ID: 948947091

View in Genome Browser
Species Human (GRCh38)
Location 2:241226216-241226238
Sequence CACCAAGCAGAGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 213}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948947083_948947091 3 Left 948947083 2:241226190-241226212 CCATCCAGAGTAGCCACCACCTT 0: 1
1: 0
2: 1
3: 14
4: 147
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947084_948947091 -1 Left 948947084 2:241226194-241226216 CCAGAGTAGCCACCACCTTAGCC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947080_948947091 10 Left 948947080 2:241226183-241226205 CCCTTTCCCATCCAGAGTAGCCA 0: 1
1: 0
2: 1
3: 22
4: 222
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947076_948947091 26 Left 948947076 2:241226167-241226189 CCTACCCTGCCTGTGACCCTTTC 0: 1
1: 1
2: 4
3: 44
4: 425
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947079_948947091 17 Left 948947079 2:241226176-241226198 CCTGTGACCCTTTCCCATCCAGA 0: 1
1: 0
2: 4
3: 22
4: 226
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947082_948947091 4 Left 948947082 2:241226189-241226211 CCCATCCAGAGTAGCCACCACCT 0: 1
1: 0
2: 2
3: 11
4: 140
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947077_948947091 22 Left 948947077 2:241226171-241226193 CCCTGCCTGTGACCCTTTCCCAT 0: 1
1: 0
2: 2
3: 40
4: 337
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947085_948947091 -10 Left 948947085 2:241226203-241226225 CCACCACCTTAGCCACCAAGCAG 0: 1
1: 0
2: 4
3: 21
4: 254
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947081_948947091 9 Left 948947081 2:241226184-241226206 CCTTTCCCATCCAGAGTAGCCAC 0: 1
1: 0
2: 2
3: 22
4: 225
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947075_948947091 27 Left 948947075 2:241226166-241226188 CCCTACCCTGCCTGTGACCCTTT 0: 1
1: 0
2: 3
3: 33
4: 414
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213
948947078_948947091 21 Left 948947078 2:241226172-241226194 CCTGCCTGTGACCCTTTCCCATC 0: 1
1: 0
2: 3
3: 26
4: 320
Right 948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG 0: 1
1: 0
2: 4
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948947091 Original CRISPR CACCAAGCAGAGATGGAACT GGG Intergenic
900416029 1:2535069-2535091 CACCAGGCAGGTATGGAACATGG + Intergenic
901895709 1:12310242-12310264 CAGCAACCCGAGATGGCACTTGG + Intronic
902268211 1:15284149-15284171 CACCAAGGAGAGAAGGCTCTAGG - Intronic
903582293 1:24380651-24380673 CACCAAGCACAGAGTGAAGTAGG - Intronic
906381022 1:45332242-45332264 AACCAAGCAGCCATGGAGCTAGG - Exonic
906781618 1:48577716-48577738 CATCCAGCAGAGCTGCAACTGGG + Intronic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
908398820 1:63751147-63751169 CACCCAGCAGAGGTGCAAGTAGG - Intergenic
908411118 1:63866511-63866533 CACCAAGTATAGATGGGAATTGG + Intronic
910853974 1:91676288-91676310 CATCAAGCAGATAGGGAGCTAGG - Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
913070367 1:115293174-115293196 CAGCAAACAGAAGTGGAACTCGG + Intronic
915841802 1:159219043-159219065 CACCAAGGAGAGGTGGCACCTGG + Intergenic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917405506 1:174702204-174702226 CACCATGCAGAGTGGGAACTTGG - Exonic
917494426 1:175527139-175527161 AACCAAGCAGACATGGAAGGTGG - Intronic
919772725 1:201172999-201173021 CACCCAGCAGGGATGGGCCTGGG + Intergenic
919813232 1:201422075-201422097 GACTGAGCAGAGATGGGACTGGG + Intronic
919939039 1:202273853-202273875 CAACAAGGAGAGATGGAAAGGGG - Intronic
920200265 1:204255907-204255929 GACCTAGGAGAGATGGCACTGGG - Intronic
920728967 1:208464721-208464743 CCCCAAGAAGAGATGCAACAAGG - Intergenic
920812586 1:209301309-209301331 CACCAAGCTGAGATTAAACATGG + Intergenic
921742991 1:218707748-218707770 CACCAAGAAGAGTTGCAACATGG + Intergenic
922105007 1:222506019-222506041 CACAAAGCAGAGCTAGATCTAGG + Intergenic
922941212 1:229468232-229468254 CACCAATCAGAGATTGATTTTGG + Intronic
924383640 1:243484047-243484069 CACCAGGCAGCTATGCAACTTGG - Intronic
1063066722 10:2617584-2617606 CTCCAAGCAGAGATGAAAATAGG + Intergenic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1063585356 10:7347303-7347325 CACCATGCAGACATGGAATTTGG + Intronic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1066474442 10:35731345-35731367 CACCAAGCTCAGATGGACATTGG - Intergenic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1067759862 10:49036758-49036780 CACCCAGCAGATGTGGAACAAGG + Intronic
1067763446 10:49068253-49068275 AGCCAAGCAGAGATGGTACTGGG + Intronic
1068234303 10:54213203-54213225 TGCCAGGCAGAGATGGGACTGGG - Intronic
1070332687 10:75429752-75429774 CACCAAGCAGAGACAGCAGTAGG + Intergenic
1071561919 10:86651804-86651826 CACCAGCCAGAGTTGGGACTGGG + Intergenic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1073489919 10:103846299-103846321 CAGCAGGGAGAGATGGGACTGGG + Intronic
1074536795 10:114333868-114333890 CACCAAGTAGAGATGTCTCTGGG + Intronic
1075788678 10:125067945-125067967 CACCAAGGAGAGGTGAAATTGGG - Intronic
1079626669 11:22625137-22625159 CCCCAAGAAGAGTTGGAACCCGG - Exonic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1084534149 11:69746926-69746948 CAGCAAGCAGAGAGGGAAGGTGG - Intergenic
1085023088 11:73221349-73221371 CACCAAGCTGAGGTGAAACCTGG + Intronic
1085232016 11:74980437-74980459 CTCCAAGCTGAGGAGGAACTTGG - Intergenic
1086294048 11:85345540-85345562 CACCTGGCAGAAATGGAACCAGG + Intronic
1088063692 11:105689190-105689212 CACCAAGAAGAGATGGAATTTGG + Intronic
1089649705 11:119904821-119904843 GACCAAGCAGAGAGGGAAACAGG - Intergenic
1103222589 12:119258165-119258187 CATCAAGAAGAGCTGGAAATGGG - Intergenic
1104161703 12:126187365-126187387 CACAAAGCAGAAATTGCACTAGG - Intergenic
1104357622 12:128101634-128101656 GACCATGCAGAGATGGAGCCAGG - Intergenic
1104373476 12:128244189-128244211 CAGCAAGGAGAGAGGGACCTCGG - Intergenic
1104388369 12:128370606-128370628 CACCAAGAAAAGGGGGAACTTGG + Intronic
1105445963 13:20457194-20457216 TACCAAGGAAAGATGGGACTTGG - Intronic
1105833949 13:24192369-24192391 CACCAAGCAGAGCTGCAAGGAGG - Intronic
1106689470 13:32098420-32098442 CACCTAGCAGGGATGGTGCTCGG + Intronic
1108211554 13:48144669-48144691 TACCCAGCAGATATGGGACTGGG - Intergenic
1111906183 13:94258907-94258929 CATCAAACAGAGATGTAACAAGG + Intronic
1116806212 14:49496108-49496130 CTCCAAGTAGAAATGTAACTTGG - Intergenic
1117214202 14:53533360-53533382 CACAAAGTAGACTTGGAACTAGG + Intergenic
1119445845 14:74662738-74662760 CACCAAGCAGAGAGAGAATCAGG + Exonic
1121667346 14:95683396-95683418 AAATAAGCAGAGCTGGAACTTGG + Intergenic
1123757504 15:23408309-23408331 CAACAAGCAGGGGTGGGACTTGG + Intergenic
1126067482 15:44837228-44837250 CATCAAGGAGAGATGGGATTGGG + Intergenic
1127209520 15:56758816-56758838 CAAGAAGGAGAGATTGAACTTGG - Intronic
1127532827 15:59861877-59861899 CACAAAACAGAGCTGGAAATGGG + Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128312877 15:66642396-66642418 CACCAAGAAGTGAAGCAACTTGG - Intronic
1130927239 15:88394814-88394836 CAGAAAGGAGAGATTGAACTGGG - Intergenic
1131143365 15:89996038-89996060 CAGAAAGCAGAGGTGGACCTAGG - Intergenic
1131482879 15:92797025-92797047 CATATAGCAGAGATGGAACAAGG - Intronic
1134315232 16:13112884-13112906 CTGCAAGCTGAGATGGAATTAGG - Intronic
1134572886 16:15306753-15306775 CACCCAGCAGTGTTGGACCTTGG - Intergenic
1134729498 16:16449229-16449251 CACCCAGCAGTGTTGGACCTTGG + Intergenic
1134750711 16:16622844-16622866 CACCAAGCAAGGATAGAACCAGG - Intergenic
1134875060 16:17690777-17690799 CACCAAGGAGGGATGGAGCTGGG + Intergenic
1134937937 16:18262621-18262643 CACCCAGCAGTGTTGGACCTTGG - Intergenic
1134994744 16:18730746-18730768 CACCAAGCAAGGATAGAACCAGG + Intergenic
1136057359 16:27700358-27700380 AACCAAGCAAAGATGGTCCTGGG - Intronic
1137562366 16:49511003-49511025 CTCCAGGCAGAGATGGCACTTGG - Intronic
1138857393 16:60710843-60710865 CACCAAGGAGATATGTCACTTGG - Intergenic
1140801631 16:78493757-78493779 CATACAGAAGAGATGGAACTAGG + Intronic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1143058206 17:4178238-4178260 CATGAAGGTGAGATGGAACTTGG - Intronic
1144507274 17:15843173-15843195 CACCAAGCAGAGAACAAACTGGG - Intergenic
1144578179 17:16443064-16443086 CCCCTAGCATAGATGGAACTGGG + Intronic
1145119174 17:20241206-20241228 CACCAGGCAGAGAAGAAACTGGG - Intronic
1145171402 17:20660778-20660800 CACCAAGCAGAGAACAAACTGGG - Intergenic
1145201726 17:20951561-20951583 CACCAAGCAGAGAAGAAACTGGG - Intergenic
1147910008 17:43849711-43849733 CAGCAGGAAGTGATGGAACTGGG + Intronic
1149836211 17:59915355-59915377 CACCAAGCAGAAATAAAAATAGG - Intronic
1150174736 17:63040373-63040395 CATCAAGCATAGATGAAACATGG + Intronic
1153414524 18:4832063-4832085 CACCAAGCAGGGTAAGAACTTGG - Intergenic
1153414539 18:4832140-4832162 CTCCAGGCAGAGCTGGAATTGGG - Intergenic
1153646202 18:7198252-7198274 CAACACGCAGACATGGAACTGGG + Intergenic
1156604938 18:38655172-38655194 CTCCCACCAGAAATGGAACTTGG + Intergenic
1157108188 18:44794358-44794380 CACCACCAAGAGGTGGAACTGGG + Intronic
1157378797 18:47192007-47192029 CACAAAGCAGGAATGGAGCTTGG + Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1159616825 18:70591006-70591028 CTCCAAGCATTGATGGTACTTGG - Intergenic
1159984550 18:74826694-74826716 CCCCAAGCAGAGCGGGAATTTGG + Intronic
1160401336 18:78613542-78613564 CACCTAGCATAGTTGGGACTGGG - Intergenic
1162834412 19:13306898-13306920 GACCAAGCAGAGAAGCAACAGGG - Intronic
1162918908 19:13889024-13889046 CACCCAGTAGAGCTGCAACTCGG + Intronic
1166221007 19:41364463-41364485 CACAAATCAGAGATTGAACCAGG + Intronic
1166657559 19:44623341-44623363 CACATAGCAGAGAGGGAGCTGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
1167932022 19:52873740-52873762 CACCAGGCATGGATGGAAATGGG - Intronic
925114748 2:1369256-1369278 CACCAAGGAGGGAAGAAACTGGG + Intergenic
926002177 2:9342452-9342474 CCACAAGCAAAGAAGGAACTTGG + Intronic
926698950 2:15789995-15790017 CACCAGGCAGAGAGGAAAATAGG - Intergenic
927140400 2:20126361-20126383 CAGCACTCAGAGATGGAGCTGGG - Intergenic
930553207 2:52861808-52861830 CATCAAGCAGCCATGGACCTGGG - Intergenic
932448035 2:71792520-71792542 CACCAAGCAGAATTAGGACTGGG + Intergenic
933301134 2:80542707-80542729 CAGCAAGCAGGGATGGTACGGGG + Intronic
933782554 2:85812415-85812437 CACTTGGCAGAGCTGGAACTGGG - Intergenic
934163212 2:89271859-89271881 CTCCAGGCAGAGCAGGAACTGGG + Intergenic
936667321 2:114611154-114611176 CACCAAGCAGAAATGGGAATCGG + Intronic
936824527 2:116565144-116565166 CAACAAGAAGAGAAAGAACTGGG - Intergenic
937182593 2:120009988-120010010 CTCCTATCAAAGATGGAACTGGG - Intergenic
937401867 2:121591218-121591240 CACCATGCAGAAAAAGAACTTGG + Intronic
937593387 2:123642844-123642866 CACAAAGAAGTGATTGAACTGGG + Intergenic
937910196 2:127071938-127071960 CACAAGGCAGAGAGGGGACTCGG + Intronic
938576605 2:132609965-132609987 TACCAAGCAGAGACAGAAGTTGG - Intronic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
939103339 2:137921166-137921188 CAAGAAGCAGGGATGGTACTAGG + Intergenic
939416254 2:141901756-141901778 CAGCAAGAAGAAATGGAAGTAGG + Intronic
940739283 2:157488858-157488880 CACCGAGGAGAAATGAAACTTGG - Intronic
941748510 2:169111760-169111782 CAGCATGCAGAGGTGGAACCTGG - Intergenic
942699960 2:178695574-178695596 GATCAAGCAGAGATGCAACAAGG + Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947536173 2:230941589-230941611 CACCAAGCAGAGCTGGACTGTGG + Intronic
948088234 2:235268102-235268124 CTCAAAGCAGAGATGGACGTGGG - Intergenic
948908010 2:240989047-240989069 CCCCAGGCAGAGCTGGAACCAGG + Intronic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1168827390 20:823028-823050 CTCCAGGCAGAGATGGACCAGGG + Intergenic
1168990568 20:2092248-2092270 CACTAAAAAGCGATGGAACTTGG - Intergenic
1169824307 20:9749858-9749880 CAGCAAGGAGATATGGAACTTGG - Intronic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1174274386 20:49393122-49393144 CAGCAGGCAGAGATGGGAGTAGG + Intronic
1175569129 20:60005931-60005953 CCCTAAGCAGGGAGGGAACTTGG - Intronic
1176878657 21:14164775-14164797 CACCAAGTAGACATGAAACATGG - Intronic
1177585774 21:23092452-23092474 AACAAAGCTGAGCTGGAACTGGG + Intergenic
1177710139 21:24763345-24763367 CACCAAGAAGGGAAAGAACTTGG - Intergenic
1178689072 21:34736151-34736173 CACAGAGCAGAGAAGCAACTAGG - Intergenic
1179521208 21:41946396-41946418 CACCAAGGGGAGATGGTGCTAGG - Intronic
1181944047 22:26501653-26501675 TGCCTAGCAGAGAAGGAACTTGG + Intronic
1182845946 22:33431014-33431036 GACCAAGAAGGGCTGGAACTTGG - Intronic
950451011 3:13065739-13065761 CACCCAACAGAAATGGAACCAGG + Intronic
950505176 3:13390142-13390164 CACCATGCAGTCATGGCACTAGG - Intronic
951847616 3:27101521-27101543 CATTAAGCAGAGATGAAAGTAGG - Intergenic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
952382869 3:32818100-32818122 CAGCAAGCAGATCTGGAAATCGG - Exonic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953935430 3:47037697-47037719 CATGAAGCTGAGATGGACCTGGG - Exonic
955157638 3:56432897-56432919 CACCAATTAGAGATGAAGCTGGG + Intronic
955205576 3:56892963-56892985 CACAAAGCAGAGATGAAAAATGG + Intronic
959312278 3:104754501-104754523 CACCAAGCAGAGACTGAGATAGG - Intergenic
959453284 3:106529063-106529085 CACCATTCAGAAATGAAACTTGG + Intergenic
960653606 3:119978884-119978906 CATCAAGCTGAGAAGAAACTGGG - Intronic
962982416 3:140502455-140502477 CACCAAGCAGAGGTGGTCTTTGG + Intronic
963552954 3:146747728-146747750 CACCAAACACAGATGGAAACTGG - Intergenic
967380065 3:188847918-188847940 CATGAAGCAGAGCTGGAACTAGG + Intronic
967988873 3:195116517-195116539 CAGCAAGAAGGGAGGGAACTTGG + Intronic
968725518 4:2246144-2246166 CACCAATCATACATGGAACTGGG + Intergenic
968863531 4:3192371-3192393 CAGGAAGCAGAGATGAGACTGGG - Intronic
969262262 4:6041458-6041480 CTCCAAGGAGAAATGGAAATGGG - Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
969405760 4:6990601-6990623 TCCCATGCAGAGATGGAACTTGG + Intronic
969627937 4:8317148-8317170 CACCAAGGGGAGAGGGAGCTGGG + Intergenic
970197983 4:13572154-13572176 CAGCAAGAAGAGATGAAAATGGG + Intronic
970702331 4:18757031-18757053 CACCAAAGAGAGATGGGAGTGGG - Intergenic
973729519 4:53810309-53810331 CACCAATCTGAAATGGAACTTGG + Intronic
974165140 4:58191575-58191597 CACCCAGCAGAGCTGGTACTGGG - Intergenic
976869618 4:89775267-89775289 CACCTAACAGAAATGTAACTTGG - Intronic
977755102 4:100660558-100660580 CGCTAATCAGTGATGGAACTTGG - Intronic
979255534 4:118604141-118604163 CGCAAAGCAGAGCTAGAACTAGG - Intergenic
981694441 4:147545910-147545932 CATCAAGGAGAGCTAGAACTGGG - Intergenic
982005026 4:151055275-151055297 AACAAAACAGAGATGGAAATAGG + Intergenic
987207923 5:15646457-15646479 CACCAAGTTGAGCTGGAACCAGG + Intronic
989765321 5:45075976-45075998 CACCAAGAAGTGAGGGATCTGGG - Intergenic
990546807 5:56830357-56830379 CAAGAAACAGAGACGGAACTTGG - Intronic
992439821 5:76788361-76788383 CAAAAAGCAGAGAAAGAACTCGG + Intergenic
995232190 5:109779787-109779809 CACCAAACAGAGAGTGATCTTGG - Intronic
995509376 5:112892913-112892935 CACCAAGCAGAGGAAGAAATAGG + Exonic
998853308 5:146371458-146371480 CACCAGCCAGAGATGAAATTGGG - Intergenic
999709549 5:154305004-154305026 CACAAAGGAGAAATAGAACTGGG + Intronic
999963500 5:156783193-156783215 CAGCAGTCAGAGATCGAACTGGG + Intergenic
1001516108 5:172356297-172356319 CTTCAAGCAGAGCTGGATCTGGG - Intronic
1001792070 5:174466278-174466300 CAGCAATCCGAGATGGACCTGGG + Intergenic
1007890082 6:45281264-45281286 CACCAAGCATAAATCGAAGTAGG + Intronic
1010390384 6:75330247-75330269 CAGAAATCAGAGTTGGAACTAGG - Intronic
1012791258 6:103699648-103699670 CACCTATCAGAAATGTAACTAGG + Intergenic
1014930269 6:127327142-127327164 CACCTGCCAGAGATGGAAGTGGG + Exonic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1023033703 7:36112295-36112317 AACCAAGCAGGGATGGAGTTGGG - Intergenic
1023397626 7:39765996-39766018 CACAAAGCAGAGCTAGATCTAGG - Intergenic
1026420406 7:70230959-70230981 CAGGAAGCAGGGGTGGAACTAGG + Intronic
1031105038 7:117530314-117530336 CACAAAGCAGAGCTGGGAATGGG - Intronic
1032529136 7:132605575-132605597 AGCCAGGCAGAGTTGGAACTTGG + Intronic
1033455069 7:141495744-141495766 CAACACACAGAGATGGACCTTGG - Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1036560104 8:9894423-9894445 CTCCAGGCAAAGCTGGAACTTGG - Intergenic
1038367630 8:26952824-26952846 CTCCAAGCAGAGAAGGATCAGGG - Intergenic
1039371452 8:36988013-36988035 CACCAAGCAGGAAAGGAAATGGG - Intergenic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1040810033 8:51441430-51441452 GACCAAGCAGACATCTAACTAGG - Intronic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1041454417 8:58042366-58042388 CATCATGCAGAGATGAAATTAGG + Intronic
1045331225 8:101157424-101157446 CACCCAGGAGAGAGGGAACCGGG - Intergenic
1045363397 8:101453616-101453638 CACCAAAAAGAGATGCAACGTGG - Intergenic
1045779628 8:105848305-105848327 CCCCAAAGAGAGAAGGAACTCGG + Intergenic
1048874012 8:138822555-138822577 AACCTTGCAGAGATGGAACAAGG - Intronic
1049609030 8:143544279-143544301 CACCTAGCCCAGATGGATCTAGG + Intergenic
1050522607 9:6517332-6517354 CCCCAAGTAGAGATTGAAGTAGG - Intergenic
1050931309 9:11330677-11330699 CACCAGGCAGGGGTGGAGCTGGG - Intergenic
1052357967 9:27525477-27525499 AACCAAGCTGAGAAGGAAATGGG - Intronic
1058768894 9:108211229-108211251 AAGCAAGCAGTGAGGGAACTAGG + Intergenic
1059095401 9:111408002-111408024 CAACAAGCCGAGAAGGAAGTAGG + Intronic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1061043240 9:128151457-128151479 CACCCAGCCGAGATGGGCCTGGG - Intronic
1062031094 9:134362332-134362354 CCCCAGGGAGAGATGGGACTTGG - Intronic
1203779849 EBV:95315-95337 CACCAGACAGAGATGCTACTGGG - Intergenic
1186068667 X:5793884-5793906 CAACCAGGAGATATGGAACTAGG + Intergenic
1187007183 X:15244026-15244048 CATATAGCAGAGATGGAACCAGG + Exonic
1188028489 X:25236670-25236692 CCTAAAGGAGAGATGGAACTTGG + Intergenic
1192036398 X:67567480-67567502 CTCCGTGCAGAGATGGAAGTGGG + Intronic
1194337005 X:92660361-92660383 AACCAAGCAGAAATGTAATTAGG - Intergenic
1197984826 X:132256265-132256287 CACCAAGCAGAAAGGGACCTGGG - Intergenic
1200227166 X:154424635-154424657 CACCATGCATTGATTGAACTAGG + Intergenic
1200645438 Y:5777097-5777119 AACCAAGCAGAAATGTAATTAGG - Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic