ID: 948933653

View in Genome Browser
Species Human (GRCh38)
Location 2:241149066-241149088
Sequence TTCACCGCAGCCGGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948933653_948933660 12 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933660 2:241149101-241149123 TCCCGAGGCGACCCGAGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 44
948933653_948933662 13 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933662 2:241149102-241149124 CCCGAGGCGACCCGAGGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 103
948933653_948933658 -3 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933658 2:241149086-241149108 GAAGAGAGCGCAGGGTCCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 136
948933653_948933659 7 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933659 2:241149096-241149118 CAGGGTCCCGAGGCGACCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 81
948933653_948933665 20 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933665 2:241149109-241149131 CGACCCGAGGCGCGGGGCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 130
948933653_948933664 14 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933664 2:241149103-241149125 CCGAGGCGACCCGAGGCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
948933653_948933668 30 Left 948933653 2:241149066-241149088 CCCGCAGGGCCGGCTGCGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 133
Right 948933668 2:241149119-241149141 CGCGGGGCCTCGGCGCCCACCGG 0: 1
1: 0
2: 6
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948933653 Original CRISPR TTCACCGCAGCCGGCCCTGC GGG (reversed) Intronic
900868218 1:5283602-5283624 TCCAAGGCAGCCGGCTCTGCTGG - Intergenic
901682232 1:10919998-10920020 GCCGCCGCACCCGGCCCTGCCGG + Intergenic
902910981 1:19597121-19597143 TTCGCCCCAGCAGGCCCGGCCGG + Intronic
903176886 1:21586779-21586801 TTCCCCGCAACCAGCCCTGGAGG + Intergenic
903641651 1:24864101-24864123 GCCACCGCACCCGGCCCAGCTGG + Intergenic
906365358 1:45205826-45205848 GCCACCGCAGCCGGCCGCGCCGG + Exonic
911591187 1:99750059-99750081 TTAACCGCAGCCTAACCTGCTGG + Intronic
914821473 1:151107612-151107634 TTCACCGCGCCCGGCCCTGATGG + Intronic
914993116 1:152515508-152515530 GTCGCCGCAGCAGCCCCTGCCGG - Exonic
923736278 1:236611185-236611207 GTCACTGCACCCGGCCCTGATGG - Intergenic
1062775169 10:138401-138423 GCCACCGCACCCGGCCCTGTTGG + Intronic
1063350859 10:5353468-5353490 CTCACAGCAGCCGGACATGCTGG + Intergenic
1065315529 10:24460029-24460051 TTCTCCGCAGTCGGCACAGCAGG - Intronic
1065848672 10:29768015-29768037 TTCACAGCAGCCGGCGAGGCTGG - Intergenic
1065918060 10:30368605-30368627 TCCACCTCAGAGGGCCCTGCTGG + Intronic
1073358731 10:102879231-102879253 TTCACTGCAGCCTGACCTCCTGG + Intronic
1076640835 10:131916176-131916198 TCCACCACAGCCTGTCCTGCGGG - Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1079251770 11:18792162-18792184 TTCAGCGCGCACGGCCCTGCCGG - Intronic
1080644233 11:34176487-34176509 TTCACTGAAGCCAGGCCTGCTGG + Intronic
1082019198 11:47517170-47517192 TTCACTGCAGCCCGACCTCCTGG - Intronic
1082657693 11:55872930-55872952 TGCTCCGCAGCAGGCGCTGCAGG + Intergenic
1088170460 11:106990454-106990476 TCCCCAGCAGCTGGCCCTGCAGG + Intronic
1088221765 11:107577365-107577387 TTCACCAGAGCCGGCTGTGCCGG - Intergenic
1088346916 11:108836773-108836795 TTCACCACACCCGGCCTTGGTGG + Intronic
1090470051 11:126972525-126972547 TCCACAGCAGCCAGCTCTGCTGG - Intronic
1090710033 11:129375766-129375788 CACTCCGCACCCGGCCCTGCAGG + Intergenic
1091433060 12:453076-453098 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433081 12:453147-453169 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433103 12:453218-453240 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433125 12:453289-453311 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433147 12:453360-453382 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433169 12:453431-453453 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433191 12:453502-453524 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091588911 12:1831526-1831548 GTGAGCGCAGCCGGCCCTGCTGG + Intronic
1091804047 12:3343301-3343323 TTCACCGCCCCCGCACCTGCTGG - Intergenic
1103556340 12:121768857-121768879 GTCACTGCACCCGGCCCAGCTGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1112414559 13:99193505-99193527 TTCACTGCAGCCCGACCTGCTGG - Intergenic
1113147810 13:107228461-107228483 TTCACCCCTCCCGACCCTGCAGG - Intronic
1121322307 14:92999204-92999226 TTGTGCGCAGCCGTCCCTGCTGG - Intronic
1122604380 14:102938453-102938475 AACTTCGCAGCCGGCCCTGCCGG - Intronic
1124261072 15:28191985-28192007 TTGACGGCAGCGAGCCCTGCTGG - Exonic
1126466022 15:48962562-48962584 TCCACCGCAGCAGGACCTGGTGG - Exonic
1128186599 15:65647972-65647994 GCCACCGCACCCGGCCCTGAAGG - Intronic
1129022327 15:72532749-72532771 TTCACCTCAGGTGGCCATGCTGG - Intronic
1129309464 15:74695990-74696012 TTCACCACCGCCGCCGCTGCCGG + Exonic
1129949470 15:79573284-79573306 TTCACCACAGCCAGCCCTGGGGG + Intergenic
1132622630 16:874983-875005 TACATCGCAGCCGGGACTGCCGG + Intronic
1132672449 16:1107400-1107422 GTGACCGCAGTCGGCCCTGCAGG + Intergenic
1134144819 16:11752190-11752212 TTCAACGCAGCCGGGCATGGTGG - Intronic
1137271804 16:46907192-46907214 TTCTCTGCAGCTGGACCTGCTGG - Intronic
1140187554 16:72788399-72788421 TGCACAGCTGCAGGCCCTGCAGG - Exonic
1141603174 16:85138376-85138398 TTCACTGCAGCCTCCCCTCCCGG + Intergenic
1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG + Intronic
1142239247 16:88937667-88937689 CTCACGGCAGCCAGCCCTGAGGG - Intronic
1142685963 17:1577148-1577170 GCCACCGCGCCCGGCCCTGCTGG + Intronic
1142982407 17:3679804-3679826 TTCACCTGGGACGGCCCTGCAGG + Intronic
1143010628 17:3864530-3864552 GCCACCGCACCCGGCCGTGCTGG + Intronic
1143136763 17:4716551-4716573 TCCTCAGCAGCCGGTCCTGCAGG - Exonic
1150440106 17:65184071-65184093 TTCTCAGCTGCCGGCCCTCCTGG - Intronic
1151455638 17:74224121-74224143 GTCACCGCGCCCGGCCATGCAGG - Intronic
1151499711 17:74481033-74481055 GCCACCGCACCCGGCCCAGCTGG + Intronic
1152260682 17:79265270-79265292 CTCCCCGAAGCCGGCCCTGGGGG + Intronic
1160712504 19:559013-559035 TTGAAGGCAGCTGGCCCTGCTGG + Intergenic
1160758504 19:771051-771073 GCCACCGCGCCCGGCCCTGCGGG - Intergenic
1160778672 19:868251-868273 TTAACCTCAGCCCGCCCTGCAGG - Exonic
1161368069 19:3892618-3892640 GTCACCGCACCCAGCCCTGAGGG - Intronic
1162418785 19:10553980-10554002 TCCTCCGCTGCCGGCCCAGCTGG + Exonic
1162520502 19:11176671-11176693 TTGGCCGCTGCCGTCCCTGCAGG + Exonic
1163326406 19:16606168-16606190 GTCACCGCAGCCTCTCCTGCTGG - Intronic
1163431134 19:17268502-17268524 CTCACCGCAGCCTCCCCTCCCGG + Intronic
1165434678 19:35789440-35789462 TGCGCCGCAGCAGCCCCTGCAGG + Intergenic
1166027573 19:40102451-40102473 TTCACTGCAGCCTGACCTCCTGG - Intergenic
1167141938 19:47657681-47657703 TTCACAGCAGCCGGGCATGGTGG - Intronic
1167374466 19:49103570-49103592 TTTACCGATGCCGGCCTTGCGGG - Intronic
1168271766 19:55253919-55253941 TTCACAGCAGCCCGCCCTGGTGG - Intronic
925098990 2:1229867-1229889 CTCGGAGCAGCCGGCCCTGCCGG - Intronic
927154012 2:20211608-20211630 TTCCCACCAGCCGGCCCGGCTGG + Intronic
927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG + Intergenic
928071898 2:28225349-28225371 TTAACACCAGCCAGCCCTGCAGG + Intronic
934655839 2:96116544-96116566 TTCGCCCCAGCCGCGCCTGCAGG + Intergenic
941080742 2:161057875-161057897 TTCACAGCAGCCTCCTCTGCTGG - Intergenic
942491274 2:176491569-176491591 TTCACAGCAGTTGGCCCTGGGGG - Intergenic
942678385 2:178451351-178451373 TTCTCCGCGCCCGCCCCTGCCGG + Intronic
943507820 2:188783790-188783812 GCCACCGCACCCGGCCTTGCTGG + Intronic
944706523 2:202294676-202294698 GCCACCACACCCGGCCCTGCTGG - Intronic
947575873 2:231273699-231273721 GTCACCGCACCCGGCCCCGTAGG + Intronic
948047056 2:234952497-234952519 TTCCCGGCGGGCGGCCCTGCGGG + Intronic
948862301 2:240758497-240758519 TTGACCCCTGCCGTCCCTGCAGG - Exonic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
1171151157 20:22827442-22827464 TTCAGCGAAGACGGCTCTGCAGG + Intergenic
1171502543 20:25604804-25604826 ATCAGCGCTGCCGGCCCTGCCGG - Intergenic
1173959885 20:47062714-47062736 TTCACCGCAGAAGGCTCTTCTGG - Intronic
1175142396 20:56870682-56870704 GCCACCGCGCCCGGCCCTGCAGG - Intergenic
1175764407 20:61582616-61582638 TCCACCGCACCAGGCCCTGCAGG - Intronic
1176096649 20:63347424-63347446 GTAACCGCAGCCGCCCCTGAAGG - Intronic
1184220360 22:43096029-43096051 GCCACCGCACCCGGCCCGGCTGG - Intergenic
1184497938 22:44853739-44853761 ACCACCGCAGCTGGCCCTGATGG - Intronic
1184707533 22:46224742-46224764 TTCACCCCAGCAGCCCCTGCAGG - Intronic
1185095197 22:48802664-48802686 CTCACCGCAGCCGGCCTTGCAGG + Intronic
1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG + Intergenic
1185326558 22:50228495-50228517 GCCACAGCAGCAGGCCCTGCAGG + Intronic
949908325 3:8878075-8878097 TGCACTGCGGCTGGCCCTGCTGG - Exonic
961305888 3:125958982-125959004 GTCAGCGCAGCTGGCCCTGGCGG + Intergenic
961868930 3:129974604-129974626 CTGACGGCAGCCGGCCCCGCGGG - Exonic
968613413 4:1567128-1567150 TTCACAGCATCCCACCCTGCGGG + Intergenic
969316123 4:6382235-6382257 TTCACAGCAGCGGGCCATCCCGG - Intronic
973293295 4:48490584-48490606 GTCGCAGCTGCCGGCCCTGCGGG - Exonic
978777381 4:112516809-112516831 GGCACCGCACCCGGCGCTGCCGG + Intergenic
980012678 4:127614502-127614524 TTCACTGCAGCCTGCACTCCTGG - Intergenic
983769034 4:171525102-171525124 TTCACAGCAGCAAGCACTGCAGG + Intergenic
985783804 5:1883903-1883925 TCCCTCGCAGCCAGCCCTGCGGG - Intronic
986733202 5:10649852-10649874 TTCTCCGCCGCAGGCGCTGCAGG - Exonic
991496657 5:67233370-67233392 TTCACCAGAGCAGGCTCTGCGGG - Intergenic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
997622309 5:135306830-135306852 TTCCCTGCAGCCAGCCCTGTGGG + Intronic
998047655 5:139002134-139002156 TTCACTGCAGCCCGACCTCCTGG - Intronic
1001845247 5:174916397-174916419 AGCACCACAGCCGCCCCTGCTGG - Intergenic
1002928744 6:1619672-1619694 TTCCCCGCGCCCGGCGCTGCCGG + Intergenic
1003060708 6:2860233-2860255 CTCGGAGCAGCCGGCCCTGCTGG + Intergenic
1003671524 6:8164426-8164448 CTCGGAGCAGCCGGCCCTGCCGG + Intergenic
1003770172 6:9290707-9290729 CTCGGAGCAGCCGGCCCTGCCGG - Intergenic
1011717889 6:90125993-90126015 TTCCCTGCAGCCGGCCCTCCTGG - Intronic
1020062135 7:5160547-5160569 GCCACCGCGCCCGGCCCTGCTGG - Intergenic
1020166009 7:5808130-5808152 GCCACCGCGCCCGGCCCTGCTGG + Intergenic
1041114142 8:54517916-54517938 CTCACAGCAGCAGGCTCTGCAGG - Intergenic
1043982645 8:86659046-86659068 TCCACCTCAGAGGGCCCTGCTGG + Intronic
1046754150 8:117955905-117955927 TTCACCCCAGCCTGCCCTTATGG + Intronic
1049797710 8:144504138-144504160 TTCACCGCAGCTGGCCTCACTGG - Exonic
1050575997 9:6995952-6995974 GCCACCGCGCCCGGCCCTGCAGG + Intronic
1052804600 9:33001611-33001633 CTCACCGCTTCCGGCGCTGCGGG + Intronic
1053165449 9:35841041-35841063 TTCTCCCCAGCCCGCCCAGCAGG + Intronic
1054109088 9:61087290-61087312 GTCACCGCGCCCGGCCCTGTTGG + Intergenic
1054611769 9:67243835-67243857 GTCACCGCGCCCGGCCCTGTTGG - Intergenic
1057270815 9:93650455-93650477 GTCACAGCAGCCGCCCCTGCAGG - Intronic
1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG + Exonic
1062421532 9:136484676-136484698 TGCACCGCCTGCGGCCCTGCTGG - Exonic
1062516965 9:136941684-136941706 CTCACCGTAGCCCTCCCTGCAGG - Exonic
1190292728 X:49003342-49003364 GCCACCGCGCCCGGCCCTGCTGG - Intergenic
1195664907 X:107420344-107420366 TTCACAGCAGCAGGTCCTTCTGG + Intergenic
1198312312 X:135435002-135435024 CCTGCCGCAGCCGGCCCTGCAGG - Intergenic
1200071958 X:153533666-153533688 TTCTCCTCGGCTGGCCCTGCTGG - Intronic
1202101593 Y:21314289-21314311 GCCACCGCAGCCGGCCCAGAAGG - Intergenic
1202366954 Y:24172124-24172146 TCCACCTCAGAGGGCCCTGCTGG - Intergenic
1202373452 Y:24213359-24213381 TCCACCTCAGAGGGCCCTGCTGG + Intergenic
1202497329 Y:25456761-25456783 TCCACCTCAGAGGGCCCTGCTGG - Intergenic
1202503828 Y:25497999-25498021 TCCACCTCAGAGGGCCCTGCTGG + Intergenic