ID: 948931775

View in Genome Browser
Species Human (GRCh38)
Location 2:241136791-241136813
Sequence TCCCCAGCAACCACCGTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948931775_948931783 14 Left 948931775 2:241136791-241136813 CCTCCGACGGTGGTTGCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 948931783 2:241136828-241136850 GGAGCTTGGCAGCCATGAGCAGG 0: 1
1: 0
2: 2
3: 52
4: 442
948931775_948931782 0 Left 948931775 2:241136791-241136813 CCTCCGACGGTGGTTGCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 948931782 2:241136814-241136836 AGGGTGGAGAGGAAGGAGCTTGG 0: 1
1: 1
2: 11
3: 135
4: 1239
948931775_948931781 -7 Left 948931775 2:241136791-241136813 CCTCCGACGGTGGTTGCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 948931781 2:241136807-241136829 CTGGGGAAGGGTGGAGAGGAAGG 0: 1
1: 1
2: 15
3: 216
4: 1593
948931775_948931786 29 Left 948931775 2:241136791-241136813 CCTCCGACGGTGGTTGCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 948931786 2:241136843-241136865 TGAGCAGGGACCTCCCTCCCTGG 0: 1
1: 0
2: 0
3: 28
4: 295
948931775_948931784 15 Left 948931775 2:241136791-241136813 CCTCCGACGGTGGTTGCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 948931784 2:241136829-241136851 GAGCTTGGCAGCCATGAGCAGGG 0: 1
1: 1
2: 3
3: 63
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948931775 Original CRISPR TCCCCAGCAACCACCGTCGG AGG (reversed) Intronic
900702001 1:4054183-4054205 TCCCCAGCAAACACTGGCAGAGG - Intergenic
901227321 1:7621266-7621288 TCTCCAGCACCCACCATGGGGGG - Intronic
904737749 1:32647898-32647920 TCCCCTACAACCCCCGTTGGTGG + Intronic
905393395 1:37652328-37652350 TCCCCAGCGACCACCTTCTAGGG - Intergenic
905584522 1:39106009-39106031 TCCCCAGCAACTCCCCACGGCGG - Intronic
906636929 1:47416221-47416243 CCCCCCCCAACCACCGCCGGGGG - Exonic
916713694 1:167433051-167433073 TCCCAAACAACCAGCGCCGGAGG - Exonic
917299173 1:173555172-173555194 AGCCCAGCAACCACAGGCGGTGG + Intronic
918109838 1:181445889-181445911 TCCCCAGCAACCCCAGTCTCAGG + Intronic
923627223 1:235623787-235623809 TCCCCAGCAACCAGCAGCTGGGG + Intronic
1070190183 10:74105155-74105177 GCCCCAGCAACCAGCATCTGAGG - Exonic
1074065130 10:110007416-110007438 GCCCCAGCAGCCAGCGTGGGCGG + Intronic
1076746664 10:132517985-132518007 TCCCCAGAAACCACTGACGTGGG + Intergenic
1077386998 11:2274495-2274517 ACCCCAGCATCCACTGACGGAGG - Intergenic
1083712973 11:64560078-64560100 CCCCCAGCAGCCTCCATCGGAGG + Intronic
1088613600 11:111602302-111602324 TCTCCAGCAGCCGACGTCGGCGG + Intergenic
1092263222 12:6963306-6963328 TCCCCAGCACCCACTCTCTGGGG + Intergenic
1094831647 12:34303009-34303031 TCCCCAGCAACCACTGTGTGGGG + Intergenic
1101373421 12:104150937-104150959 TCCCCAACCACCACCATCCGTGG + Intergenic
1103940694 12:124499773-124499795 TCCCCCGCAACCACCTTCTGTGG - Intronic
1104544667 12:129700143-129700165 CTCCCGGCAACCACCGTGGGGGG + Exonic
1105306725 13:19174119-19174141 CCCCCAGGGACCACCGTGGGGGG + Exonic
1110283494 13:73722501-73722523 TCCCCAGCAGCTACATTCGGAGG + Intronic
1113809675 13:113130629-113130651 TCCCCAGTAACCTTCGGCGGTGG - Intronic
1142055951 16:87996142-87996164 TGTCCAGCAGCCACCGACGGCGG + Intronic
1144339055 17:14297770-14297792 TCCCCAACAGCCACCCTCTGGGG - Intergenic
1152258900 17:79255955-79255977 TCCCCAGCCAACTCCCTCGGGGG + Intronic
1160798696 19:957209-957231 TCCCCAGCCACCACCCTGGCAGG + Intronic
1161042301 19:2116628-2116650 TCCCAAGCACCGGCCGTCGGAGG - Exonic
1163453174 19:17390959-17390981 TCCCCAGGATCCAGCGTCGGTGG - Intergenic
1167116208 19:47490729-47490751 GCCCCAGCCACCCCCGTCTGAGG + Intronic
926235712 2:11041823-11041845 TCCCCAGCAAACATAGTCTGTGG - Intergenic
929547074 2:42862778-42862800 CCTCCAGCACCCACTGTCGGTGG + Intergenic
940266663 2:151846157-151846179 TCCCCAGCAACCACAATCATTGG - Intronic
947642058 2:231712385-231712407 TCCCCAGGAGCCACAGTAGGAGG + Intronic
947820904 2:233068838-233068860 TCCCCAGCAGCCTCCGTCACAGG - Intronic
948541259 2:238692838-238692860 TCCCCAGAGACCACCGTCTATGG + Intergenic
948931775 2:241136791-241136813 TCCCCAGCAACCACCGTCGGAGG - Intronic
1173190409 20:40871488-40871510 TGCCCAGGAACCACCGCTGGAGG + Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175790675 20:61738153-61738175 TCTGCAGCAACCACCGCCAGGGG + Intronic
1181181206 22:21069819-21069841 CCCCCAGGGACCACCGTCAGGGG - Intergenic
950219031 3:11180314-11180336 TCCCCTTCAACCCCCGTCCGTGG - Intronic
953546232 3:43865518-43865540 TCCCCAGCAACAAGCTTCAGAGG - Intergenic
954967565 3:54624905-54624927 TCACCAACAACCACCCCCGGTGG - Intronic
969121149 4:4912372-4912394 TGCCCAGTAACCACAGTGGGTGG + Intergenic
969478815 4:7436121-7436143 TCCCCAGCAACCAGAGTCCTTGG - Intronic
991489227 5:67166448-67166470 TCCCCAGAAGCCACCGACGGAGG + Exonic
992328260 5:75685337-75685359 TCCCCACCAGCCGCCGTCGGAGG - Exonic
996689181 5:126319695-126319717 TCCCCAGCTACAACCGCAGGCGG - Intergenic
1012537112 6:100312615-100312637 TCCACAGCAAGCACCGTGGGTGG - Intergenic
1018697963 6:166405480-166405502 TCACCAGCAAGGACCATCGGGGG - Intergenic
1018715553 6:166530129-166530151 TCCCCAGCAACTACAGGCAGGGG - Intronic
1018918079 6:168150247-168150269 TCCACAGCAACCTCTGTAGGTGG - Intergenic
1019646099 7:2129833-2129855 AACACAGCCACCACCGTCGGAGG + Intronic
1019722058 7:2578558-2578580 TCCCCAGTAACTAGCGTCTGGGG - Intronic
1023869748 7:44256885-44256907 CCCACAGCAACCAACGTGGGTGG - Intronic
1029115082 7:98232564-98232586 TCCCCACCCACCACCCTCTGAGG + Intronic
1029254110 7:99257432-99257454 GCCCCAGCACCCACCCTCAGTGG - Intergenic
1035218717 7:157391479-157391501 CCCCCAGCAGCCACCGCAGGAGG - Intronic
1039789724 8:40865615-40865637 TCCCCAGCAACCGTGGTGGGAGG + Intronic
1040967693 8:53100868-53100890 TAACCAGCAACCAGGGTCGGCGG + Intergenic
1044967434 8:97586686-97586708 TCCCCACCAAGGACCGTTGGTGG - Intergenic
1049266488 8:141670556-141670578 CCCCCAGCAGCCACCCCCGGTGG + Intergenic
1049491469 8:142905489-142905511 TCCCCAGCACCCACCATGCGTGG + Intronic
1056755659 9:89380580-89380602 TCCCCAGCAGCCACCTTCCAGGG - Intronic
1061302633 9:129714449-129714471 TCCCCTGCATCCACCCTAGGAGG - Intronic
1196390595 X:115203771-115203793 TCCCCTGAAACCAGCGACGGGGG - Intronic