ID: 948922718

View in Genome Browser
Species Human (GRCh38)
Location 2:241073269-241073291
Sequence CTCGAGCTGCGCCGAGGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948922718_948922723 2 Left 948922718 2:241073269-241073291 CCACAGCCTCGGCGCAGCTCGAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 948922723 2:241073294-241073316 CATGGAGGAAGCCCCCAAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 208
948922718_948922724 11 Left 948922718 2:241073269-241073291 CCACAGCCTCGGCGCAGCTCGAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 948922724 2:241073303-241073325 AGCCCCCAAGCGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
948922718_948922722 1 Left 948922718 2:241073269-241073291 CCACAGCCTCGGCGCAGCTCGAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 948922722 2:241073293-241073315 ACATGGAGGAAGCCCCCAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948922718 Original CRISPR CTCGAGCTGCGCCGAGGCTG TGG (reversed) Exonic
900535215 1:3173653-3173675 CGTGGGCTGCGCAGAGGCTGGGG + Intronic
900604654 1:3518562-3518584 GGCGGGCTGCGCCGAGGCAGGGG + Intronic
900622273 1:3592947-3592969 CCCGGGCTGGGCTGAGGCTGGGG - Intronic
901192681 1:7421952-7421974 CTCTCGGTGCGCCGTGGCTGGGG + Intronic
901232827 1:7650699-7650721 TTCGAGGAGCGCAGAGGCTGAGG - Intronic
901663001 1:10810439-10810461 CACCAGCTGCCCGGAGGCTGGGG + Intergenic
903328819 1:22586541-22586563 CTGGAGCTGCGGAGTGGCTGTGG - Exonic
903442342 1:23397517-23397539 CTTGAACTGTGCCGGGGCTGTGG - Intronic
905943865 1:41885547-41885569 TTCCAGCTACGCGGAGGCTGAGG + Intronic
907258234 1:53196682-53196704 GACGAGCAGCGCGGAGGCTGGGG + Exonic
915268827 1:154737804-154737826 CCCCAGCTGCTCGGAGGCTGAGG + Intronic
917929335 1:179812983-179813005 CTGGAACTGCCCCGAGGCTGGGG - Intronic
918248035 1:182677601-182677623 CTCCAGCTGCTCAGTGGCTGGGG + Intronic
920331475 1:205211441-205211463 CGCGAGCTGTGCCGGGGCTTCGG - Exonic
1067524373 10:47029332-47029354 CTGGGGCTGCACAGAGGCTGTGG - Intergenic
1068945431 10:62724558-62724580 TTCCAGCTACTCCGAGGCTGAGG + Intergenic
1073105706 10:101031150-101031172 CCCACGCTGCGCGGAGGCTGCGG + Intronic
1073131154 10:101190046-101190068 CCTGAGCTGAGCTGAGGCTGGGG + Intergenic
1075454674 10:122577457-122577479 CTTGAGCTGCGATGAGTCTGAGG - Intronic
1075766650 10:124898731-124898753 CTGGAGCATCGGCGAGGCTGGGG + Intergenic
1077436564 11:2542200-2542222 CTGGGGCTGTGCCGAGGGTGTGG + Intronic
1078243050 11:9547938-9547960 TTCTAGCTGCTCAGAGGCTGAGG + Intergenic
1079109428 11:17596164-17596186 CTCGGGAGGAGCCGAGGCTGGGG - Intronic
1083610394 11:64001489-64001511 CTGGAACTGTGCCGAGACTGAGG - Intronic
1089404056 11:118182795-118182817 CTCAAACTTCGCCCAGGCTGGGG + Intergenic
1090063203 11:123481336-123481358 TTCCAGCTACTCCGAGGCTGAGG + Intergenic
1100545707 12:95600045-95600067 TTCCAGCTACGCGGAGGCTGAGG + Intergenic
1102341063 12:112121998-112122020 CTTGAGCGGGGCTGAGGCTGCGG + Intergenic
1102539706 12:113609994-113610016 CTCGGGCTGGGCGGAGGCCGAGG + Intergenic
1109992955 13:70082822-70082844 CTCCAGCTGCACCCATGCTGTGG - Intronic
1110384043 13:74887889-74887911 CTGGAGCTGAGCAGGGGCTGAGG - Intergenic
1112437347 13:99399782-99399804 CTTGAGATGTGCGGAGGCTGGGG - Intergenic
1112653766 13:101426575-101426597 TTCCAGCTACTCCGAGGCTGAGG - Intergenic
1114411674 14:22506451-22506473 CTGGAGCTGGGCCCAGGATGAGG + Intergenic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1123697902 15:22892158-22892180 CCCCAGCTCCGCTGAGGCTGGGG + Intronic
1125462411 15:39919954-39919976 CGCGTCCGGCGCCGAGGCTGCGG - Exonic
1127807923 15:62538103-62538125 CTCCAGCTACTCAGAGGCTGAGG + Intronic
1129356492 15:74995569-74995591 CGCGAGCCGCTCCGGGGCTGGGG - Intronic
1129381990 15:75173899-75173921 CTCCAGCTACTCAGAGGCTGAGG - Intergenic
1129815509 15:78549436-78549458 CTCAAGCTGCGCGGAAGATGAGG + Exonic
1132685641 16:1160935-1160957 CCAGGGCTGCACCGAGGCTGGGG - Intronic
1133221767 16:4321981-4322003 CTGGAGCTGCACACAGGCTGTGG - Intronic
1134901808 16:17944749-17944771 CTCCAGCGAGGCCGAGGCTGAGG + Intergenic
1135135768 16:19884699-19884721 TGCGAGCTGCGCCGATGCAGTGG - Intronic
1137586109 16:49664741-49664763 CTGGAGCTGTGCCCTGGCTGTGG - Intronic
1141354623 16:83333504-83333526 CTTGACCTGTGACGAGGCTGTGG + Intronic
1141599794 16:85118750-85118772 CACAAACTGCTCCGAGGCTGGGG - Intergenic
1143145555 17:4772829-4772851 TTCCAGCTGCTCGGAGGCTGAGG - Intronic
1144207952 17:12992668-12992690 ATGGAGCTGTGCCGAGGCTTGGG - Exonic
1144709189 17:17389095-17389117 CTGGAGCTGAGACAAGGCTGCGG - Intergenic
1147028183 17:37607838-37607860 TCCCAGCTGCTCCGAGGCTGAGG + Intronic
1147338510 17:39740591-39740613 CTGGAGCTAGGCCGAGGGTGGGG + Intronic
1151537630 17:74747953-74747975 CTGGAGCTGCACCCAGGCTTTGG + Intergenic
1151812494 17:76452826-76452848 CTCGGGGTGCTCCGAGGCCGGGG - Exonic
1152563648 17:81090736-81090758 CCCGAGCTGCGGGGAGGCTGCGG + Intronic
1152609903 17:81310297-81310319 CTCCAGCTGCGCAGGGGCCGGGG + Intergenic
1153772768 18:8428840-8428862 CTGGAGCTGCCCTGAGGCAGAGG - Intergenic
1154032763 18:10767737-10767759 CCAGAGCTGCTCCAAGGCTGCGG + Intronic
1154174494 18:12076560-12076582 CTCGCGCTGCTGGGAGGCTGCGG - Intergenic
1157492948 18:48136765-48136787 CAGGAGCTCCGGCGAGGCTGGGG + Intronic
1157550220 18:48576131-48576153 CCCGAGAGGCGCCGAGGATGGGG + Intronic
1157580325 18:48770464-48770486 CTCTAGATGTGCAGAGGCTGAGG + Intronic
1158277087 18:55780371-55780393 TGCGGGCTGCGCGGAGGCTGCGG - Intergenic
1160557123 18:79733261-79733283 CCCGTCCTGTGCCGAGGCTGCGG - Intronic
1161293877 19:3509747-3509769 CTCAAGGTGCGTCTAGGCTGTGG + Intronic
1161771983 19:6235801-6235823 CTCTGGCTGCACCGAGGATGTGG - Intronic
1165454023 19:35900480-35900502 CTGGCGCAGCGCCGAGGCCGCGG - Exonic
1166299340 19:41905236-41905258 CTCGGGCTGGGCCGGGGCTTAGG - Exonic
1167995616 19:53399647-53399669 CTTGATCTGTGCCCAGGCTGGGG - Intronic
927751326 2:25673282-25673304 CTCGCGCTGCGCCGGGACTGGGG - Intronic
931338873 2:61378787-61378809 CGCGAGCTACTCAGAGGCTGAGG + Intronic
940388191 2:153099003-153099025 TTCGAGCTACTCCGAGGCTGAGG + Intergenic
940974123 2:159924464-159924486 CCTGAGCTGCGAGGAGGCTGGGG + Intergenic
942850178 2:180474922-180474944 CTCCAGCTGCCCTGAGGCTAGGG - Intergenic
946467063 2:219921356-219921378 TTCCAGCTGCGTCCAGGCTGAGG - Intergenic
947665728 2:231904328-231904350 CTCCTCCTCCGCCGAGGCTGGGG - Intergenic
947797050 2:232901309-232901331 CTCGAGCTTTGCTGAGGGTGGGG - Intronic
948199490 2:236119577-236119599 CTGGAGCTGGGCCGGGGGTGGGG - Intronic
948922718 2:241073269-241073291 CTCGAGCTGCGCCGAGGCTGTGG - Exonic
1171123619 20:22584573-22584595 GCCGAGCTGCCCCGAGGCGGCGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171721129 20:28564268-28564290 CTGTAGCTGTGCCAAGGCTGTGG + Intergenic
1171756939 20:29119288-29119310 CTGCAGCTGTGCCAAGGCTGTGG - Intergenic
1171862993 20:30418553-30418575 CTGCAGCTGTGCCAAGGCTGTGG - Intergenic
1172032602 20:31992414-31992436 CTGGAGCTGCTCAGAAGCTGAGG + Intronic
1173606771 20:44337246-44337268 CTCGGGCTGGGCCGGGGCTGGGG - Exonic
1175815866 20:61882946-61882968 CAGGAGATGCGCAGAGGCTGGGG - Intronic
1183606882 22:38871418-38871440 CCCGTGCTGTGCCGGGGCTGGGG + Intronic
950039469 3:9910782-9910804 CTCCAGCTGCCCCCAGGATGTGG + Intronic
952088398 3:29854148-29854170 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
954462709 3:50636852-50636874 CTGGACCTGGGCCCAGGCTGAGG + Intronic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
963588206 3:147221900-147221922 CAAGAGCTGCCACGAGGCTGAGG + Intergenic
968602013 4:1513893-1513915 CTCCAGCTGCTCCAAGGCTCAGG - Intergenic
968701020 4:2058516-2058538 TTCGAGAAGCGCCGAGGATGGGG + Intergenic
976431415 4:84966528-84966550 CCCGAGGAGCGCCGAGGCTGAGG - Intergenic
981089589 4:140718997-140719019 TTCCAGCTGCTCGGAGGCTGAGG + Intronic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
983398498 4:167233928-167233950 CGCGCGCTGCTCCGAGGCGGGGG - Intronic
985003320 4:185506625-185506647 CTCGGGGGGCACCGAGGCTGTGG + Exonic
985697296 5:1347846-1347868 CCCGAGCTGAGCTGAGCCTGGGG - Intergenic
987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG + Exonic
1001328396 5:170745605-170745627 CTCCAGTTGCTCAGAGGCTGGGG + Intergenic
1003595215 6:7468603-7468625 CCCCAGCTGCGAGGAGGCTGCGG - Intergenic
1007432727 6:41786139-41786161 CTGGCGCTGCACCGAGGCGGAGG + Exonic
1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG + Exonic
1007473382 6:42104764-42104786 CGCGCGCTACGCCGGGGCTGGGG - Exonic
1008629323 6:53348558-53348580 CTCGCCCCACGCCGAGGCTGAGG - Intronic
1011054746 6:83193344-83193366 CGCGACCTGCGGCGAGGCGGGGG - Intronic
1012530442 6:100229177-100229199 CCCGAGCGGCGGCGAGGCCGAGG - Intergenic
1014272491 6:119349660-119349682 CCTGAGCCGCGCCGGGGCTGCGG - Exonic
1014725084 6:124963071-124963093 CGAGAGCTGCTCCGAGGCGGGGG - Exonic
1015577977 6:134692888-134692910 CTGTAGATGCCCCGAGGCTGAGG - Intergenic
1016813637 6:148283740-148283762 CTCGATCTTCACCCAGGCTGGGG - Intronic
1017714953 6:157203135-157203157 CTGGAGCTGCCTGGAGGCTGGGG - Intronic
1019303980 7:323697-323719 CTCGAGCTGAGCAGAGGGGGCGG - Intergenic
1019354494 7:571668-571690 GTCCAGCTGCCCCCAGGCTGTGG + Intronic
1019485066 7:1285592-1285614 CTCAGGCTTCGCCGAGGGTGGGG + Intergenic
1020016838 7:4836213-4836235 CTCTGGCTGTGCCGAGGCTGTGG - Intronic
1020262229 7:6536889-6536911 CGAGAGCTGCGCCGGGGCTGGGG + Intronic
1022795942 7:33731442-33731464 CTCCAGGTGCGCCTTGGCTGGGG + Intergenic
1024630088 7:51239725-51239747 GTGGAGCTGGGCAGAGGCTGTGG - Intronic
1024794415 7:53004344-53004366 CTCCACCTGCGGCCAGGCTGTGG + Intergenic
1028995492 7:97095483-97095505 TTCCAGCTACTCCGAGGCTGAGG + Intergenic
1029553558 7:101252041-101252063 CCCGAGCCTCGCCGAGCCTGCGG - Intronic
1030230045 7:107198323-107198345 TTCAAGCTGCTCAGAGGCTGAGG - Intronic
1034965136 7:155386184-155386206 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
1035117469 7:156536692-156536714 CTCGAGCTGTGCGGCAGCTGTGG - Intergenic
1035223871 7:157422948-157422970 CTCCAGCTACTCGGAGGCTGAGG + Intergenic
1035265172 7:157686052-157686074 CGCGGGCAGCGCCGGGGCTGAGG + Intronic
1040023530 8:42761558-42761580 CTGGAGCTTCTCCGAGCCTGCGG - Intronic
1047998402 8:130357959-130357981 CTCCAGCTGCGCGGCGGCAGCGG + Intronic
1049708120 8:144052032-144052054 TTCGAGCTGCGGCGGGGCTCGGG - Exonic
1061743812 9:132725608-132725630 GGGGAGCTGTGCCGAGGCTGGGG + Exonic
1061899198 9:133664359-133664381 CCAGAGCAGCGCCGAGGCTGGGG + Intronic
1062609685 9:137368426-137368448 CTCAGGATGCGCTGAGGCTGGGG - Intronic
1202801555 9_KI270720v1_random:4055-4077 CTGCAGCTGTGCCAAGGCTGTGG + Intergenic
1190142233 X:47857856-47857878 CTCAAACTGGGGCGAGGCTGGGG + Intronic