ID: 948929590

View in Genome Browser
Species Human (GRCh38)
Location 2:241123471-241123493
Sequence CTATGAAGCCACTTTAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948929590_948929594 20 Left 948929590 2:241123471-241123493 CCCGACCTAAAGTGGCTTCATAG 0: 1
1: 0
2: 2
3: 7
4: 96
Right 948929594 2:241123514-241123536 CAGTGTGAAAAGTTACAAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 218
948929590_948929595 21 Left 948929590 2:241123471-241123493 CCCGACCTAAAGTGGCTTCATAG 0: 1
1: 0
2: 2
3: 7
4: 96
Right 948929595 2:241123515-241123537 AGTGTGAAAAGTTACAAAGAGGG 0: 1
1: 0
2: 3
3: 49
4: 582
948929590_948929596 26 Left 948929590 2:241123471-241123493 CCCGACCTAAAGTGGCTTCATAG 0: 1
1: 0
2: 2
3: 7
4: 96
Right 948929596 2:241123520-241123542 GAAAAGTTACAAAGAGGGCCAGG 0: 1
1: 0
2: 6
3: 53
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948929590 Original CRISPR CTATGAAGCCACTTTAGGTC GGG (reversed) Intronic