ID: 948945389

View in Genome Browser
Species Human (GRCh38)
Location 2:241216666-241216688
Sequence CCTGGTAAGGTGACAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948945389_948945406 29 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945406 2:241216718-241216740 GCACGGGTGGTGCACTCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 105
948945389_948945397 -5 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945397 2:241216684-241216706 CCAGGTGGTGGCCAGTGCCAGGG 0: 1
1: 0
2: 6
3: 35
4: 380
948945389_948945395 -6 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945395 2:241216683-241216705 ACCAGGTGGTGGCCAGTGCCAGG 0: 1
1: 0
2: 2
3: 28
4: 261
948945389_948945398 -4 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945398 2:241216685-241216707 CAGGTGGTGGCCAGTGCCAGGGG 0: 1
1: 0
2: 1
3: 34
4: 390
948945389_948945402 13 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945402 2:241216702-241216724 CAGGGGCTCACTGCCTGCACGGG 0: 1
1: 0
2: 3
3: 34
4: 248
948945389_948945405 26 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945405 2:241216715-241216737 CCTGCACGGGTGGTGCACTCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
948945389_948945401 12 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945401 2:241216701-241216723 CCAGGGGCTCACTGCCTGCACGG 0: 1
1: 1
2: 4
3: 33
4: 320
948945389_948945403 16 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945403 2:241216705-241216727 GGGCTCACTGCCTGCACGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 250
948945389_948945407 30 Left 948945389 2:241216666-241216688 CCTACCACTGTCACCTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 948945407 2:241216719-241216741 CACGGGTGGTGCACTCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948945389 Original CRISPR CCTGGTAAGGTGACAGTGGT AGG (reversed) Intronic
900473275 1:2864742-2864764 CCTGGGGAGGTGCCAGTGCTTGG + Intergenic
901327031 1:8373038-8373060 TCTGCTCAGCTGACAGTGGTAGG - Intronic
902217643 1:14944724-14944746 CCTGGGAAGATTACAATGGTGGG - Intronic
902261382 1:15227301-15227323 CTTGGCAATGTGACAGTGGTGGG + Intergenic
903406794 1:23104026-23104048 ACTGGTAAGGTCTCTGTGGTAGG + Intronic
903407138 1:23107236-23107258 CAGCGTAAGGTGATAGTGGTGGG - Intronic
904547091 1:31283616-31283638 TGGGGTAAGGTGAGAGTGGTTGG - Intronic
904825531 1:33271578-33271600 CCTGGTGAGGCGACAGTGGCTGG + Intronic
905229859 1:36508199-36508221 CCTGGTGGGGTGGGAGTGGTGGG + Intergenic
905648437 1:39640291-39640313 CCTGGCGTGGTGGCAGTGGTGGG + Intergenic
906838995 1:49115864-49115886 CCTGGTAATGTGTCGGTGGCTGG + Intronic
907926954 1:58964351-58964373 CCTGGAAAGGAGACAGGGCTGGG - Intergenic
915933044 1:160071906-160071928 CCTGGTGAGGAGACTGAGGTGGG + Intergenic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
919061461 1:192639183-192639205 CCTGGCAAGGGGAGTGTGGTTGG + Intronic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
1062957662 10:1551022-1551044 CCTCAGAAGGTGACAGTGTTTGG + Intronic
1064650009 10:17499622-17499644 CCTGGTCAGGGTACAGTGGGAGG - Intergenic
1065450286 10:25849385-25849407 CCTGGTAAGATGACAGTGTGTGG + Intergenic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1067277145 10:44845970-44845992 CCTGGTAAGCAGACAGTGCCAGG - Intergenic
1075667403 10:124240900-124240922 CCTGGTGAGTTGACACGGGTGGG + Intergenic
1080381347 11:31775299-31775321 TGTGGTAAGGGGGCAGTGGTGGG - Intronic
1087060978 11:93977322-93977344 CCTGGAAAGGGGACAGGGGCTGG - Intergenic
1090077690 11:123589893-123589915 CCTGGCAAGGTGGCAGAGCTGGG + Intronic
1092277216 12:7070464-7070486 GCTGTAAAGGGGACAGTGGTGGG + Exonic
1092491051 12:8945450-8945472 AATGGGAAGGAGACAGTGGTAGG - Exonic
1098481288 12:70964687-70964709 CCTGGTTAGAAGAGAGTGGTTGG + Intergenic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1099882713 12:88486959-88486981 CATGGTAGTGTGATAGTGGTAGG - Intergenic
1102037767 12:109781959-109781981 CCTGGTAAGGTGATATAGTTTGG + Intergenic
1102530662 12:113544082-113544104 ACTGGTAAGGTGGCAGAGCTGGG + Intergenic
1103444217 12:120983430-120983452 CGTGGCTAGGTCACAGTGGTGGG + Intronic
1104013449 12:124947797-124947819 TCTGGTCAGTGGACAGTGGTGGG + Exonic
1104319882 12:127741076-127741098 CCTGGGTAAGTGACAGTGTTGGG + Intergenic
1104678192 12:130729837-130729859 CCTGGGAAGGTGGCCGTGGAGGG + Intergenic
1104961802 12:132491638-132491660 CCTGGAAAAGTGAGAGGGGTTGG - Intronic
1108205581 13:48086263-48086285 ACTGGTAAGTTGACAGAGGTTGG - Exonic
1108459689 13:50652688-50652710 CCTGGTAGGGTGGGAGTGGTGGG - Intronic
1114634003 14:24177405-24177427 CCAGGTAGGGTGTCAGTGCTGGG + Intronic
1118501771 14:66368874-66368896 ACTGATAAGTTCACAGTGGTTGG - Intergenic
1119184018 14:72624640-72624662 CCTGGTAAAGAGACATAGGTTGG - Intronic
1120121942 14:80691454-80691476 GCTGGTAAGGTGATAGTCCTAGG - Intronic
1121457675 14:94049076-94049098 CCTGGTAAGGTGAAGTTGGTGGG - Exonic
1121662139 14:95643090-95643112 ACTGTTAAGGTGACAGTGCATGG - Intergenic
1122577904 14:102753195-102753217 CCTTGTAAGGTTACACAGGTGGG - Intergenic
1122768418 14:104086303-104086325 CCTGGTCAGGCAGCAGTGGTTGG + Intronic
1123024475 14:105418309-105418331 CCTGCTGAGGAGACAGAGGTAGG + Intronic
1125297872 15:38222255-38222277 CCTGGTTAGGTGAGACTGATTGG - Intergenic
1127822825 15:62675195-62675217 CCTGCAAAAGTGACAGTGGTCGG - Exonic
1128914797 15:71549968-71549990 CCTGGTATGGTGTCAGTGCATGG + Intronic
1136403176 16:30029388-30029410 CCTGCCCAGGTGCCAGTGGTTGG - Intronic
1137675693 16:50302765-50302787 CTTGCTAAGGTGGCAGTGGCGGG + Intronic
1138119363 16:54386476-54386498 CCTGTTTAGGTGACAGTTTTAGG + Intergenic
1139846709 16:69926453-69926475 CCTGGGAAGTTGGCAGTGATAGG + Intronic
1139901147 16:70329672-70329694 CCTGGGATGGGGACAGGGGTTGG - Intronic
1140399981 16:74663782-74663804 CCTGCAAAGGGCACAGTGGTTGG + Intronic
1142663304 17:1446397-1446419 CCTGCTATGGTAACAGTGGCTGG - Intronic
1142968343 17:3594855-3594877 CCTGGGAAGGGAACAGAGGTGGG + Intronic
1143335222 17:6167080-6167102 CCTGGGATGGTGGCAGTGGATGG + Intergenic
1143645792 17:8229206-8229228 CCTGGGATGAAGACAGTGGTTGG + Exonic
1147652569 17:42070922-42070944 CCTGGGGAGGTGTCAGTGCTGGG - Intergenic
1147704249 17:42414985-42415007 CCTGGCCTGGTGACAGTGGGAGG - Intronic
1147899528 17:43774938-43774960 CCTGGACAGGAGACAGTGGTGGG + Exonic
1151927719 17:77211122-77211144 AGTGGTGAGGTGGCAGTGGTGGG + Intronic
1156982294 18:43305022-43305044 CCTGGTGAGATAACAATGGTGGG - Intergenic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158739987 18:60130090-60130112 CCTGGTATAGTGACAGTGACAGG - Intergenic
1160872857 19:1285126-1285148 CCTGGTAGGCTGACACAGGTGGG - Intergenic
1161618515 19:5286100-5286122 CCTGGCATGGTGTCTGTGGTTGG - Exonic
1162380623 19:10329635-10329657 CCTGGAAAGGTGGCAGGGGTGGG - Intronic
1162906474 19:13826875-13826897 GCTGGAAAGGTGTCATTGGTAGG + Intronic
1165342619 19:35223726-35223748 CTTGGGAAGGGGCCAGTGGTTGG - Intergenic
1166798571 19:45442698-45442720 CCAGGGAGGGTGACAGGGGTGGG + Intronic
926173583 2:10569621-10569643 CCTGGTGTGCTGACAGTGCTGGG + Intergenic
927505793 2:23613791-23613813 CCTGGTGAGCTGAGAGTGGTGGG - Intronic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
930029631 2:47050155-47050177 GCTGGCAAGGAGCCAGTGGTGGG - Intronic
931456754 2:62415576-62415598 ACTGGAGATGTGACAGTGGTTGG - Intergenic
932419652 2:71594026-71594048 CCAGGTAAGGTCACAGTGGTGGG + Intronic
935038723 2:99404913-99404935 CCTGGTCATGTGATAGTGGCTGG - Intronic
936370138 2:111896991-111897013 CCTGGTGAGGAGCCACTGGTAGG + Intergenic
936638522 2:114286581-114286603 CCTGGTCATGTGACAGTGTGTGG - Intergenic
942575562 2:177360019-177360041 ACTGGTATGGTGAGGGTGGTTGG - Intronic
944414972 2:199471309-199471331 CCTGGGAAGGAGCCAGGGGTAGG - Intergenic
946305922 2:218857065-218857087 TCTTCTAAGGTGATAGTGGTGGG + Intergenic
948116156 2:235495192-235495214 CCTGGTAACCTGTCAGGGGTCGG - Intronic
948269921 2:236666393-236666415 CCTGGGAATATGACTGTGGTGGG + Intergenic
948556226 2:238813368-238813390 CGTGGGAAGGTGACAGTAATGGG - Intergenic
948945389 2:241216666-241216688 CCTGGTAAGGTGACAGTGGTAGG - Intronic
1168921287 20:1538178-1538200 ACTGGTAAGGAGGCAGGGGTGGG - Intronic
1169066624 20:2697654-2697676 CCTGGTAGGAAGACATTGGTAGG - Intronic
1170405162 20:16028067-16028089 CCTGGGAAGGCTTCAGTGGTTGG + Intronic
1170874092 20:20234665-20234687 CCTGGGAAGCTGTCAGAGGTGGG + Intronic
1171046206 20:21810843-21810865 CTTGGGAAGGTGGCAGTGGATGG - Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1176188046 20:63792248-63792270 CCTGGGAAAGAAACAGTGGTTGG + Intronic
1177927377 21:27235261-27235283 CTTTGGAAGGTGACAGTGTTAGG - Intergenic
1178303803 21:31473810-31473832 CCAGCTAAGGTGACAGAGGAGGG - Intronic
1179681167 21:43022255-43022277 CCTGGAGAGGAGACAGTGGGAGG - Intronic
1182354452 22:29716141-29716163 TCTGCTGAGGTGACAGTGCTTGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183308973 22:37099009-37099031 CTTGTGAAGCTGACAGTGGTGGG + Intronic
1183438621 22:37809951-37809973 CCTGGAAAGATGACAGTGCCAGG - Exonic
1185338581 22:50281742-50281764 CCTGGGGAGGCGGCAGTGGTCGG + Exonic
950614163 3:14146159-14146181 TCTGGACAGGTGGCAGTGGTGGG + Exonic
951349454 3:21587820-21587842 CCTGAAAAGGTGAGAGTGGGAGG + Intronic
953957593 3:47243742-47243764 CCTGCTGAAGTGACAGTGCTTGG + Intronic
954200514 3:49020959-49020981 ACTGGTGCGGTGACGGTGGTGGG + Intronic
954412743 3:50378097-50378119 CCTGGGGAGGGGGCAGTGGTGGG + Exonic
954701434 3:52452878-52452900 CCTGGTCAGGTTACCGTGGGTGG - Intronic
954996300 3:54885049-54885071 CCAGGGAAGGTGGCAGTGCTGGG + Intronic
957146153 3:76426379-76426401 CCTGGGAAGGTTACAGAGATTGG + Intronic
960439757 3:117671992-117672014 CCTGGCAAGGTCACACTGCTTGG + Intergenic
968271215 3:197405096-197405118 GCTGGTAAAGTGGCAGGGGTGGG + Intergenic
968326697 3:197823889-197823911 CATGGTATGGTGACAGTGTAAGG - Intronic
969721040 4:8893249-8893271 CCCGGGAAGGGGGCAGTGGTGGG - Intergenic
970775443 4:19669005-19669027 CCTGGGAAGGTGTCAGGGGAGGG + Intergenic
971821722 4:31565886-31565908 CCTGGCAAGCTGTGAGTGGTCGG - Intergenic
975091782 4:70412123-70412145 CCTGGTTAGGTGGCTGAGGTGGG + Intergenic
977805887 4:101297471-101297493 CCATGTAAGGTGACAGAAGTGGG + Intronic
984356759 4:178669984-178670006 CCTCAGAAGGTGACAGTGTTTGG - Intergenic
985573205 5:661789-661811 CCTGGCTAGGTGACAGAGATGGG + Exonic
986436763 5:7741757-7741779 GATGGTATGGTGACAGTGATAGG - Intronic
987372482 5:17206274-17206296 CCTGATACAGTGGCAGTGGTGGG + Intronic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
991488270 5:67160197-67160219 CCTGGTAAGGGCACAGTGCTTGG + Intronic
992993411 5:82308429-82308451 TCTGGAGATGTGACAGTGGTTGG - Intronic
995929339 5:117418551-117418573 CCTGTTTAGGTGAGATTGGTTGG - Intergenic
997537224 5:134632404-134632426 CCTGGTAAGGTGAAGGTGGCGGG - Intronic
1001694935 5:173663050-173663072 TCTGGAAAGGTAACAGTGATGGG + Intergenic
1002442647 5:179272443-179272465 CCTGGGAGGGTGCCTGTGGTAGG - Intronic
1003187185 6:3842092-3842114 CCTGGGAAGGGAACAATGGTGGG - Intergenic
1006556740 6:34873356-34873378 ACTGGTAAGGTCACAGAGCTGGG - Exonic
1010218084 6:73422711-73422733 TCCTGTATGGTGACAGTGGTAGG - Intronic
1013429232 6:110041021-110041043 GCTGGGCAGGGGACAGTGGTTGG - Intergenic
1014908038 6:127054551-127054573 CCTGGCAAAGTGGCAATGGTGGG + Intergenic
1016581957 6:145637900-145637922 CCTAGTGAGGTGATAGTGCTGGG + Intronic
1017777535 6:157691690-157691712 ACTGGTAGGGTGGCAGTGGCAGG - Intergenic
1017777570 6:157691833-157691855 ACTGGTAGGGTGGCAGTGGCAGG - Intergenic
1017777583 6:157691886-157691908 ACTGGTAGGGTGGCAGTGGCAGG - Intergenic
1017777628 6:157692079-157692101 ACTGGTAGGGTGGCAGTGGCAGG - Intergenic
1018152609 6:160954538-160954560 CCTGGGAAGGTGAAAGTTGAGGG - Intergenic
1018882439 6:167898227-167898249 GTTGGTAAGGTCACAGTGATGGG - Exonic
1019059111 6:169242876-169242898 ACTGGGAAGGTGGGAGTGGTGGG - Intronic
1019916274 7:4134732-4134754 CCCGGTAAGCTGACAGTGAGTGG - Intronic
1021245242 7:18253678-18253700 CGTGGTAAGGGGACAGGTGTTGG + Intronic
1023145464 7:37146529-37146551 CCAGGTGAGGAGAGAGTGGTGGG - Intronic
1023779214 7:43640546-43640568 CCTGGGAAGGTGACGGCAGTGGG - Intronic
1026568637 7:71510641-71510663 CCTGGTAAGGAGACACTGTCAGG - Intronic
1031238219 7:119204664-119204686 CCAGGTAAATTGACATTGGTTGG + Intergenic
1031922275 7:127611124-127611146 ACTGGCCAGGTGACAGTGGGAGG + Exonic
1032239474 7:130149704-130149726 CCTGGCAAGGTGACCGGGGGAGG + Intergenic
1033611273 7:142965191-142965213 CCTTGTGAGGTGACAGTTTTGGG + Intergenic
1033839138 7:145352780-145352802 GCTGGTTAACTGACAGTGGTGGG + Intergenic
1034042398 7:147893504-147893526 CCTGGGAAAAGGACAGTGGTAGG - Intronic
1036258138 8:7221339-7221361 CCTGGCGAGGGGCCAGTGGTGGG - Intergenic
1036310187 8:7679935-7679957 CCTGGCGAGGGGCCAGTGGTGGG - Intergenic
1037559418 8:20059316-20059338 CCTGTCAAGGTTACAGTGATGGG - Intergenic
1038613634 8:29074119-29074141 CCTGGGGAAGTGACAGTGGCTGG - Intronic
1038985573 8:32805815-32805837 TCTGTTAAGGTGATAGTGATAGG + Intergenic
1039492189 8:37956125-37956147 CCTGGTGGGGTGGCAGTGATTGG + Intergenic
1039970624 8:42318856-42318878 CCTGGCGAGGTGAGTGTGGTTGG + Intronic
1040006932 8:42628724-42628746 CCTGCTGAGGTGGCAGTGCTGGG + Intergenic
1042048758 8:64684646-64684668 CTTGGTAAGGTGCCATTTGTAGG - Intronic
1042175578 8:66034562-66034584 GTTGGCAAGGTGGCAGTGGTGGG + Intronic
1044364255 8:91324768-91324790 CGTGGTCAAGTGACAGGGGTGGG + Intronic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1049513176 8:143039885-143039907 CCAGGGAAGGTTACAGTGGAAGG + Intronic
1049720422 8:144112998-144113020 CCTGGGCAGGTGACAGTGCCAGG - Intronic
1049766297 8:144356789-144356811 GCTGGTAAGTTGGCATTGGTGGG - Exonic
1051964277 9:22807914-22807936 ACTGGAAAGGTGATAGTTGTGGG - Intergenic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1057066327 9:92055562-92055584 TCTTGTAAGGTGAAAGTGCTGGG - Intronic
1058063672 9:100525651-100525673 TCTGGGAAGGGGACAGGGGTTGG - Intronic
1058426783 9:104882382-104882404 CCTGGCAAGGGGACAGAGGCTGG - Intronic
1062017830 9:134300481-134300503 CCTGCTAAAGAGACAGTGTTAGG - Intergenic
1062242633 9:135548420-135548442 CCAGGAAAGGGGACAGTGGCAGG - Intronic
1187527452 X:20066892-20066914 CCATGTAAGGGGACAGTGGCCGG - Intronic
1189376511 X:40470940-40470962 CCTGGAAGGGAGACATTGGTTGG - Intergenic
1196618652 X:117796914-117796936 GCAGGTTAGGTGACAGAGGTGGG - Intergenic
1197637229 X:128928706-128928728 CATGGTAAGGAGCCAGTGATGGG - Intergenic
1200761500 Y:7043164-7043186 CCTGGGAAGGTGCAAGAGGTTGG + Intronic