ID: 948928387

View in Genome Browser
Species Human (GRCh38)
Location 2:241115079-241115101
Sequence CTTTCATCGACCGCCACCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948928387_948928389 -9 Left 948928387 2:241115079-241115101 CCTGGGGTGGCGGTCGATGAAAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 948928389 2:241115093-241115115 CGATGAAAGCGAAGAGGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 68
948928387_948928393 21 Left 948928387 2:241115079-241115101 CCTGGGGTGGCGGTCGATGAAAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 948928393 2:241115123-241115145 CGTGCTTCTCCATCACAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 90
948928387_948928390 -5 Left 948928387 2:241115079-241115101 CCTGGGGTGGCGGTCGATGAAAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 948928390 2:241115097-241115119 GAAAGCGAAGAGGTCTAGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948928387 Original CRISPR CTTTCATCGACCGCCACCCC AGG (reversed) Exonic