ID: 948938220

View in Genome Browser
Species Human (GRCh38)
Location 2:241182238-241182260
Sequence TGTCTGCTGTGTCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948938217_948938220 27 Left 948938217 2:241182188-241182210 CCATAGAGGTAATTTACAGAAGA 0: 1
1: 0
2: 1
3: 11
4: 189
Right 948938220 2:241182238-241182260 TGTCTGCTGTGTCACAGTGATGG 0: 1
1: 0
2: 1
3: 28
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948938220 Original CRISPR TGTCTGCTGTGTCACAGTGA TGG Intronic
900508996 1:3049323-3049345 TGCCTGCTTTGTCCCAGTGATGG - Intergenic
901193101 1:7424382-7424404 TGTATTGCGTGTCACAGTGAGGG + Intronic
901499250 1:9641459-9641481 TGTCGGCTGTGTGACCTTGAAGG - Intergenic
901612552 1:10510381-10510403 TGTCTGGTGTGTCCAAGTAAAGG + Intronic
902358597 1:15927642-15927664 TGTCTGCTTTGTCACAACGCCGG + Intronic
903670143 1:25030755-25030777 TTTCTGCTCTGGAACAGTGAGGG - Intergenic
904789449 1:33007685-33007707 GGTTTGCTCTGTTACAGTGAAGG - Intergenic
905600655 1:39247509-39247531 TGTCTGTTGTGTCTCTGTGATGG + Intronic
906681725 1:47731154-47731176 TGCCAGGTGTTTCACAGTGATGG - Intergenic
906783824 1:48596766-48596788 TTTCTGAAGTGGCACAGTGAAGG + Intronic
907246746 1:53113830-53113852 CTTCTGCTGTGTCACACTGATGG + Intronic
907929117 1:58982586-58982608 TTTCTGCTGGGTAACAGTGGTGG + Intergenic
908027421 1:59967671-59967693 TGCCTCCTGTGTCTCAGTTATGG + Intergenic
908271981 1:62431046-62431068 GGTCTGTTGTGTCAAAGTCAGGG - Intergenic
909227432 1:73043922-73043944 TGTCACCTGTCTCACAGTGTGGG - Intergenic
910514874 1:88048911-88048933 TGTTTACTGTGTCTCAGTGAGGG + Intergenic
910762205 1:90744914-90744936 TGCCTGCTGTGTGAAGGTGATGG + Intergenic
910947517 1:92610448-92610470 TGTCTGCTGTCTCTCACTCATGG - Intronic
913470503 1:119181201-119181223 TGTATTCTGCGTCCCAGTGAGGG + Intergenic
914505261 1:148283228-148283250 TCTCTGCTGTTTCACAGCTATGG + Intergenic
914507304 1:148300919-148300941 TCTCTGCTGTTTCACAGCTATGG - Intergenic
914735868 1:150415889-150415911 TATATGCTGTTTCACAGAGAAGG - Intronic
916530388 1:165651169-165651191 TATTTGCTGAGTCATAGTGATGG + Intronic
917332169 1:173892602-173892624 TCACTGCTGTGTCACAGTTGAGG - Exonic
920345791 1:205304867-205304889 TGCCTTCTGAGTCATAGTGAAGG + Intronic
922247290 1:223813052-223813074 AGACTGCTGGGTCACAGGGATGG + Intronic
924090331 1:240494370-240494392 TGTCTGCTGGTTAACATTGATGG - Intronic
924374648 1:243392454-243392476 GTTCTGCTTTGTTACAGTGATGG + Intronic
924749587 1:246873511-246873533 TTTCTCCTGCATCACAGTGAAGG + Intronic
1063305388 10:4894525-4894547 TGCCTGCTGTGTGGCTGTGATGG + Intergenic
1064656648 10:17562603-17562625 TGACAGCTGTGTCACAGAAAAGG - Intergenic
1067674965 10:48365811-48365833 TGTCTCATGTGTTACAGTCATGG + Intronic
1068472490 10:57482670-57482692 TGACTACTTTGTCACAGGGAAGG - Intergenic
1071160876 10:82743692-82743714 TGCCATATGTGTCACAGTGAAGG + Intronic
1071529945 10:86381410-86381432 TTTCTGCTGTTTCACTATGATGG - Intergenic
1073761322 10:106631720-106631742 TGTCTGCTGTCTCTCAATGGAGG - Intronic
1073835010 10:107431187-107431209 TGCCTACTGTGTCAAAGCGAAGG + Intergenic
1073990989 10:109261838-109261860 GGTCCCCTGTGTCCCAGTGATGG - Intergenic
1075410125 10:122221548-122221570 TGTCTGCAGTGTGACAGAGACGG - Intronic
1076197407 10:128529176-128529198 TATCTGCTGGGTCACACTTACGG - Intergenic
1076353472 10:129834633-129834655 GGTCTGCTGTGCCACTGTGGTGG + Intergenic
1077325731 11:1963204-1963226 TGTCTCATGTCTCTCAGTGAGGG - Intronic
1077780485 11:5323535-5323557 TATCTTCTATGTTACAGTGATGG - Exonic
1079111932 11:17610006-17610028 TGTCTGCAGTGCAACAGGGAGGG - Exonic
1079268818 11:18962247-18962269 TATTTGCTGTATTACAGTGATGG + Intergenic
1079326663 11:19498743-19498765 TGTCTGCTGTGTTCCAAAGATGG + Intronic
1083308080 11:61771157-61771179 TGCCTGCAGTGTCACACTCAAGG - Intronic
1083708264 11:64531321-64531343 TGTCTCCTGGGGCACAGTGCGGG + Intergenic
1084139947 11:67220059-67220081 GGTGTGCAGTGTCACAGTCATGG + Intronic
1089066530 11:115666186-115666208 TGTCAGCTGAGTCACAGGCAGGG + Intergenic
1090829835 11:130413510-130413532 TGGATGCTGTTTCATAGTGATGG + Intronic
1091235172 11:134017128-134017150 TGCCTGCTCCCTCACAGTGATGG + Intergenic
1202808711 11_KI270721v1_random:18383-18405 TGTCTCATGTCTCTCAGTGAGGG - Intergenic
1092008645 12:5090115-5090137 TCTCTGCTGTGGTGCAGTGAGGG - Intergenic
1093526554 12:20110047-20110069 TTTCTTCTGTGACACAGAGAAGG + Intergenic
1095378421 12:41559348-41559370 TGTCTGCTGTGTCATTGCCAGGG + Intronic
1101288352 12:103340060-103340082 TTACTGCTGTGACACAGGGAGGG + Intronic
1102524222 12:113499826-113499848 TTTCTCCAGTGGCACAGTGAAGG + Intergenic
1103494386 12:121350328-121350350 TGTCTGTTGAGTAACAGTGATGG - Intronic
1106954522 13:34921339-34921361 TGACTGCTGTGTGTCAGTGAAGG - Intergenic
1108250380 13:48561092-48561114 TGTCTGCTGTGGCACAATCATGG - Intergenic
1108364625 13:49697450-49697472 TGTCCGTTGTCTTACAGTGATGG - Intergenic
1108747695 13:53411612-53411634 GGCCTGCTGTGCCACAGTCAGGG + Intergenic
1109638865 13:65160590-65160612 TGTTTTCTCTGTCACAGGGATGG - Intergenic
1111025183 13:82511220-82511242 ACACTACTGTGTCACAGTGATGG + Intergenic
1111330645 13:86759629-86759651 TGTCTTCTGTGAGGCAGTGAAGG + Intergenic
1111723872 13:91980139-91980161 TGTTTTCTCTGTCACAGTGTTGG - Intronic
1114371490 14:22093983-22094005 TGTCTCCTGTGTCAAAGCCAAGG + Intergenic
1114700456 14:24673060-24673082 TGTGTGGTATGTTACAGTGATGG + Intergenic
1117024736 14:51607939-51607961 TGTCTGCTGTGGCCACGTGAAGG + Intronic
1117836468 14:59811987-59812009 TGAATGCTATTTCACAGTGAGGG - Intronic
1125893696 15:43284767-43284789 TCTCTGCTTTGTCCCAGGGAGGG - Intronic
1127854193 15:62941372-62941394 TGCCTGCAGAGCCACAGTGAAGG - Intergenic
1129308837 15:74690462-74690484 TGTCTGATGTGGCACAGAGATGG - Intronic
1129604472 15:77018131-77018153 TCTGTCCTGTGTCACAGTGCAGG + Exonic
1130792487 15:87170242-87170264 TGTGTGCACTGTGACAGTGATGG + Intergenic
1131443287 15:92474934-92474956 TGTCTGCTGTGTGCCAGCTATGG + Intronic
1132041523 15:98528555-98528577 TGCCTTCTGTCTGACAGTGATGG - Intergenic
1135758767 16:25119438-25119460 TGTCAGCTTGGCCACAGTGACGG + Intronic
1142168996 16:88610530-88610552 TCTCTGCTGTGTCCGAGGGAGGG + Intronic
1142928586 17:3262413-3262435 AGTCTTCAGTGTCACTGTGAGGG - Intergenic
1144162937 17:12579298-12579320 TTTCAGATGTGTCACAATGAAGG - Intergenic
1144207312 17:12988276-12988298 TGACTGCTGAGGCACAGGGAAGG + Intronic
1145927060 17:28655903-28655925 TTGCAGTTGTGTCACAGTGAAGG + Intronic
1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG + Intronic
1147658052 17:42102126-42102148 TGTCTCCCGTGTCCTAGTGAGGG + Intronic
1148065220 17:44864270-44864292 TATCTGGTGTGTCAGATTGATGG + Intronic
1153989640 18:10385057-10385079 TGTCTGCTGGTTCTCTGTGATGG + Intergenic
1155916972 18:31566751-31566773 TGTCAGCAGTGTCACAGGGCTGG - Intergenic
1156366165 18:36429242-36429264 TGTCTGCTGTGTCTGTCTGAGGG + Intronic
1157331213 18:46705124-46705146 TCTCAGCTATGTCACAGTGTAGG - Intronic
1159158630 18:64615435-64615457 TTTCTGCTGTGTGTCAGTCATGG + Intergenic
1159617788 18:70601205-70601227 TGTCTGCTGGGACACAGGGAGGG - Intergenic
1168012664 19:53545829-53545851 CGGCTCCTGTGTCACAGTAACGG + Intronic
1168537697 19:57185065-57185087 TGTCTGCTGTGTGCCAGACATGG + Intergenic
925701254 2:6640600-6640622 AGTCTGTTGTGTCACAGAGAGGG - Intergenic
927048262 2:19301954-19301976 TGGCTGCTGGCTCACAGAGAAGG + Intergenic
928637329 2:33261221-33261243 AGTCTGCTGCCTCACGGTGATGG + Intronic
929925131 2:46201417-46201439 GGTCTGCTGGGACACAGAGAGGG - Intergenic
931217595 2:60261104-60261126 TGTTTGCTATGTCAGACTGAGGG - Intergenic
936764017 2:115823106-115823128 TTTCTGCTGTCTCTCAGTCATGG + Intronic
938485787 2:131706407-131706429 TGACTGCTGTGTGTCAGTGAAGG - Intergenic
938830170 2:135042564-135042586 TATCTGGAGAGTCACAGTGAAGG + Intronic
941846836 2:170142081-170142103 TGCCTGCTGTGCCCCTGTGATGG + Intergenic
942029012 2:171939840-171939862 TGACTGCTGTGGCGCAGTCATGG + Intronic
943530683 2:189076705-189076727 AGTCTGTTATGTCACAGTCAGGG + Intronic
943718902 2:191182325-191182347 TGTCTCCTGTGTCAATGTGAAGG - Intergenic
944280379 2:197889227-197889249 TGTCTCCTGTCTCCCAGTGTAGG + Intronic
947791351 2:232871132-232871154 TGGCTTCTGTGTCACAGTAGCGG + Intronic
948366758 2:237460445-237460467 GGTCTTCTGTGTCACACTTAAGG - Intergenic
948938220 2:241182238-241182260 TGTCTGCTGTGTCACAGTGATGG + Intronic
1169263456 20:4153805-4153827 TGTCTGCTGAGTCGAAGTGAAGG + Intronic
1171079130 20:22160318-22160340 TGTCTGCACTGTCACAGACAGGG - Intergenic
1171218338 20:23369945-23369967 TGACTACTCTGTAACAGTGAGGG + Intronic
1172223519 20:33289425-33289447 TGTCTGGGGTGGCACAGGGAAGG + Intronic
1175729388 20:61343452-61343474 TGTCTGCTGTGTATCAGTGTTGG + Intronic
1177403669 21:20638624-20638646 TGTCTTCTCTGTCAGAGAGAGGG - Intergenic
1178728428 21:35076662-35076684 TGTCTGCTGTGTACCTGTGAGGG - Intronic
1179420181 21:41229227-41229249 TGTGTGCTGAGCCCCAGTGAGGG - Intronic
1180705133 22:17804801-17804823 TGTCTGCTGTGTCACTCTCAAGG - Intronic
1180729583 22:17971639-17971661 TGTCTCCTGTGCCCCAGAGATGG + Intronic
1180837592 22:18938120-18938142 TGTCTCATGTGTCCCTGTGAAGG + Intergenic
1180840442 22:18956622-18956644 GGGCTGATGTCTCACAGTGAGGG + Intergenic
1181305863 22:21916895-21916917 TGTCCACTGTGTCACAGAGGGGG - Intergenic
1181593122 22:23896632-23896654 TCTCGGCTGTGTCACAGATAGGG + Intronic
1184303910 22:43581442-43581464 TTTCTTCTGTGTCAGAGTCAAGG - Intronic
1184504298 22:44891649-44891671 TGACTGATGTGTCCCACTGACGG - Intronic
1184529778 22:45047637-45047659 TGTCTGCTGTGTCTCAGGCTCGG - Intergenic
1203287685 22_KI270734v1_random:163419-163441 TGTCTCATGTGTCCCTGTGAAGG + Intergenic
949849717 3:8410777-8410799 TGTCTGCTGGGCCAAAGTGAAGG - Intergenic
950654621 3:14428882-14428904 TCTCTGCTGGGTGACAGTGAGGG + Intronic
952701551 3:36333937-36333959 ACTCTGCTGTGTCAAAGCGATGG - Intergenic
955070501 3:55568812-55568834 GGTCTCATGGGTCACAGTGAAGG - Intronic
955584628 3:60462967-60462989 TCTGTGCTGTGCCACACTGAGGG + Intronic
957590966 3:82197225-82197247 TGTCTGCTGAGTGACAGAAATGG - Intergenic
959965074 3:112345043-112345065 TTTCTGCCATGTCACAATGAGGG - Exonic
961431853 3:126889299-126889321 TGACTGATGTGTCACTGAGAAGG + Intronic
962598959 3:136976195-136976217 TATGTGCTGTGTCTCAGAGAAGG + Intronic
965079560 3:164019840-164019862 TGTTTTCTGTGACGCAGTGAAGG + Intergenic
966130801 3:176636476-176636498 TGTCTGCTGGGTGCCAGTCATGG - Intergenic
967130375 3:186465034-186465056 GGGCTGCTGTTCCACAGTGAAGG + Intergenic
967747978 3:193081310-193081332 GGAATGCTGTGTCACAGTCATGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969607988 4:8211813-8211835 TGTCTGCTGTGTCCCATTCAGGG - Intronic
971695255 4:29893908-29893930 TGTGTGTTGTGTCACATTGTGGG - Intergenic
972791872 4:42380318-42380340 TGTCTGCTGTCTCTCATTTATGG + Intergenic
974055850 4:56982253-56982275 TGTCTTCTCTGTCTCGGTGAAGG + Intronic
975081453 4:70285353-70285375 TGTCTTCTTTGTTACAATGAAGG - Intergenic
980963961 4:139502692-139502714 TCTCTGCTGTGGCAGAGGGAGGG - Intronic
984059886 4:174978551-174978573 TGTCTGCTGTGTTACACTCAGGG + Intergenic
984065038 4:175037137-175037159 TGCTTGCTGTGTCAAAGAGAAGG - Intergenic
984167905 4:176324857-176324879 GAGCTGCTGTGTCACACTGAAGG + Intronic
985288653 4:188363233-188363255 TGTAGGCTGTGTCAGAGGGAAGG - Intergenic
986068363 5:4257942-4257964 TGTCTCCTCTGTCACAATGAGGG + Intergenic
986896537 5:12377457-12377479 TGTGTGCAGACTCACAGTGAGGG - Intergenic
992579937 5:78162818-78162840 TGTCTGCTGTCCAACAGGGATGG - Exonic
993129841 5:83881812-83881834 TGTCTGCTCTCTCACATTGCTGG - Intergenic
995016410 5:107314453-107314475 AGTCTGTTCTCTCACAGTGAGGG - Intergenic
996634366 5:125672301-125672323 TGTCATCTGTGTCACAGTAGGGG + Intergenic
997157280 5:131574029-131574051 TGTGGGTTGTCTCACAGTGAAGG - Intronic
998191112 5:140025271-140025293 CTTCTGCTGTGTTACAGAGATGG - Intronic
998628096 5:143868415-143868437 TGGCTGCTGTATCTCAGGGAAGG - Intergenic
999145651 5:149391554-149391576 AGCCTGCTGTTTCACAGTGCTGG + Intronic
1000508286 5:162149169-162149191 GGTCTCCTATGTCACAGCGATGG + Exonic
1002776960 6:336488-336510 TCTCTGCTCTGCCCCAGTGAAGG - Intronic
1003501036 6:6702973-6702995 TGACTACTGTGTCACAGGCATGG - Intergenic
1004125916 6:12873382-12873404 TATATGCTGTGTCACTGTGCTGG + Intronic
1005042873 6:21615223-21615245 TGTCTGCTGTGCCGTAGAGAGGG + Intergenic
1005391258 6:25335936-25335958 TGTCTGCTCTGTTACTGTGTTGG + Intronic
1005983825 6:30857772-30857794 TGCCTGCTGGGGCCCAGTGAGGG + Intergenic
1006066151 6:31463879-31463901 TGGCTGCTGTCACACAATGAGGG - Intergenic
1006597269 6:35202594-35202616 TGTCTTCTGTGCCCCAGTTACGG + Intergenic
1007051215 6:38832059-38832081 TGTCTCCCATGTCACAGTGATGG + Intronic
1007394108 6:41567570-41567592 TGTCTGCACAGTCACAGAGATGG - Intronic
1008467341 6:51845341-51845363 TTTCTGGGCTGTCACAGTGATGG - Intronic
1010048758 6:71478785-71478807 TGTCTGTTGTCTCAAAGTGGTGG + Intergenic
1011002508 6:82606858-82606880 TGTCCGGCATGTCACAGTGAGGG + Intergenic
1011084028 6:83519280-83519302 TGTATGCTGACTCACAGTGGTGG + Intronic
1013838331 6:114359465-114359487 TGCCTGCTGGGTCACAGTAAAGG - Intergenic
1013880303 6:114891188-114891210 TGACTACTGTGTCACAGTGGAGG - Intergenic
1014611054 6:123546828-123546850 TGTGTGATGTGTCACTGTCATGG - Intronic
1015013603 6:128382099-128382121 TGAGTGCAGTGTCACAGTCATGG - Intronic
1016107891 6:140185494-140185516 TGTCTGCTGTGTTGCTTTGAAGG - Intergenic
1016854431 6:148652351-148652373 TGTCTACTGAGCCACAGTGCAGG - Intergenic
1017794599 6:157832419-157832441 TGTCTGCAGGGGCACAGTGCAGG + Intronic
1018953581 6:168393743-168393765 TGTGTGTGGTGTCACAGTGACGG + Intergenic
1019325292 7:435267-435289 TGTCTTCTGTGTGACATGGAGGG - Intergenic
1019373483 7:676328-676350 GGTCTGCAGGGTCGCAGTGAGGG - Intronic
1021898867 7:25263408-25263430 TGTCTGCTCTGTCTCAGAGCTGG + Intergenic
1021952060 7:25784981-25785003 TTTCTGCTGTGTAACTGAGATGG - Intergenic
1022575362 7:31492243-31492265 TGCCTGCTAGGTCACAGTGTCGG + Intergenic
1022836899 7:34126537-34126559 TGGCTGCTGTGTCACCAAGAAGG + Intronic
1029230224 7:99060750-99060772 TGTGTTCTGTGTCACATGGATGG - Intronic
1030848415 7:114452626-114452648 TTTCTGGTCTTTCACAGTGAAGG + Intronic
1033453037 7:141478439-141478461 CCTCTGCTGGGTCACAGTGATGG + Exonic
1034416334 7:150966131-150966153 TGTGTGTGGGGTCACAGTGAAGG - Intronic
1035944952 8:3952155-3952177 TTTCTGCTCTGTCCCATTGAAGG - Intronic
1035964581 8:4176507-4176529 TGATTGATATGTCACAGTGAAGG - Intronic
1037560706 8:20072283-20072305 TGTCTGGAGAGTCACAGTGTTGG - Intergenic
1037611969 8:20483374-20483396 TCTCTTCTGTGTAGCAGTGAGGG + Intergenic
1039613616 8:38937935-38937957 TGTCTGCTGAGGGCCAGTGATGG + Intronic
1041700571 8:60784516-60784538 TCTGTGCTGTGTCACTGTCAGGG + Intronic
1041990179 8:63978765-63978787 GGGCTGCAGTTTCACAGTGAAGG + Intergenic
1044278501 8:90329540-90329562 TTTCATCTGAGTCACAGTGATGG - Intergenic
1048843367 8:138584140-138584162 TGTGTCCTGTGTCACAGTGTAGG + Intergenic
1049216827 8:141412168-141412190 CCTCTGCTGTGTCACAGAAAAGG - Intronic
1049630545 8:143652995-143653017 TGCCTGCTGTGGCACAGAGCTGG + Exonic
1049698531 8:143995440-143995462 TATCTGCTGTGTCCCAGCCAGGG + Intronic
1050583668 9:7087137-7087159 TGTCAGCTGATACACAGTGATGG + Intergenic
1052133451 9:24880416-24880438 TATCTGGTGTGTCATACTGATGG + Intergenic
1052713647 9:32088784-32088806 GGTCTGCTGTATCTCAGAGATGG + Intergenic
1052837237 9:33260527-33260549 ATTCTGCTGTGTCACAATGCAGG + Intronic
1053862094 9:42397070-42397092 TGGCTACTTTGTAACAGTGATGG + Intergenic
1055392094 9:75833902-75833924 TCTCTGCTGTGGTACAGTAAAGG + Intergenic
1057484136 9:95468913-95468935 GGTGTCCTGTGTCACGGTGACGG + Exonic
1057725810 9:97567469-97567491 TGTATGCTGGGTCCCAGTGGAGG - Intronic
1059599385 9:115759976-115759998 TGTCTGTTGTGTTGCAGTGTGGG - Intergenic
1059620376 9:115998179-115998201 TTTCAGCTGTGACACAGAGAAGG + Intergenic
1060479194 9:124008192-124008214 TGTTTGCTGTGACGCTGTGATGG - Intronic
1060588623 9:124802184-124802206 TCTCTGCTGCATCACAGAGAAGG + Intronic
1061105249 9:128525177-128525199 TAGCTGCTCTGTCAGAGTGACGG - Exonic
1187200217 X:17127522-17127544 TGCCTGCTGTGGCATAGAGAAGG + Intronic
1187343474 X:18442063-18442085 TGTCCTTTCTGTCACAGTGAAGG + Intronic
1187469360 X:19554884-19554906 TTTCTGCTTTCTGACAGTGAAGG + Intronic
1188745099 X:33831485-33831507 GGTCTGCTCTGGCAGAGTGAAGG - Intergenic
1192113003 X:68384220-68384242 TGTCTGCTATGTGACAGTCTGGG - Intronic
1192185064 X:68941126-68941148 TGTGTGTTGTGTCACTGTGTTGG + Intergenic
1196627619 X:117894709-117894731 TGTCTGCTGTTGCAGTGTGAAGG - Intergenic
1197468490 X:126837229-126837251 GTACTTCTGTGTCACAGTGAAGG + Intergenic
1198643009 X:138777271-138777293 TGCCTGGTGTTTCACAGTAAGGG - Intronic
1200149577 X:153944654-153944676 TGTCAGCTGAGTGACAGTCACGG - Exonic
1200905305 Y:8475696-8475718 GGAGTGCAGTGTCACAGTGATGG - Intergenic