ID: 948942553

View in Genome Browser
Species Human (GRCh38)
Location 2:241203578-241203600
Sequence CCCCTGGAGGGCAGCGTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 236}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948942543_948942553 19 Left 948942543 2:241203536-241203558 CCCCCAGCTTGGTGTCAGGTTGT 0: 1
1: 0
2: 1
3: 14
4: 123
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942542_948942553 20 Left 948942542 2:241203535-241203557 CCCCCCAGCTTGGTGTCAGGTTG 0: 1
1: 0
2: 1
3: 18
4: 129
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942537_948942553 30 Left 948942537 2:241203525-241203547 CCACCTGGGCCCCCCCAGCTTGG 0: 1
1: 0
2: 3
3: 39
4: 450
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942546_948942553 16 Left 948942546 2:241203539-241203561 CCAGCTTGGTGTCAGGTTGTAAC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942539_948942553 27 Left 948942539 2:241203528-241203550 CCTGGGCCCCCCCAGCTTGGTGT 0: 1
1: 0
2: 1
3: 27
4: 247
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942544_948942553 18 Left 948942544 2:241203537-241203559 CCCCAGCTTGGTGTCAGGTTGTA 0: 1
1: 0
2: 0
3: 10
4: 74
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942541_948942553 21 Left 948942541 2:241203534-241203556 CCCCCCCAGCTTGGTGTCAGGTT 0: 1
1: 0
2: 1
3: 12
4: 164
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236
948942545_948942553 17 Left 948942545 2:241203538-241203560 CCCAGCTTGGTGTCAGGTTGTAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948942553 Original CRISPR CCCCTGGAGGGCAGCGTGCG TGG Intronic
900244634 1:1631474-1631496 CCCGTGGAGGGTAGCGCGTGAGG - Intergenic
900410589 1:2510853-2510875 CCCCTGCAGGGCAGCGTGACGGG - Intronic
900598223 1:3492108-3492130 CCCGTGCAGGACTGCGTGCGTGG + Intronic
900694209 1:4000071-4000093 CCTCTGGGGAGCAGCGTGTGCGG + Intergenic
901818824 1:11812349-11812371 TTCCTGGAGGGTAGCGTGCCTGG - Intronic
903170755 1:21551697-21551719 GCACTGGAGCGCAGCTTGCGTGG + Intronic
907238848 1:53069642-53069664 CCTCTGGAGGGCAGCCTGGTGGG + Intronic
907409663 1:54275108-54275130 CCCCTTGAGGGCAGGGTCCGTGG + Intronic
907444625 1:54499757-54499779 CCCCTGGTGGGGAGCTTGTGAGG + Intergenic
909035920 1:70593792-70593814 TCTCTGGAGGGCAGAGTGGGGGG - Intergenic
914334791 1:146704524-146704546 CCCCTAGAGGGCTGAGTGCAGGG + Intergenic
915426333 1:155830235-155830257 TCCCTGCAGGGCTGGGTGCGTGG - Intronic
919765126 1:201122206-201122228 GGCGTGGAGGGCAGCGTGAGGGG - Intronic
922205739 1:223444439-223444461 CCCCTGGAGGCCCGCGCGTGGGG - Intergenic
923506693 1:234610782-234610804 CCTCTGGAGGGGAGGGAGCGCGG + Intergenic
923592055 1:235328018-235328040 CCTCTGGAGGGCAGCGCGATTGG - Exonic
924043834 1:240008989-240009011 CCCTTGGAGGGCAGGGTGGAAGG + Intergenic
924382039 1:243474392-243474414 CACCTGGAGGGCAGCCGGCCGGG - Intronic
1063297941 10:4825735-4825757 CCCCTGGGGCACAGGGTGCGCGG - Intronic
1063476093 10:6330341-6330363 GTGCTGGAGGGCAGCGTGGGCGG + Intergenic
1064969310 10:21048185-21048207 CTCTTTGAGGACAGCGTGCGAGG - Intronic
1067346597 10:45442747-45442769 CCACAGGAGGGCAGCAGGCGTGG - Intronic
1067711865 10:48656365-48656387 CCCCTGCCGGGCAGCGCGGGTGG + Intergenic
1069554702 10:69390094-69390116 CACCTGGAAGGCAGCCTGCTGGG - Intronic
1070681738 10:78453619-78453641 CCCCAGCAGGGCAGCCTGCCAGG + Intergenic
1072248999 10:93567144-93567166 CACCTGCAGCGCGGCGTGCGGGG + Exonic
1073646309 10:105307982-105308004 CCTCTGGGGTGCAGCCTGCGAGG + Intergenic
1074165792 10:110872452-110872474 CCCAGGGAGGGCAGGGGGCGGGG - Intronic
1074883455 10:117676461-117676483 CCCCTGGAGAGCAGGGGCCGTGG + Intergenic
1076856060 10:133116097-133116119 CCCCTGCAGAGCGGCGTGGGTGG - Intronic
1077210815 11:1370238-1370260 AGCGTGGAGGGCAGCGGGCGGGG - Intergenic
1077844874 11:6013356-6013378 CCCCTGCAGGGCCGCGAGCTGGG - Intergenic
1079205623 11:18412203-18412225 GCCCTGGAGCGCAGTGTGGGTGG - Intergenic
1081597213 11:44467480-44467502 CCCCTGAGGGGCAGGGTGGGAGG + Intergenic
1081808966 11:45904769-45904791 GTCCTGGAGATCAGCGTGCGGGG + Exonic
1083608954 11:63996042-63996064 CCCCAGGAGGGCTGCGGGCAAGG + Intronic
1084192937 11:67507049-67507071 CCTCTGGAGGGCAGTGGGTGGGG - Intronic
1084636354 11:70395531-70395553 CAGCAGGAGGGCAGCGTTCGTGG - Intergenic
1084704147 11:70806215-70806237 CCATTGGAGGGCAGCATGCCGGG - Intronic
1089339999 11:117750843-117750865 CCCCTGGAGGGCAGGGGCTGGGG - Intronic
1090327770 11:125904167-125904189 CGCCTGGAGGGCTGTGTGAGCGG + Intronic
1091223860 11:133946351-133946373 CCCATGGAGGGCAGCTGGTGGGG - Intronic
1091356265 11:134940156-134940178 CCCCTGGTGGGCTGCTTGCCTGG + Intergenic
1092117939 12:6022737-6022759 CACCTGGAGGGCAGTGGGCATGG + Exonic
1092137207 12:6158505-6158527 CCCCTGGAGGTCAGCAAGAGAGG + Intergenic
1103852702 12:123943614-123943636 CTCCTGAAGGGCAGGGTGTGGGG + Intronic
1104981246 12:132573955-132573977 TCCCTGGGAGACAGCGTGCGGGG + Intronic
1106103847 13:26717168-26717190 CCTCAGGAGGGCAGCGGGCAGGG + Intergenic
1106843437 13:33711124-33711146 CCCCTAGAGGACAGCATGTGTGG - Intergenic
1113863048 13:113502725-113502747 CCACTGGAGGGAGGCGTGCCAGG + Intronic
1114444678 14:22779340-22779362 CCTCTGGGAGGCAGCGTGCATGG + Intronic
1118598469 14:67454089-67454111 CCCCTGGGGGGCAGGGTAGGGGG + Intronic
1119024398 14:71141038-71141060 CCCCTGGGGGGCAGAGTGGAGGG + Intergenic
1119035990 14:71231085-71231107 CCCCTGGAGGCCACCGCCCGAGG + Intergenic
1122715906 14:103696953-103696975 CCCCTGGAGGGAAGGGGCCGAGG - Intergenic
1122795386 14:104203473-104203495 CCCCGTGAGGCCAGCCTGCGAGG - Intergenic
1122837416 14:104436974-104436996 CCCCTGGAGGACAGGGTGTTAGG + Intergenic
1122870804 14:104637428-104637450 GCCTTGGAGTGCAGAGTGCGTGG - Intergenic
1122883772 14:104701531-104701553 CGCCTGGAGGGCAGCGACGGCGG + Exonic
1122885612 14:104709078-104709100 CCCATGGAGGGTAGCGAGGGTGG + Intronic
1123063722 14:105605993-105606015 CCCCTGGAGGCCAGCATGCATGG + Intergenic
1124661508 15:31554135-31554157 CCGCTGGAGGGCAGGGAGGGAGG - Intronic
1126545159 15:49865267-49865289 TTCCTGGAGGGCAGCATGCCTGG + Intronic
1126574213 15:50182123-50182145 CCCCGGGAGGACCGCGTGGGAGG + Intronic
1126849667 15:52789445-52789467 CGCCTGGCGGGCAACGTGAGCGG - Exonic
1128765072 15:70246384-70246406 CCCCTTGAGGTCAGTGTTCGTGG - Intergenic
1129618523 15:77120849-77120871 CACCTGGAGGGTAGAGTGGGTGG - Intronic
1129701445 15:77770819-77770841 GCCCTGGATGGCAGCCTGCCAGG - Intronic
1129906304 15:79190028-79190050 CCCCTTGAAGGCAGCGAGAGGGG + Intergenic
1132224951 15:100133224-100133246 CCCCTGGATGGCACCGAGTGTGG - Exonic
1132604459 16:788023-788045 CCCCTGGAGGGGAGGGTCTGTGG - Intronic
1132731083 16:1362359-1362381 CTCCAGCAGGGCTGCGTGCGCGG - Intronic
1132746621 16:1438891-1438913 AAGCTGGAGGGCAGCCTGCGGGG - Exonic
1132913231 16:2326624-2326646 CCCCTGGAGGGAAGGGTACAAGG + Intronic
1132949499 16:2552962-2552984 CCCCAGGGAGCCAGCGTGCGAGG + Intronic
1132964849 16:2647204-2647226 CCCCAGGGAGCCAGCGTGCGAGG - Intergenic
1133197932 16:4184132-4184154 CCCCTCGGGGACAGCGTGTGAGG + Intergenic
1133303571 16:4797108-4797130 CCCCTGGAGGGCATGGTGTCGGG - Exonic
1137576264 16:49602316-49602338 CCCCTGGAAGGCAGGGTGTGAGG + Intronic
1138178719 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG + Intergenic
1139436797 16:66941166-66941188 GCCCTGGTGGGCTGCCTGCGGGG + Exonic
1139998833 16:71006712-71006734 CCCCTAGAGGGCTGAGTGCAGGG - Intronic
1140474682 16:75233933-75233955 CCCCTGGAGGGCAGAGACAGGGG + Exonic
1140722507 16:77784550-77784572 CCCCGGGAGGGCAGCGACAGTGG + Intergenic
1141697228 16:85625827-85625849 GCCCTGGAGGGCAGCGTCTGGGG + Intronic
1142065096 16:88057794-88057816 GCCCTGGAGTCCAGGGTGCGGGG - Intronic
1142246636 16:88973205-88973227 CGCCTGGAGTGCAGAGTGAGTGG + Intronic
1142395119 16:89827949-89827971 CCCCTGGAGGTCACCTTGCCCGG + Intronic
1144680026 17:17187078-17187100 CCCCTGGAGGGCAGAAGGCAGGG - Exonic
1148180426 17:45601155-45601177 GTCCTGGAGATCAGCGTGCGGGG - Intergenic
1148268474 17:46244739-46244761 GTCCTGGAGATCAGCGTGCGGGG + Intergenic
1148770789 17:50064756-50064778 CCCCAGGAGTGCAGAGAGCGAGG - Intronic
1150295520 17:64005410-64005432 CCACTGGAGGGCAGGGGGTGGGG - Intronic
1150633947 17:66899452-66899474 TCCCTGGAGGGAAGAGTGTGAGG + Intergenic
1151879932 17:76888798-76888820 CCACTGGAGGGCCGCGTTGGTGG + Intronic
1151890298 17:76947472-76947494 CCCATGGAGGGCAGGGCTCGTGG + Intronic
1152223574 17:79082383-79082405 CCCCGTGAGGGAAGCCTGCGGGG + Intronic
1152702306 17:81825165-81825187 CCCCTGGTGGGCAGAGGGGGTGG + Exonic
1152799035 17:82322616-82322638 TCCCTGGAGGGCAGCATGGCAGG - Intronic
1153721409 18:7907225-7907247 CCCCTGGGGGGCAGGGTTTGGGG - Intronic
1154066394 18:11110928-11110950 CACATGGAGGGGAGCTTGCGGGG - Intronic
1156557133 18:38080056-38080078 CTCCTGGAGGGCAGGGTGGAGGG + Intergenic
1158962255 18:62596666-62596688 CCCCTGGAGGGCGGTGCGCCCGG - Intergenic
1160297543 18:77651568-77651590 CCTCGGGTGGGCAGCGTGCCGGG - Intergenic
1160568304 18:79800075-79800097 CACCTGGAGGGCAGCGCGAACGG + Intergenic
1160828423 19:1091420-1091442 CCCCTGGAGGACCCCGTGCCGGG + Intronic
1161483780 19:4524000-4524022 GCTCTGGAGTCCAGCGTGCGGGG - Exonic
1161664532 19:5567594-5567616 CCCCTGGAGAGCGGCGGGGGAGG - Intergenic
1162503706 19:11069623-11069645 CACATGGAGCGCAGCGTGGGTGG - Intergenic
1163019653 19:14475388-14475410 CCCCTGGAGGCCAGCAAGGGCGG - Intergenic
1163103278 19:15109886-15109908 CACCTGGACAGCAGCGTGGGGGG + Exonic
1163310767 19:16513200-16513222 CCCCTGGAAGCCAGCATGCAAGG - Intronic
1163700963 19:18786291-18786313 CCTGCGGAGGGCAGCATGCGGGG + Exonic
1164902946 19:31943505-31943527 CCCCTGGTGGGCAGAGAGCAAGG + Intergenic
1166234060 19:41443090-41443112 CCCCTGGGGAGCTGTGTGCGTGG - Intergenic
1166547025 19:43639870-43639892 CCCCGGGCGGGCAGGGGGCGGGG - Intergenic
1167473851 19:49689310-49689332 CCCCTGGAGGGCGTGGAGCGAGG - Exonic
1167613193 19:50517237-50517259 CCCCTGGAAGGCGGCGGGCCCGG + Exonic
926374066 2:12209399-12209421 TCCCTGGAGGGCAGCACCCGGGG + Intergenic
927604055 2:24470493-24470515 CCCTTGCTGGGCAGCGTACGTGG + Intergenic
927911943 2:26905895-26905917 CACCTGGATGGCGGCTTGCGAGG - Intronic
932219510 2:69989188-69989210 CTCCTGGAGGGCAGGGTTCTTGG + Intergenic
933903072 2:86862704-86862726 CCCTTGGAGGGCTGCGGGAGAGG + Intergenic
933993944 2:87654135-87654157 CCCCTGGAAAGCAGGGTGAGAGG - Intergenic
934720207 2:96568873-96568895 TTCCTGGAGGGCAGAGTGCGGGG + Intergenic
935196435 2:100819576-100819598 CCCCTGGAGGACAGTGTGGAGGG + Intergenic
935777474 2:106486566-106486588 CCCTTGGAGGGCTGCGGGAGAGG - Intergenic
936299921 2:111296779-111296801 CCCCTGGAAAGCAGGGTGAGAGG + Intergenic
936375998 2:111942043-111942065 CCCCAGGAAGGCAGCCTGAGGGG - Intronic
936561225 2:113541570-113541592 GCCCCGGAGGGCGGCGAGCGCGG + Intergenic
936993281 2:118388097-118388119 CCCCTGAAAGGCAGGGTGTGAGG + Intergenic
938260555 2:129892462-129892484 GCCCTGGGGTGCAGCGTGGGAGG - Intergenic
938643886 2:133311390-133311412 TTCCTGGAGGGCAGTGTGCCAGG - Intronic
942046812 2:172104027-172104049 CACCTGGTGGGCAGTGTGCGAGG + Intergenic
946042187 2:216792039-216792061 CCCCTGGAGGGGAGGATGCCTGG + Intergenic
948154337 2:235769223-235769245 CTCCTGGAGGGCACCGTGCCAGG - Intronic
948626943 2:239275217-239275239 CCTCAGGAGGCCAGCCTGCGCGG - Intronic
948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG + Intronic
1168765908 20:381467-381489 CCCCTAGAGGAGGGCGTGCGGGG + Intronic
1170894090 20:20398645-20398667 CACCTGGAGGGCAATGTGCTCGG + Intronic
1172126225 20:32626829-32626851 CCCCTGCAAGGCAGGGTGAGTGG + Intergenic
1173002479 20:39114502-39114524 GTCCTGCAGGGTAGCGTGCGGGG + Intergenic
1173860030 20:46277325-46277347 CCTCTGGAGAGCAGCGGGCCAGG + Intronic
1173916017 20:46709465-46709487 CCCCGGGAGGACAGTGGGCGAGG + Exonic
1174041923 20:47706260-47706282 CGCATGGAGGGCAGCGTTAGAGG - Intronic
1174256897 20:49263410-49263432 ACCCTGGAGTGCACCATGCGTGG - Exonic
1174956721 20:55106052-55106074 TCCCTGGAAGGCAGCATGCATGG + Intergenic
1175503458 20:59466332-59466354 CCCCTGGAGGGCAGAGGTCAGGG - Intergenic
1175986130 20:62764947-62764969 CCCGTGGAGGGCAGCAGTCGAGG - Intergenic
1176015593 20:62929549-62929571 GCCCTGGAGCACAGCGTGGGGGG - Intronic
1176083237 20:63284449-63284471 CCCCTGGAGGGAAGAGGGCACGG - Intronic
1176667411 21:9700300-9700322 CACCTGGAGAGCAGCCTGCCTGG + Intergenic
1177034266 21:16022329-16022351 CCCCTGGAGGGGAGCTGGCATGG - Intergenic
1179081150 21:38171905-38171927 CCCCTGGAGGTCAGCAGGCCAGG + Intronic
1180002162 21:45000113-45000135 TCCCTGTGGGGCAGCCTGCGTGG - Intergenic
1180569374 22:16701151-16701173 CACCTGGAGGGCAGTGGGCATGG + Intergenic
1181006607 22:20016586-20016608 TACCTGGAGCGCAGCGTGGGCGG + Exonic
1181639032 22:24187261-24187283 GGCCTGGAGGTCAGCGTGCAGGG + Exonic
1184607061 22:45580252-45580274 CTCCTGGTGGGGAGCGTGGGAGG + Intronic
1184840059 22:47047401-47047423 CCTGTGCAGGGCAGCGTGCTGGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950576068 3:13832795-13832817 CCCCTGGAATGCAGCCTGGGAGG + Intronic
951149794 3:19275393-19275415 ACAGTGGAGGGCAGCGTGGGGGG - Intronic
951848110 3:27106189-27106211 CCCCTAGTGGGCAGCCTGCTGGG + Intergenic
953723092 3:45373405-45373427 TCCCTGGAGGGCAGAGAGCCTGG + Intergenic
953885610 3:46712865-46712887 CCCCTGAAGGGGAGTGAGCGAGG + Intronic
954660946 3:52226489-52226511 CCCCTGGAGGGCAGAGAGCAGGG - Intergenic
954930525 3:54277122-54277144 GTCCTGCAGGGCAGCGTGTGGGG - Intronic
961384801 3:126517467-126517489 CCCCTGGAGTCCAGGGTGGGCGG + Intronic
968230465 3:197002533-197002555 CCCCTGAAGGGCTGCGCGTGGGG - Exonic
968485792 4:860736-860758 CCCCTCGAGTGCACAGTGCGAGG - Intronic
968485804 4:860782-860804 CCCCTCGAGTGCACAGTGCGAGG - Intronic
968894107 4:3388712-3388734 GCCGTGGAGGGCAGGGTGTGGGG - Intronic
969121524 4:4914766-4914788 CACCTGGAAGGCAGGGTGCAGGG + Intergenic
969427031 4:7130415-7130437 CCCCTGGGCTGCTGCGTGCGGGG - Intergenic
971474106 4:27056397-27056419 CCCCGGGAGAGCTGCGTGCTGGG + Intergenic
972320691 4:37970948-37970970 CCACTAGAGGGCAGCCTGCCTGG + Intronic
973945235 4:55948758-55948780 CCCCTGGAGGTCGGCGCCCGCGG - Intergenic
974794607 4:66732190-66732212 CCCCTGGTGGGCAGTGTTAGTGG + Intergenic
984150452 4:176123672-176123694 CTCCTGGAGGGCGGCATGCCTGG - Intronic
985092717 4:186381162-186381184 CTCCCTCAGGGCAGCGTGCGGGG + Intergenic
985217938 4:187672685-187672707 TCCCGACAGGGCAGCGTGCGGGG - Intergenic
985407399 4:189651305-189651327 CACCTGGAGAGCAGCCTGCCTGG - Intergenic
985427350 4:189843765-189843787 CCCCTGGTGGTCAGCTTGGGAGG - Intergenic
985604769 5:852753-852775 CCCATGGAGGACAGCGAGCCGGG + Intronic
985604850 5:853073-853095 CCCATGGAGGACAGCGAGCCAGG + Intronic
985605371 5:855131-855153 CCCATGGAGGACAGCGAGCCGGG + Intronic
985605589 5:856010-856032 CCCATGGAGGACAGCGAGCAGGG + Intronic
985696758 5:1345186-1345208 CCCCAGGAGGGCGGCGCGGGCGG - Intergenic
985877654 5:2612569-2612591 CCCAGGGAGGGCAGCGTGAGAGG - Intergenic
991093803 5:62718570-62718592 CCCCTGGAGGGTAGGATGTGTGG + Intergenic
991130893 5:63121292-63121314 CCCCTGGAGTGCAGGGAGTGGGG + Intergenic
991404153 5:66285443-66285465 TCCTTGGAGGGCAGCCTGAGTGG + Intergenic
997326530 5:133026451-133026473 CCACTGGAGGGCTGGGAGCGGGG - Intronic
998133097 5:139660906-139660928 CCCCTGAGGGGCAGCTTGCCTGG + Intronic
998139091 5:139689957-139689979 CCCCAGGAGGGCAGGGAGCGAGG - Intergenic
998250273 5:140547832-140547854 CCCCCGGAGGTCAGCGGGCCGGG + Exonic
1001051798 5:168419814-168419836 CCCATGGAGGGCAGCTTGGGTGG - Intronic
1001317054 5:170651077-170651099 CCTCTGAAGGGCAGAGGGCGTGG + Intronic
1002505643 5:179677567-179677589 CCCCTGCACGGCAGCCTGGGCGG + Intergenic
1006129310 6:31859822-31859844 ACCCTGGAGGGCAGCATGGATGG - Exonic
1007394646 6:41570533-41570555 CCCTAGGAGGGCAGAGGGCGGGG + Intronic
1007509561 6:42364747-42364769 CCAGTGGAGGCCAGCCTGCGTGG + Intronic
1007702173 6:43771735-43771757 CCGCGGGAGGGCAGAGAGCGTGG + Intronic
1015601313 6:134913717-134913739 TCCCTGGCGGGCAGGGTGGGCGG - Intergenic
1018845334 6:167551789-167551811 ACCCTCGAGGGGAGCGTGCCCGG - Intergenic
1019014073 6:168867183-168867205 TACCTGGAGGCCAGCGTTCGAGG + Intergenic
1021452961 7:20798592-20798614 CACCTGCTGGGCAGCCTGCGCGG + Intergenic
1022485108 7:30771784-30771806 CCCCAGGAGGGCAGCGGACGGGG - Intronic
1022497538 7:30862440-30862462 CCGCTGGAGTGCAGTGTGCCTGG - Intronic
1022715256 7:32892254-32892276 GCCCTTGAGGGGCGCGTGCGCGG + Intronic
1026846699 7:73702747-73702769 CCCCGGCAGGGCAGCGTGTCGGG + Intronic
1027333207 7:77121776-77121798 GGCGTGGAGGGCGGCGTGCGGGG - Intergenic
1029200437 7:98835733-98835755 CCCCTTGAGGGCAGGGTCGGTGG - Intergenic
1029206113 7:98870166-98870188 CTCCAGGAGGGCAGGGGGCGCGG - Intronic
1029640153 7:101815637-101815659 GCGCTGGAGGGCAGCGCCCGGGG - Intergenic
1029782585 7:102749526-102749548 GGCGTGGAGGGCGGCGTGCGGGG + Exonic
1030111404 7:106030128-106030150 CCTCTAGAGGGCAGCATGTGAGG + Intronic
1031991618 7:128202509-128202531 CCCCTGGAGGACAGGGTCTGTGG + Intergenic
1032316827 7:130845613-130845635 CCCCTGGAGGGCAGGGCATGCGG - Intergenic
1033647802 7:143318601-143318623 CCCATGCAGGGCAGGGTGAGGGG - Intronic
1034269148 7:149795289-149795311 CCCCAGGAGGGCAGCCTGGGTGG - Intergenic
1034282540 7:149864171-149864193 TCCCTGGAGGGCAGGATGGGTGG - Exonic
1034781896 7:153888337-153888359 CCCCAGGAGGGCCGCGTGCCTGG + Intronic
1036255502 8:7203141-7203163 CCACTGGAGGCCAGCCTGGGTGG - Intergenic
1036361988 8:8084362-8084384 CCACTGGAGGCCAGCCTGGGTGG + Intergenic
1036810026 8:11861446-11861468 CCTATGGAGAGCAGCTTGCGTGG - Intronic
1037613290 8:20494750-20494772 CCCCTGAAGGGAAGGGTGAGAGG + Intergenic
1039468955 8:37802015-37802037 CCCTAGGTGGGCAGCCTGCGTGG - Intronic
1040551167 8:48438791-48438813 GGCCTGGAGGGCAGCATGAGCGG - Intergenic
1040639224 8:49313104-49313126 CCCCTGGAGAGCAGCAGGAGAGG + Intergenic
1041109397 8:54470485-54470507 CCCTTGGCGGGCGGCGCGCGCGG + Intergenic
1044569352 8:93700374-93700396 CCCCTGCAGAGCCGCCTGCGCGG - Intronic
1046660759 8:116946212-116946234 GCACTGGAGGGCATCGTGCCAGG - Intergenic
1048854155 8:138672518-138672540 CCACTGGAGGGCAGGGAGCCTGG + Intronic
1049244927 8:141557330-141557352 ACCCTGGAGGGCAGCCAGGGAGG + Intergenic
1049891462 9:73746-73768 GCCCCGGAGGGCGGCGAGCGCGG - Intergenic
1051427704 9:16950428-16950450 TTCCTGGAGGGCAGCATGCCTGG + Intergenic
1053425077 9:38005080-38005102 CCCCTGGAGGGCAGGATGACAGG - Intronic
1055282678 9:74692552-74692574 CGCCTGGGGGGCAGCATGGGAGG + Exonic
1056314174 9:85372513-85372535 TCCCTGGAGGACAGCGTGAAAGG - Intergenic
1059336044 9:113569063-113569085 CCCATGGAGGGCAGGGAGAGGGG - Intronic
1061369766 9:130191762-130191784 GCCCTGGTGGGCAGCCTGCTTGG + Intronic
1061749896 9:132770361-132770383 CCCCTGGACGCCATCGAGCGCGG - Intronic
1061928755 9:133821345-133821367 CCCCTGGAGGGGAGGCAGCGAGG + Intronic
1062230425 9:135479356-135479378 CCGCGGGAAGGGAGCGTGCGGGG - Intronic
1187018689 X:15357333-15357355 CCCATGGAGGGCAGCGTCCTGGG - Intronic
1189327353 X:40120850-40120872 CACCTGGAAGGCAGGGTGTGGGG + Intronic
1190050445 X:47145317-47145339 CCCTGGGAGGGCAGCGCGCTTGG + Exonic
1197424014 X:126272976-126272998 CCCCTGGGGGGAAGTGTCCGTGG - Intergenic
1197766846 X:130065011-130065033 CCCCTGGAGGGCACTGTGTTTGG - Exonic
1200210382 X:154344436-154344458 CCCCTTCAGGGCTGCATGCGGGG - Intergenic
1200220470 X:154387656-154387678 CCCCTTCAGGGCTGCATGCGGGG + Intergenic