ID: 948923808

View in Genome Browser
Species Human (GRCh38)
Location 2:241081391-241081413
Sequence AAGGAGGAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13885
Summary {0: 8, 1: 107, 2: 842, 3: 2982, 4: 9946}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948923808_948923818 18 Left 948923808 2:241081391-241081413 CCCTCCTCCTTCTCCTCCTCCTT 0: 8
1: 107
2: 842
3: 2982
4: 9946
Right 948923818 2:241081432-241081454 TCCTTCCAGTAATGAGGTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 139
948923808_948923815 12 Left 948923808 2:241081391-241081413 CCCTCCTCCTTCTCCTCCTCCTT 0: 8
1: 107
2: 842
3: 2982
4: 9946
Right 948923815 2:241081426-241081448 CTTCCTTCCTTCCAGTAATGAGG 0: 1
1: 0
2: 6
3: 29
4: 340
948923808_948923817 17 Left 948923808 2:241081391-241081413 CCCTCCTCCTTCTCCTCCTCCTT 0: 8
1: 107
2: 842
3: 2982
4: 9946
Right 948923817 2:241081431-241081453 TTCCTTCCAGTAATGAGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948923808 Original CRISPR AAGGAGGAGGAGAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr