ID: 948924810

View in Genome Browser
Species Human (GRCh38)
Location 2:241088686-241088708
Sequence CAGCTGATCTAGGGGTTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948924810_948924825 12 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924825 2:241088721-241088743 GAGGCAGGGGGGTGGGCCCTTGG 0: 1
1: 0
2: 8
3: 60
4: 655
948924810_948924821 0 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924821 2:241088709-241088731 CAGTGGGAGGAAGAGGCAGGGGG 0: 1
1: 3
2: 120
3: 3742
4: 67568
948924810_948924824 5 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924824 2:241088714-241088736 GGAGGAAGAGGCAGGGGGGTGGG 0: 1
1: 4
2: 26
3: 289
4: 2793
948924810_948924822 1 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924822 2:241088710-241088732 AGTGGGAGGAAGAGGCAGGGGGG 0: 1
1: 2
2: 15
3: 283
4: 2623
948924810_948924820 -1 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924820 2:241088708-241088730 GCAGTGGGAGGAAGAGGCAGGGG 0: 1
1: 3
2: 24
3: 224
4: 2053
948924810_948924827 21 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924827 2:241088730-241088752 GGGTGGGCCCTTGGAGAGGCTGG 0: 1
1: 0
2: 4
3: 80
4: 410
948924810_948924818 -3 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924818 2:241088706-241088728 CTGCAGTGGGAGGAAGAGGCAGG 0: 1
1: 1
2: 13
3: 132
4: 1265
948924810_948924817 -7 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924817 2:241088702-241088724 TCAGCTGCAGTGGGAGGAAGAGG 0: 1
1: 0
2: 5
3: 78
4: 545
948924810_948924826 17 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924826 2:241088726-241088748 AGGGGGGTGGGCCCTTGGAGAGG 0: 1
1: 0
2: 5
3: 31
4: 363
948924810_948924819 -2 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924819 2:241088707-241088729 TGCAGTGGGAGGAAGAGGCAGGG 0: 1
1: 1
2: 12
3: 96
4: 1002
948924810_948924823 4 Left 948924810 2:241088686-241088708 CCAAGAAACCCCTAGATCAGCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948924823 2:241088713-241088735 GGGAGGAAGAGGCAGGGGGGTGG 0: 1
1: 2
2: 65
3: 712
4: 7345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948924810 Original CRISPR CAGCTGATCTAGGGGTTTCT TGG (reversed) Exonic
903120844 1:21216182-21216204 AAGCTGAGCTGGGGGTTTCAAGG + Intergenic
905222050 1:36454842-36454864 CAGGTGATGTAGAGCTTTCTGGG - Intergenic
906523898 1:46483238-46483260 CATCTGATTTGTGGGTTTCTGGG + Intergenic
908734005 1:67256847-67256869 CATCTGAACAAAGGGTTTCTAGG + Intronic
909093926 1:71263261-71263283 CATCTGCTCTTCGGGTTTCTAGG + Intergenic
909554913 1:76942745-76942767 GAGGTCATCTATGGGTTTCTGGG + Intronic
910403792 1:86864470-86864492 CAGTTTATCTAGGGTATTCTGGG + Intronic
912418066 1:109524339-109524361 CAGCTCATCTAGTAATTTCTAGG - Intergenic
912620946 1:111157302-111157324 CAAGAAATCTAGGGGTTTCTTGG - Intronic
915216827 1:154346042-154346064 CAGCTGATCTAGAACTCTCTTGG + Intronic
916138786 1:161675723-161675745 CAGCAAATCAAGGGGTTTCCAGG - Intronic
917170589 1:172168872-172168894 AAGATTATCAAGGGGTTTCTTGG + Intronic
917703041 1:177600548-177600570 CAGCTGCACTGGGGGTTTCAGGG + Intergenic
1067879318 10:50029888-50029910 CAGCTGATGAAGGGGTCTGTGGG + Intergenic
1067892577 10:50149544-50149566 CAGCTGATGAAGGGGTCTGTGGG - Intergenic
1071824908 10:89316042-89316064 ATTCTGATGTAGGGGTTTCTGGG - Intronic
1073107259 10:101039281-101039303 CAGCTGACCTAGGGTCTTCCAGG + Intronic
1074881566 10:117663446-117663468 CAGCTGTTCTTGGGGGCTCTTGG + Intergenic
1077316837 11:1923153-1923175 CAGCTGATGTAGGGCTGTCAAGG - Intronic
1078919597 11:15817233-15817255 CAGCTGATCTCAGGGTTACTGGG - Intergenic
1080030603 11:27656642-27656664 GTTCTGATCTAGGTGTTTCTGGG + Exonic
1080638583 11:34144789-34144811 CAGCTGATTTGGGGGTTGATGGG + Intronic
1083007154 11:59357074-59357096 CACCAGATCTAGGGGTATCATGG + Intergenic
1085447698 11:76611591-76611613 GCACTGATCTAGGGGTTGCTGGG - Intergenic
1086739346 11:90348174-90348196 CAGCTAATCTAGTTTTTTCTTGG + Intergenic
1094297053 12:28918774-28918796 CATCTGATCTAGGGCTTTTTTGG - Intergenic
1094816377 12:34190207-34190229 CAGTGGATCCAGGAGTTTCTAGG + Intergenic
1100023761 12:90102511-90102533 CAGGTGATCTAAGGATATCTTGG + Intergenic
1106225429 13:27782799-27782821 CAGCTGCTCCAGGATTTTCTTGG - Intergenic
1106308033 13:28531063-28531085 CTGCAGAGGTAGGGGTTTCTGGG + Intergenic
1107184848 13:37505946-37505968 CATATAATCTAGGGTTTTCTAGG + Intergenic
1107484072 13:40809712-40809734 CAGTTCATCTCAGGGTTTCTTGG + Exonic
1107487452 13:40842752-40842774 CATCTGATCTAGGGCTTTTTTGG - Intergenic
1107641642 13:42449843-42449865 CATCTGTTCCAGGGGTTTTTTGG - Intergenic
1108598279 13:51968699-51968721 CTGCTGTTCTAGAGGATTCTGGG - Intronic
1110610666 13:77484109-77484131 CAGATGATCTAGGAGCTTTTGGG + Intergenic
1111210368 13:85070452-85070474 CAGATGATCAAAGGGTCTCTAGG - Intergenic
1112563604 13:100534123-100534145 GAGCTGCTCTGGGGGGTTCTAGG + Intronic
1113910769 13:113840196-113840218 CAGCTGACCTGGGGGCTTCCAGG + Intronic
1117242839 14:53852486-53852508 CAGTTGATGTAAGGGTCTCTTGG + Intergenic
1122287512 14:100660344-100660366 GGGCTGTTCTAGGGGTCTCTGGG + Intergenic
1123999415 15:25742310-25742332 AAACTGATCAAGGGGTGTCTGGG + Intronic
1124421552 15:29527380-29527402 CAGCTGATCGTGGGGTGGCTGGG - Intronic
1127722808 15:61719461-61719483 CTGCTGAACAAGGGGTTTCCTGG - Intergenic
1127982297 15:64044327-64044349 TAGATGATCTATGGGGTTCTAGG - Intronic
1129752134 15:78073245-78073267 AAGCTGATATAGGAATTTCTTGG - Intronic
1129978678 15:79846358-79846380 CAGCTGTCCTGGGGGTTTCTGGG + Intronic
1130420783 15:83745056-83745078 CAGCTGAGCCTGGGGTTTTTAGG - Intronic
1131212410 15:90509255-90509277 CAGATGATCTTGGGATTGCTGGG + Intergenic
1132764252 16:1526355-1526377 CTGCTGACCTGGGGGTCTCTCGG + Intronic
1137500546 16:49008177-49008199 CTGCTGATCTTGGGACTTCTCGG + Intergenic
1140481593 16:75265511-75265533 CAGCTGTCCCAGGGGTTTCCCGG + Intronic
1148360825 17:47010717-47010739 CAGGTGGCCTAGGGATTTCTGGG - Intronic
1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG + Intronic
1150463858 17:65375255-65375277 CACCTGACTTAGGGGTTTCCAGG - Intergenic
1150785712 17:68161441-68161463 CAGCTGGCCTGGGGATTTCTGGG + Intergenic
1151585214 17:75004534-75004556 CAGCTGTTTCAGGGGTTTCCTGG + Exonic
1152660361 17:81539247-81539269 CCGCTCATCTAGGGCCTTCTTGG + Intergenic
1152744522 17:82032648-82032670 CAGCAGGGCTGGGGGTTTCTGGG + Intronic
1156038199 18:32789531-32789553 CAGCTGGCCAAGGGGGTTCTAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157728417 18:49983323-49983345 GAGCTCATCTGGAGGTTTCTGGG - Intronic
1159723541 18:71923983-71924005 CATCTGATCTAGGATTTTTTGGG - Intergenic
1164611126 19:29632423-29632445 CAGGTGGTCCAGGGGTCTCTCGG - Intergenic
1165586127 19:36917150-36917172 CAGCTGATCTAGGTGGGGCTTGG + Intronic
1165669302 19:37662070-37662092 CAGCTGACCATGGGGCTTCTGGG - Intronic
925559398 2:5173722-5173744 CAACTGATCTTGGACTTTCTAGG - Intergenic
925686742 2:6481049-6481071 CAGCTGATCTAGGAGTTACCTGG - Intergenic
926120491 2:10239023-10239045 CAGCTGACCTTGGTGTTTCCAGG + Intergenic
927863829 2:26576433-26576455 CAGTGGAGCTAGGGGTCTCTAGG + Intronic
936776535 2:115980884-115980906 CATCTGGTCTTGGGGTTTTTTGG + Intergenic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
937622048 2:123999861-123999883 CAGCTGATGTCAGAGTTTCTTGG - Intergenic
940087393 2:149876253-149876275 CAGCAGATCAATGGTTTTCTGGG + Intergenic
941062833 2:160867408-160867430 AAGCAGATCTAGGGTTGTCTAGG + Intergenic
941587286 2:167376461-167376483 CATCTGGTCCAGGGCTTTCTTGG + Intergenic
943384521 2:187184899-187184921 CAGCTGATCCTGGGTTTTTTGGG + Intergenic
946943814 2:224798552-224798574 CATCTGAAATAGGGCTTTCTTGG + Intronic
948924810 2:241088686-241088708 CAGCTGATCTAGGGGTTTCTTGG - Exonic
1174624271 20:51901366-51901388 CAGCTTATCTAGGAGTGCCTTGG - Intergenic
1175157058 20:56978273-56978295 CAGCAGATCTGTGGGTCTCTTGG - Intergenic
1181118619 22:20650292-20650314 CAGCTGATAAAGGGGTCTGTGGG - Intergenic
1181933590 22:26423411-26423433 CAGCAAATCTAGGGGTCCCTAGG + Intergenic
1182444131 22:30380384-30380406 CAGCTGCTGCAGGGGTTTCTGGG + Exonic
1184277699 22:43419598-43419620 CAGCTGCTCTAGAGGGTGCTGGG + Intronic
1185032788 22:48453524-48453546 CATCTTATCTAGGTGTTTCTGGG - Intergenic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
953808289 3:46090532-46090554 CAGCTGGTGAAGGGGCTTCTGGG + Intergenic
960641837 3:119832372-119832394 CAGCTTAGCTAGGTGGTTCTGGG - Intronic
962273455 3:133995122-133995144 GAGGGGCTCTAGGGGTTTCTGGG - Intronic
964413987 3:156428425-156428447 CTGCAGATCTTGGGATTTCTTGG + Intronic
967466147 3:189808238-189808260 CGGCTAATATTGGGGTTTCTGGG + Intronic
974430294 4:61788387-61788409 CAGCAGAGCTACGGGGTTCTGGG - Intronic
974920537 4:68233817-68233839 AAGCAGATTTAGGGCTTTCTTGG - Intronic
975752238 4:77535753-77535775 CAGCTGATCTAGTTATTTGTTGG - Intronic
976092228 4:81471012-81471034 CAGATGAGCTAGAGGTATCTAGG - Intronic
976780617 4:88754576-88754598 CAGCTGAGCTAGGAGGTACTTGG + Intronic
978205768 4:106079413-106079435 CAGCATCTCTAGGGTTTTCTAGG - Intronic
982744157 4:159089143-159089165 CATCTGATTTTGGGGGTTCTTGG - Intergenic
988641841 5:33049319-33049341 CAGCTGTGATAGGGGCTTCTGGG - Intergenic
996294258 5:121893147-121893169 CATCTGGTCTAGGGCTTTTTTGG - Intergenic
1005654989 6:27926769-27926791 CAGCTGTTCTAGGGTCATCTTGG + Intergenic
1012828719 6:104180102-104180124 AAGCAGATATAGAGGTTTCTAGG - Intergenic
1013302592 6:108818406-108818428 CTGCTGATGTTGGGGTTTTTAGG + Intergenic
1015037134 6:128669362-128669384 CAGCTCATGTAGGGGGTGCTTGG + Intergenic
1016778133 6:147928280-147928302 CATCTGATCTTGGGCTTTTTTGG + Intergenic
1018388249 6:163323629-163323651 CTGCTGATCTAGGGTGTGCTGGG - Intergenic
1019095348 6:169575134-169575156 CAGCAGATCTTGGGACTTCTCGG + Intronic
1020412545 7:7909010-7909032 CTGCAGATCTTGGGATTTCTTGG + Intronic
1020864449 7:13540006-13540028 CAACTGATGCAGGAGTTTCTGGG - Intergenic
1024130245 7:46344805-46344827 CACCTGCTCTCGGTGTTTCTAGG - Intergenic
1027344130 7:77239707-77239729 TAGCTAATATAAGGGTTTCTGGG + Intronic
1027949580 7:84797354-84797376 CATCTGATCCAGGGCTTTTTAGG + Intergenic
1029010174 7:97251844-97251866 CAGCTTATTAAGAGGTTTCTGGG + Intergenic
1029258653 7:99286542-99286564 AAGCAGAGCTGGGGGTTTCTGGG - Intergenic
1033597380 7:142867212-142867234 CAGCTGACCTAGGGGCTACTCGG + Intronic
1034621372 7:152459869-152459891 CAACTGACCTAGGGTTCTCTTGG + Intergenic
1035062433 7:156079491-156079513 CAGCTGACCTGGTGGTTTGTCGG - Intergenic
1040340357 8:46437416-46437438 GGGCAGATCTAGGGGCTTCTGGG + Intergenic
1048739477 8:137538607-137538629 CAGCAGATCTTGGGAATTCTTGG - Intergenic
1053052778 9:34975860-34975882 GAGCTAACCTAGGGATTTCTTGG - Intronic
1056309765 9:85328266-85328288 TATCAGATCTAGGGGTTTTTTGG - Intergenic
1058650485 9:107171428-107171450 CCGCAGATCTGGAGGTTTCTCGG - Intergenic
1062169007 9:135124072-135124094 TAGATGACCTAAGGGTTTCTGGG - Intergenic
1062210786 9:135362667-135362689 GAGCTGATCTAGGGGTCTAGGGG - Intergenic
1062572708 9:137192960-137192982 GAGCTGGTCTAGAGGCTTCTGGG - Intronic
1186950589 X:14620256-14620278 CAACTAATTTGGGGGTTTCTCGG + Intronic
1190604970 X:52131666-52131688 CATCAGATCTAGGAGCTTCTGGG - Intergenic
1193348407 X:80430321-80430343 CAGCGAAATTAGGGGTTTCTTGG + Intronic
1193908345 X:87270322-87270344 CAGCTGATCTAGGATTGGCTTGG + Intergenic
1194445041 X:93976391-93976413 CTCCTGATCTAAGGGTTTCAGGG + Intergenic
1195338083 X:103877085-103877107 CAGTGAATTTAGGGGTTTCTTGG + Intergenic
1195381329 X:104273745-104273767 AAACTAATCTAGGTGTTTCTGGG + Intergenic
1196908118 X:120458894-120458916 CAGCACTTCTAGGGGTATCTAGG - Intronic
1197497866 X:127208198-127208220 CAGTTGGTTTTGGGGTTTCTAGG - Intergenic
1199644240 X:149890304-149890326 TATCTGATCTAGGAGCTTCTGGG - Intergenic