ID: 948946890

View in Genome Browser
Species Human (GRCh38)
Location 2:241224934-241224956
Sequence CCCAGCAAGCACCCAAATGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948946876_948946890 24 Left 948946876 2:241224887-241224909 CCAGGGCCCCTCTTGCTGTTTTT 0: 1
1: 0
2: 13
3: 43
4: 354
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946877_948946890 18 Left 948946877 2:241224893-241224915 CCCCTCTTGCTGTTTTTACCTCT 0: 1
1: 0
2: 2
3: 52
4: 476
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946875_948946890 25 Left 948946875 2:241224886-241224908 CCCAGGGCCCCTCTTGCTGTTTT 0: 1
1: 0
2: 0
3: 26
4: 229
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946878_948946890 17 Left 948946878 2:241224894-241224916 CCCTCTTGCTGTTTTTACCTCTG 0: 1
1: 0
2: 1
3: 39
4: 426
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946883_948946890 0 Left 948946883 2:241224911-241224933 CCTCTGTTCCTTGGGGCCTAGTA 0: 1
1: 0
2: 1
3: 5
4: 113
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946884_948946890 -8 Left 948946884 2:241224919-241224941 CCTTGGGGCCTAGTACCCAGCAA 0: 1
1: 0
2: 1
3: 7
4: 119
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946879_948946890 16 Left 948946879 2:241224895-241224917 CCTCTTGCTGTTTTTACCTCTGT 0: 1
1: 0
2: 4
3: 48
4: 470
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129
948946874_948946890 30 Left 948946874 2:241224881-241224903 CCTGGCCCAGGGCCCCTCTTGCT 0: 1
1: 2
2: 7
3: 74
4: 557
Right 948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948946890 Original CRISPR CCCAGCAAGCACCCAAATGG GGG Exonic
900197399 1:1383585-1383607 GCCAGCAAGCCCCCAAATTAGGG - Intergenic
902139595 1:14341680-14341702 CCCTCCTAGCACCCATATGGGGG + Intergenic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
905271127 1:36788269-36788291 CCCAGTAAGCAACAAAATGAGGG - Intergenic
910208163 1:84768046-84768068 CCCACCAAGAACACCAATGGAGG - Intergenic
911846244 1:102754962-102754984 CCAAGCAAGTCCCTAAATGGAGG + Intergenic
914246480 1:145889754-145889776 CTCAGTCAGCCCCCAAATGGAGG - Intergenic
914925372 1:151881472-151881494 CCCAGGGAGCTCCTAAATGGTGG - Intronic
919083302 1:192891650-192891672 CCCAGCAGGCACCCACAGGAGGG + Intergenic
919367157 1:196676410-196676432 CCCAGTAACCACCCAAATGCAGG + Intronic
920860721 1:209704268-209704290 GCCAGCCAGAACCCAGATGGCGG - Intronic
922612336 1:226939903-226939925 CCCAGCAAGCACCAGTCTGGAGG + Intronic
1068879870 10:62036693-62036715 CCCTGCAGAGACCCAAATGGAGG + Intronic
1069808616 10:71142079-71142101 CCCAGGTAGCACCATAATGGAGG + Intergenic
1077424065 11:2466291-2466313 CCCAGCAAGCACCCATCAGGCGG - Intronic
1078930635 11:15909843-15909865 CCCAGCACTCATCCAAATGCTGG + Intergenic
1080933354 11:36837087-36837109 CCTAGGAAGCACTCAAACGGTGG - Intergenic
1080933385 11:36837228-36837250 CCCAGGAAGCACCTGAATGGTGG - Intergenic
1081763227 11:45591582-45591604 CCCAACATGCTCCCAAATGATGG - Intergenic
1084595608 11:70115170-70115192 TCAAGCAAGCAACCAAATGCAGG - Intronic
1084663105 11:70558595-70558617 CCCAGCTAGCATCCCCATGGGGG - Intronic
1086109913 11:83188715-83188737 CCAAGTAAGCAACCTAATGGAGG + Intergenic
1090420344 11:126571075-126571097 ACCAACAAGCACCAACATGGAGG - Intronic
1090833076 11:130433052-130433074 CACAGCAAGCACTCAAAAGATGG - Intergenic
1093850028 12:24025155-24025177 AACAGAAAGCTCCCAAATGGTGG + Intergenic
1094718402 12:33035217-33035239 CCCAGCTCCCACGCAAATGGAGG + Intergenic
1097141815 12:56908633-56908655 CTCAGCAGTCACCCCAATGGAGG - Intergenic
1098313861 12:69173942-69173964 GCCAGGAATCACCCAACTGGGGG - Intergenic
1098910985 12:76208337-76208359 CCCAGTGAGCAGCCAATTGGAGG - Intergenic
1100433976 12:94554684-94554706 CCCAACCATCACCCACATGGTGG + Intergenic
1101987110 12:109455944-109455966 CCCTGCAAGGAGCCAAATGTAGG - Intronic
1103589969 12:121984933-121984955 CCCAGCAAGTGCCCACATGGTGG + Intronic
1106782454 13:33072982-33073004 TGCAGCAAGCACCCAGATGAAGG - Intergenic
1117388666 14:55241943-55241965 CACACCCAGCACCCAGATGGAGG - Intergenic
1117728274 14:58695706-58695728 CCCATCAACCACCCACATGTGGG - Intergenic
1118967859 14:70604822-70604844 CCCAGCAAACCCCAAAAGGGAGG + Intergenic
1120038555 14:79726603-79726625 CCCAGTAAGCACTCTACTGGGGG - Intronic
1121831284 14:97054467-97054489 CTCACCAAGCACTAAAATGGTGG - Intergenic
1129944053 15:79523990-79524012 CAGAGCAAGAACACAAATGGAGG + Intergenic
1137002481 16:35241621-35241643 CCCAGCAACTACAGAAATGGAGG + Intergenic
1141182705 16:81765273-81765295 CCCAGCAACCACCCAAAGCTTGG + Intronic
1141304646 16:82850759-82850781 CTCAGCAGCCACCAAAATGGAGG + Intronic
1142051661 16:87962657-87962679 CCCCGCAAGCACACATTTGGGGG + Intronic
1143376612 17:6471091-6471113 CCCAGCAAACACCCAGAGGAAGG + Intronic
1144365976 17:14545356-14545378 CACAGCAAACACACAAATGGAGG - Intergenic
1148082464 17:44975189-44975211 CCCAGCAGGCACACACCTGGTGG + Intergenic
1150266009 17:63832871-63832893 CCCAGCAAGGACCCAGAGGGTGG + Exonic
1151685132 17:75641828-75641850 CCCAGACAGCACACAAATGGGGG - Intronic
1152280581 17:79382812-79382834 ACCAGCAAGCACCCAAAGCATGG - Intronic
1153671356 18:7415346-7415368 CCCAGGAGGCAGCCAAGTGGTGG + Intergenic
1155141206 18:23046347-23046369 CCCAGAAAGCACAGAAATTGGGG + Intergenic
1156576372 18:38321289-38321311 CCCTGCTAGCACCCTAATCGTGG - Intergenic
1161227068 19:3151613-3151635 CCCAGCAAGGACCCTGCTGGGGG - Intronic
1161668530 19:5591102-5591124 TCCCCCAAGAACCCAAATGGTGG - Intronic
1161955284 19:7490719-7490741 CCCAGAGAGCACACAAGTGGCGG - Intronic
1165423695 19:35734215-35734237 CCCAGCTAGCACCGAGATGAGGG + Intronic
1167634419 19:50646139-50646161 CCAAGGAGGCACCCAAAAGGAGG - Intronic
926633615 2:15158816-15158838 ACCAGCAGGCACAGAAATGGGGG + Intergenic
927076123 2:19579846-19579868 CCCAGGAAGCTCCCAAAGGGAGG + Intergenic
927144289 2:20151497-20151519 CCCAGCTAGCACCAAAATAGAGG - Intergenic
927267117 2:21163215-21163237 CCCAGCAATCACCCAGATGTGGG + Intergenic
927383554 2:22506702-22506724 CCCAGAAAGAAGCCAGATGGAGG + Intergenic
928086560 2:28349885-28349907 CCCAGAAAGCCCCCAGAGGGAGG + Intergenic
929598970 2:43193218-43193240 CCCAGAAAGCACACAAACTGGGG + Intergenic
929855603 2:45636280-45636302 GCCAGTAAGCAAACAAATGGGGG + Intergenic
934552680 2:95271829-95271851 CCCAGCAAGCAGGCAGGTGGGGG - Intergenic
935361978 2:102253000-102253022 CCAAGCAACCACACAAATGGGGG + Intergenic
935418465 2:102842867-102842889 CCAGGCAACCACCCAAAGGGAGG - Intronic
936349277 2:111700691-111700713 ACCAGGAAACACCCACATGGAGG - Intergenic
937008048 2:118535995-118536017 CCCAGCAGGCAGCAAAGTGGGGG - Intergenic
938318270 2:130344941-130344963 CCCAGCAGGCACTCCAGTGGGGG - Intronic
942923801 2:181409435-181409457 CCCAGGATGAACCCAGATGGTGG - Intergenic
946254112 2:218430748-218430770 CCCACCAAGCACACAGGTGGAGG + Exonic
946950294 2:224866994-224867016 CACAACAAGCACCCAGATCGTGG - Intronic
947368594 2:229422472-229422494 CACAGCAACCAACCAGATGGGGG + Intronic
948371668 2:237493592-237493614 CCCAGACAGCACCCATATGATGG - Intronic
948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG + Exonic
1169184334 20:3601331-3601353 CACAGCAAGAACAGAAATGGTGG - Intronic
1173115027 20:40233130-40233152 CACAGCAAGCACCCTTATGCTGG - Intergenic
1173239526 20:41281954-41281976 CCCTGCCAGCACCCTAATGTGGG - Intronic
1174348746 20:49951518-49951540 CCCAGACAGCACACGAATGGAGG - Intronic
1174463920 20:50702522-50702544 CCCGGGAAGCCCCCAAATGTTGG - Intergenic
1176010766 20:62893790-62893812 CCCAGACAGCACCCACATGGTGG - Exonic
1178627258 21:34228390-34228412 CCCAGCAGACAGCCACATGGTGG + Intergenic
1179534056 21:42039987-42040009 CCCAGCAGACTCCGAAATGGCGG - Intergenic
1182254234 22:29026734-29026756 CCCAGCAGGCACAAAAATGCTGG - Intronic
1183896751 22:40975415-40975437 TGTAGCAAGCACTCAAATGGAGG + Intergenic
1184821317 22:46910947-46910969 CCCAGCCAGCACCCACATTGTGG - Intronic
952079564 3:29741552-29741574 CCCAGCAAGAGTCCAAATGAAGG - Intronic
953049440 3:39327567-39327589 CCCTTCAAGCACCCAGAAGGAGG + Intergenic
953694023 3:45144045-45144067 CTTAGAAAGCAACCAAATGGAGG + Intronic
957249036 3:77749468-77749490 GCCAGCAACCATCCAGATGGTGG + Intergenic
960568087 3:119156487-119156509 CCCAGGAAGCACCTGGATGGTGG - Intronic
961468978 3:127099579-127099601 CCCAGCCAGCAACCAACAGGAGG + Intergenic
962404989 3:135092953-135092975 GGCAGCAAGCAGCTAAATGGGGG - Intronic
964816167 3:160719837-160719859 CCCAGGAAGCACCCTGACGGTGG + Intergenic
970365662 4:15355533-15355555 ACTAGCAAGCACCTGAATGGTGG - Intronic
970500320 4:16670420-16670442 CCCAGCAATGACCCCAGTGGTGG - Intronic
971383916 4:26125833-26125855 ACCAGCAGGCACCCTCATGGCGG + Intergenic
972424327 4:38918417-38918439 TCCAGCAAGAAAACAAATGGAGG + Intronic
974867839 4:67602801-67602823 CCCAGCAAGCACAGTCATGGTGG - Intronic
977765754 4:100795930-100795952 CCCAGGAAGCCCCCCAAAGGAGG + Intronic
980434743 4:132756270-132756292 GCAGGCAAGCACCCAAATTGAGG + Intergenic
981750594 4:148089885-148089907 CCCTGCAGGCACCCACATGGAGG - Intronic
983155813 4:164347030-164347052 CCCAGCAAACACTCAGTTGGAGG - Intronic
984836524 4:184027461-184027483 CAAAGCCAGCACCCAGATGGTGG - Intergenic
985927167 5:3027451-3027473 CCCAGCAGGCTCCCTGATGGGGG + Intergenic
989317323 5:40097322-40097344 CCCTGCAAGAACCCAAGTAGAGG - Intergenic
989631198 5:43484178-43484200 CCCACGACGCACCCAAGTGGTGG + Intergenic
991192541 5:63892061-63892083 CACAGTAAGCACTCAAATGTTGG - Intergenic
992253180 5:74896020-74896042 CCCAACAAGTACCCATATGTGGG + Intergenic
993704275 5:91152068-91152090 CCAAGTGAGCACCCAAGTGGTGG - Intronic
1002665161 5:180817908-180817930 CCCAGCAAGCACTCATTAGGTGG + Intergenic
1007165191 6:39824203-39824225 CCCAGCAGGCACAGAACTGGGGG - Intronic
1007484151 6:42169006-42169028 CCCAGCAAGCTCACAGAGGGTGG - Intronic
1012604799 6:101144755-101144777 CCTAGCAAGAAACCAAAAGGAGG - Intergenic
1014028524 6:116675869-116675891 CCCATCAGACATCCAAATGGAGG + Intergenic
1014289202 6:119539371-119539393 CACAGCAGCCACCCAAATTGTGG + Intergenic
1017574908 6:155791521-155791543 CCCAGCAATCACCCATAGGGTGG + Intergenic
1018752796 6:166821998-166822020 CCCAGCACGCACCCAGATCCTGG + Intronic
1020119584 7:5495560-5495582 CCCAGCAAGCACAAAGCTGGGGG + Intronic
1021936036 7:25632308-25632330 CCCAGCAAGCTCCCCACTGGGGG + Intergenic
1026122384 7:67549229-67549251 CACAGCAAGCTTCCAGATGGAGG + Intergenic
1026239232 7:68557592-68557614 CCCTGCAAGCCCTCAAAGGGAGG - Intergenic
1034479540 7:151308907-151308929 GCCAGAAAGCACCCCAAGGGTGG + Intergenic
1037860293 8:22400039-22400061 CCCAACAAGCATCCAAATCTTGG - Intronic
1040746964 8:50655869-50655891 CCCAGCTAGCTCCAAACTGGTGG - Intronic
1043600232 8:81928697-81928719 CCCAGCCAGCACCAGCATGGAGG + Intergenic
1043702916 8:83313170-83313192 CCCAGCAAGCACTCCAATTTCGG - Intergenic
1044237715 8:89850973-89850995 CTCAGCAACCATCCAAATGCAGG + Intergenic
1047103209 8:121703828-121703850 CCCAGGAAGCATCCTACTGGGGG - Intergenic
1047216150 8:122877624-122877646 CACAAAAAGCACACAAATGGTGG + Intronic
1047827765 8:128596069-128596091 CCTACCAAACATCCAAATGGAGG + Intergenic
1048268653 8:133010280-133010302 TCCCGAAAGCACCCAAATGAGGG - Intronic
1048537017 8:135306343-135306365 CCTAGGAAGCAACCAAATAGTGG + Intergenic
1049263701 8:141653593-141653615 CGCAGCAAACACCCAAAGGAGGG - Intergenic
1050105759 9:2164846-2164868 CCCAGAAAGCATCTAAATGTGGG - Intronic
1060827997 9:126697261-126697283 CCCAGCCTGGGCCCAAATGGGGG + Exonic
1061641117 9:131956929-131956951 GCCAGTAAGCACCTAAAAGGAGG + Intronic
1061848955 9:133403499-133403521 CCCTGCCAGCACCCAAAGTGTGG + Intronic
1189255027 X:39631305-39631327 CTGAGCAACCACCCAATTGGTGG + Intergenic
1190430270 X:50371997-50372019 TCCAGAAAACAACCAAATGGTGG + Intronic
1194888479 X:99348470-99348492 CCCAGGAAGCACCCAGAATGTGG - Intergenic
1195252585 X:103063543-103063565 CTCGGCAGGCACCAAAATGGAGG + Intronic
1195278772 X:103310216-103310238 CTCTGCAGGCACCAAAATGGAGG + Intronic
1200920786 Y:8611091-8611113 CCTGGCAAGCTCCCAATTGGAGG + Intergenic