ID: 948936487

View in Genome Browser
Species Human (GRCh38)
Location 2:241168505-241168527
Sequence GTTGCAGAAGACGCGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948936487 Original CRISPR GTTGCAGAAGACGCGACTGT GGG (reversed) Intronic
900006357 1:56396-56418 GTTGCAGAAGAGACCTCTGTGGG + Intergenic
902747357 1:18482645-18482667 GTAGCAGAAGACGCGGCTGGAGG - Exonic
903833977 1:26190858-26190880 GCTGCAGAAGGGGCCACTGTGGG - Intronic
904177714 1:28642814-28642836 CTCGGAGAAGACGCGGCTGTGGG - Exonic
911238187 1:95434921-95434943 GTTGCAGATGACATGATTGTTGG - Intergenic
912454976 1:109791249-109791271 GTTGCAGAACCAGCGAGTGTTGG - Intergenic
913127958 1:115810860-115810882 GTGACAGAAGAAGGGACTGTTGG - Intergenic
1063371384 10:5525044-5525066 GTGGCAGAAGAGGCCACTGTGGG - Exonic
1069625887 10:69867450-69867472 TTTGCAGAACACGGGACAGTGGG - Intronic
1073001135 10:100286845-100286867 GTCCCAGACGTCGCGACTGTTGG - Intergenic
1074079153 10:110153633-110153655 GTGGCAGATGAGGCGACTGGTGG - Intergenic
1078058576 11:8029132-8029154 GTTGCAGAAGAGACCAGTGTGGG - Intronic
1078859972 11:15238014-15238036 GGTGCAGAAGAGGGGAGTGTGGG + Intronic
1082031239 11:47605544-47605566 TTTGCAGAAGGCACCACTGTTGG - Intergenic
1087017023 11:93563979-93564001 GTGGCAGAAGATGAGACTGAAGG - Intergenic
1089218933 11:116854578-116854600 GTTGCACAAGACTCTACTGTAGG - Intronic
1089422390 11:118341602-118341624 CCTGAAGAGGACGCGACTGTAGG - Intronic
1113886756 13:113665088-113665110 GTGGGAGAAGAGGCAACTGTGGG - Intergenic
1115342124 14:32304170-32304192 GTTGCAAAATATGTGACTGTAGG + Intergenic
1117140144 14:52781845-52781867 GTTGTAGAAGATGTGACTCTAGG - Exonic
1119174099 14:72556561-72556583 CTTTCAGAAGACGTGACTGCTGG + Intronic
1125428671 15:39575187-39575209 TTTGCAGAAGAAGAGAATGTGGG - Intergenic
1126495160 15:49282068-49282090 CTTGCAGAAGAAGGAACTGTAGG + Exonic
1127950048 15:63796269-63796291 GTTGCAGAAGATGTAACTGTTGG - Intronic
1129937191 15:79460514-79460536 GTTGCAAAAGACACGACAGAAGG - Intronic
1132447164 15:101934562-101934584 GTTGCAGAAGAGACCTCTGTGGG - Intergenic
1132649880 16:1015726-1015748 GTTCAAGGAGACGCCACTGTGGG - Intergenic
1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG + Exonic
1151397275 17:73831828-73831850 GTTGCAGAGGAGGCAGCTGTAGG + Intergenic
1160638112 19:97971-97993 GTTGCAGAAGAGACCTCTGTGGG + Intergenic
934159381 2:89234062-89234084 TCTGCAGAAGAGGAGACTGTTGG - Intergenic
943593148 2:189822555-189822577 GTTGTAGAAGATGTGACTCTAGG + Intronic
948936487 2:241168505-241168527 GTTGCAGAAGACGCGACTGTGGG - Intronic
948964757 2:241369777-241369799 GTTTCAGAAGAACCCACTGTTGG + Intronic
1179514636 21:41898236-41898258 GGTGCAGAAGACAGGACTGGGGG - Intronic
1179932996 21:44583271-44583293 CTTGCAGAAGACACGGCCGTGGG - Intronic
1180672472 22:17564037-17564059 GTCCGAGAAGACGCGACTGCTGG - Intronic
1184437016 22:44485259-44485281 CGTGCAGAAGATGGGACTGTGGG - Intergenic
1184628962 22:45760708-45760730 GTTGCAGATGAGGAGACTGAGGG + Intronic
958009287 3:87855459-87855481 GTTACAGAAAAAGCGACTGGAGG - Intergenic
997453147 5:133999547-133999569 CTTGCAGAAGACGGGAGTTTAGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006550818 6:34821778-34821800 GTTGCAGTAGACCCGAGTGATGG - Exonic
1023025718 7:36048043-36048065 GATGGAGAAGACACGACTGATGG - Intergenic
1040665240 8:49623881-49623903 GTGGGAGAAAACGGGACTGTAGG - Intergenic
1050193504 9:3055367-3055389 GATGCAGAAGAAGGGACTTTGGG + Intergenic
1052686001 9:31756806-31756828 GTGGCAGAAGACTGGAGTGTGGG - Intergenic
1192350926 X:70355581-70355603 GTTGCTGAGGATGTGACTGTGGG - Intronic