ID: 948944904

View in Genome Browser
Species Human (GRCh38)
Location 2:241214619-241214641
Sequence CCGACCTCACAGGAGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948944904_948944913 18 Left 948944904 2:241214619-241214641 CCTGGGGGCTCCTGTGAGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 948944913 2:241214660-241214682 GAGCATCTCTGCAACCCTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 196
948944904_948944914 27 Left 948944904 2:241214619-241214641 CCTGGGGGCTCCTGTGAGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 948944914 2:241214669-241214691 TGCAACCCTCCAGGTGCCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 278
948944904_948944910 -8 Left 948944904 2:241214619-241214641 CCTGGGGGCTCCTGTGAGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 948944910 2:241214634-241214656 GAGGTCGGGAGGGAGTGTTATGG 0: 1
1: 0
2: 0
3: 10
4: 238
948944904_948944911 -5 Left 948944904 2:241214619-241214641 CCTGGGGGCTCCTGTGAGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 948944911 2:241214637-241214659 GTCGGGAGGGAGTGTTATGGTGG 0: 1
1: 0
2: 0
3: 4
4: 106
948944904_948944912 -4 Left 948944904 2:241214619-241214641 CCTGGGGGCTCCTGTGAGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 218
Right 948944912 2:241214638-241214660 TCGGGAGGGAGTGTTATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948944904 Original CRISPR CCGACCTCACAGGAGCCCCC AGG (reversed) Intronic