAGGGCATTAGG + Intronic
1197816600 X:130504668-130504690 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
1197816622 X:130504747-130504769 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
1197816644 X:130504826-130504848 AGGGAAGGAGGGAGGGAAGAAGG - Intergenic
1198223586 X:134625225-134625247 GGTTTAGGAGGGAAGGCAGAGGG + Intronic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198369201 X:135974254-135974276 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369213 X:135974278-135974300 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369225 X:135974302-135974324 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369301 X:135974473-135974495 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198472493 X:136960568-136960590 TGGGGAGGTGGGATGGCAGAAGG + Intergenic
1198954725 X:142115960-142115982 TGGTGAGGAGGCAGGCAAGATGG + Intergenic
1198954826 X:142117225-142117247 TGGTGAGGAGGCAGGCAAGATGG + Intergenic
1199846436 X:151695362-151695384 CGGGGCGGTGGGAGGGCAGCGGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200205404 X:154312000-154312022 TGGTGTGGAGGGAGGCCAGCTGG - Intronic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic
1201438678 Y:13985725-13985747 TGGTGAGGAGGGAGGGAGGGGGG - Intergenic
1201445895 Y:14056983-14057005 TGGTGAGGAGGGAGGGAGGGGGG + Intergenic
1201685650 Y:16699016-16699038 CGGTGGGGAGGGAGAGCACTAGG + Intergenic