ID: 948948505

View in Genome Browser
Species Human (GRCh38)
Location 2:241234122-241234144
Sequence CATTATTAGCAGATAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948948505_948948509 -6 Left 948948505 2:241234122-241234144 CCTTCCATTATCTGCTAATAATG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 948948509 2:241234139-241234161 ATAATGAGAACCAGGGAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 229
948948505_948948511 7 Left 948948505 2:241234122-241234144 CCTTCCATTATCTGCTAATAATG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 948948511 2:241234152-241234174 GGGAACTTGGCTGCTCCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 125
948948505_948948512 10 Left 948948505 2:241234122-241234144 CCTTCCATTATCTGCTAATAATG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 948948512 2:241234155-241234177 AACTTGGCTGCTCCACAAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948948505 Original CRISPR CATTATTAGCAGATAATGGA AGG (reversed) Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
909053120 1:70791426-70791448 CATAATTAGGAGATAATGTTTGG + Intergenic
909501870 1:76343818-76343840 CATGTTTATCATATAATGGAAGG - Intronic
911552860 1:99305783-99305805 CATTTTTAGCAGATAAAAGTCGG - Exonic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911931932 1:103915328-103915350 GACTATAAGAAGATAATGGAAGG + Intergenic
912573210 1:110639955-110639977 CTTCATCAACAGATAATGGAAGG + Intergenic
913999980 1:143685638-143685660 CATCTTTAACAGATAATGGAAGG + Intergenic
914195164 1:145444447-145444469 CATCTTTGACAGATAATGGAAGG + Intergenic
914476435 1:148027023-148027045 CATCTTTGACAGATAATGGAAGG + Intergenic
919321249 1:196042056-196042078 CAAATTTAGCAGATAAGGGAAGG + Intergenic
920056808 1:203198757-203198779 CCTTATGAGCGGATGATGGAGGG + Intergenic
920560658 1:206936070-206936092 TATTCTGAGCAGAGAATGGAAGG + Intronic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
922650061 1:227330140-227330162 CATTATGAGAAGTTAAGGGAAGG - Intergenic
923641853 1:235771051-235771073 CATTATTGCCAGATAATGGCAGG - Intronic
1063664664 10:8054227-8054249 CATTATTAGGATCTAATGCAGGG - Intronic
1067297113 10:44980969-44980991 CCTTTTTAGCAGATAGTGCAAGG + Intronic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1073005425 10:100320265-100320287 TATTATTATCAGACAATTGATGG + Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1086824129 11:91475021-91475043 CATTATGAGCAGATCTTCGAAGG + Intergenic
1087971224 11:104487338-104487360 GTGTATTAGCAGATAATGGTGGG - Intergenic
1088278215 11:108111451-108111473 CATGTTTAGCAGAGAAGGGAAGG - Intergenic
1096985871 12:55756919-55756941 CATTATTAGCTAATAACAGAAGG + Exonic
1099172739 12:79384955-79384977 TATAATAAGCAGCTAATGGAAGG + Intronic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1103405943 12:120675347-120675369 CATTAATAACAGATAATGGCCGG - Intergenic
1106884653 13:34171482-34171504 AAATATTGGGAGATAATGGAAGG - Intergenic
1109618605 13:64871315-64871337 TATTATTAGCAGTTAATAGTAGG - Intergenic
1109972711 13:69790207-69790229 TATTATTAGTAGATATTTGAAGG - Intronic
1110177076 13:72569608-72569630 AATTAATAGCATATAATGTATGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112921868 13:104623333-104623355 GATTGTTAGCAGATAAGAGATGG - Intergenic
1114391883 14:22317808-22317830 GATTATTAACAGATAATGTGTGG + Intergenic
1115225222 14:31095348-31095370 CATTACTTTCAAATAATGGATGG + Intronic
1118033543 14:61841262-61841284 CATTCTTAGCAGACATTGTATGG + Intergenic
1124480249 15:30073248-30073270 GATTATTTGGAGATAAAGGAGGG - Intergenic
1124869769 15:33529001-33529023 TATTATTACAAGTTAATGGATGG - Intronic
1126306801 15:47268291-47268313 TAATATTAGCAGTAAATGGAAGG - Intronic
1130421376 15:83750437-83750459 CATAATCAGCAGATAATTTAGGG + Intronic
1132367892 15:101270860-101270882 AATGATTAGGAGATAATGGAGGG - Exonic
1134464296 16:14460240-14460262 CATTCTTAAAAAATAATGGATGG + Intronic
1137887626 16:52123833-52123855 CACTATAAGCAAGTAATGGATGG - Intergenic
1139788453 16:69413012-69413034 CATTATTTGCAGGGAAAGGATGG + Intergenic
1140847296 16:78902748-78902770 CATTCTTAGAAGACAGTGGATGG - Intronic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1150178202 17:63084981-63085003 CATTATAACCAGTTGATGGATGG + Intronic
1155267134 18:24105127-24105149 CAAAATTAGGACATAATGGAAGG + Intronic
1158504042 18:58030310-58030332 CAAAATTAGGAGAAAATGGAGGG + Intergenic
925940277 2:8810393-8810415 CATTATTACCTGATTCTGGAGGG + Intronic
926428410 2:12761214-12761236 CATTTTTAAAAGATGATGGATGG - Intergenic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
931295568 2:60921362-60921384 CACTTTTAGGAGAAAATGGAAGG - Intronic
931930748 2:67130736-67130758 GATTAATAGCTGAAAATGGAGGG + Intergenic
935315357 2:101828142-101828164 CATTACTAGCAGTAAATGTATGG - Intronic
936803480 2:116295362-116295384 CATCTTTAACAGATAATGGGAGG + Intergenic
936853164 2:116925972-116925994 CATTATTGGCAGTTACAGGAGGG - Intergenic
938099412 2:128488092-128488114 TATTAAAAGCAGATAATGTAAGG + Intergenic
941994779 2:171592051-171592073 TATTTTTAGGAGAAAATGGATGG + Intergenic
942641845 2:178068904-178068926 CATTTTAAGTAGAGAATGGAAGG + Intronic
943574737 2:189617730-189617752 CATAATCAGCAGATAACTGAAGG + Intergenic
943859707 2:192845541-192845563 CATTACTAGTATCTAATGGAAGG + Intergenic
944297931 2:198088751-198088773 CATTTTTAAAAGATAATAGAGGG - Intronic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
946816835 2:223587536-223587558 TATTAATAGCAGATAAAGGAGGG + Intergenic
948329656 2:237155096-237155118 CATGATTGGCAGCTAGTGGAGGG - Intergenic
948635022 2:239329281-239329303 TTTTACTAGCAGATAATGGAGGG - Intronic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169408778 20:5349217-5349239 CAATATTAGCAGACAGTTGAGGG + Intergenic
1169744063 20:8925734-8925756 AATTATTAGCAGAGAATATAAGG - Intronic
1169840440 20:9929834-9929856 CATTATTGGCAGCTAGTGAAGGG + Intergenic
1170363319 20:15571619-15571641 TATCTGTAGCAGATAATGGAAGG + Intronic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1174975882 20:55333220-55333242 AATTATTAGGAGAATATGGAAGG - Intergenic
1175506472 20:59488903-59488925 CAGTCTTAGCAGTTAATGGTGGG + Intergenic
1177154568 21:17488246-17488268 CAGTATTAGTAGCCAATGGAAGG - Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1177812537 21:25939724-25939746 GATTCTTAGCAGAAAATCGAGGG + Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
952509545 3:34039334-34039356 CATTATTAGCAGGGAAAGGATGG - Intergenic
955557995 3:60158677-60158699 CACTCTTAGTAGCTAATGGACGG - Intronic
955573126 3:60328975-60328997 TACTTTGAGCAGATAATGGATGG - Intronic
956201328 3:66709359-66709381 GATTATTAGCAGAAAATGACAGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956540324 3:70330505-70330527 CATTACCAGAAAATAATGGAAGG + Intergenic
958007161 3:87826775-87826797 CACAAATAGTAGATAATGGAAGG + Intergenic
959687367 3:109162453-109162475 CATTATTATCAGATTATCCAGGG - Intergenic
960443845 3:117723069-117723091 CAATCTTAGCAGTTCATGGAGGG - Intergenic
964118326 3:153159148-153159170 AATAATTAACAGATAATAGACGG - Intergenic
964140955 3:153398216-153398238 CATACATAGAAGATAATGGATGG - Intergenic
965369112 3:167839037-167839059 CTGTATTAGCAGATAATGTTAGG + Intergenic
965434134 3:168626275-168626297 CATCATTAGAAGACAATGGTAGG - Intergenic
967659636 3:192090949-192090971 CATTTTTAGAAGATTATGGGGGG - Intergenic
970713516 4:18892958-18892980 CATTATTTCCATATCATGGATGG + Intergenic
970820689 4:20208612-20208634 GATTAATATCAGAAAATGGATGG + Intergenic
974072376 4:57136039-57136061 CATAATAAGCATATAATGGCTGG + Intergenic
975692672 4:76981285-76981307 CATTTTTAGTGGACAATGGAGGG + Intronic
977377382 4:96223193-96223215 CAATAGAAGCAGATTATGGATGG - Intergenic
978872939 4:113602574-113602596 AATTAATGGCAGATAATGGCTGG - Intronic
981647354 4:147015354-147015376 CAACATTAGGAGATAACGGAGGG + Intergenic
982803542 4:159734449-159734471 CATTATTAGAGCATAATGTATGG - Intergenic
984089100 4:175348188-175348210 CATCATTAGCATATACTTGAAGG + Intergenic
984159395 4:176232825-176232847 GATTATTACCAGGTGATGGAGGG - Intronic
984925938 4:184807008-184807030 CCTTAATAGCAGTTAATAGAAGG - Intronic
986525725 5:8672927-8672949 CATCATCAGCACATAATAGATGG + Intergenic
986872876 5:12070948-12070970 CATTCTTATCAGAGAATGGTGGG - Intergenic
986914566 5:12602693-12602715 CATTTATAGCAGATATTGAAGGG + Intergenic
990316436 5:54587203-54587225 AATTATTAAAAGATATTGGATGG - Intergenic
993348348 5:86814384-86814406 CATTATTAAGATATTATGGAAGG + Intergenic
993813545 5:92512590-92512612 CACTATTAGAAGAAAATGGAGGG + Intergenic
994791756 5:104236124-104236146 AATAATTACCAGATAATGAAGGG - Intergenic
996233732 5:121100544-121100566 CATTCCTAGAAGATAATGTAGGG + Intergenic
996352374 5:122559445-122559467 AAGTATTAGCTAATAATGGATGG + Intergenic
999103954 5:149052587-149052609 CAATAGGGGCAGATAATGGAAGG + Intronic
999687145 5:154113126-154113148 AATTATTAGTAGACCATGGATGG - Intronic
999848196 5:155508273-155508295 CAATATTAGGAAATCATGGATGG - Intergenic
1000122107 5:158207324-158207346 TATTATTATCAGATAAGGTATGG + Intergenic
1000841238 5:166220988-166221010 AATTGTTTGCAGATAAAGGAAGG - Intergenic
1004746703 6:18516189-18516211 CTTAATTAGCAGGAAATGGAGGG - Intergenic
1004994630 6:21177516-21177538 CATTTTTAGTAGTTAATGAAAGG - Intronic
1007896482 6:45366554-45366576 AGTTTTTAGCAGATAAAGGAGGG - Intronic
1009474358 6:64070570-64070592 AATGACTAGCAGATAATGTATGG - Intronic
1009683610 6:66928440-66928462 CAGTAGTAGCACAAAATGGATGG + Intergenic
1010601389 6:77831595-77831617 CATCATTTGCAGAGCATGGATGG + Intronic
1011601199 6:89061964-89061986 CATTACTTCCAAATAATGGATGG + Intergenic
1012106917 6:95173867-95173889 CATTTTTAGTAGTTCATGGAAGG + Intergenic
1014690517 6:124558290-124558312 CATAATTAAGACATAATGGAAGG + Intronic
1015361568 6:132345518-132345540 TATTATAGACAGATAATGGATGG - Intronic
1016156530 6:140816857-140816879 CATTACTAGCAGTTAATGATTGG + Intergenic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1021242987 7:18227674-18227696 CATTATTAGTTGATACTGAAGGG - Intronic
1022925579 7:35053050-35053072 AATTATTGGGAGATAATTGAAGG - Intergenic
1023219991 7:37911341-37911363 CATTAACAGCAGAGAATGGGAGG + Intronic
1029823584 7:103167747-103167769 AATTATTGGGAGATAATTGAAGG - Intergenic
1030654986 7:112157542-112157564 AATTATTTGGAGATAATGTAAGG + Intronic
1032319930 7:130876537-130876559 CACTATTAGCATATCATGAATGG - Intergenic
1035791395 8:2308733-2308755 AATTCTCAGCAGATAATGAATGG + Intergenic
1035801410 8:2412972-2412994 AATTCTCAGCAGATAATGAATGG - Intergenic
1040804695 8:51381511-51381533 CCATATTAGCAGATACTGGGGGG - Intronic
1043824883 8:84914844-84914866 AATTAGTAGGAGATAAGGGATGG - Intronic
1044620715 8:94188374-94188396 AATTTTTGGCAGTTAATGGAAGG + Intronic
1044781525 8:95748555-95748577 CATGATGATCAGATATTGGAAGG + Intergenic
1045229990 8:100295468-100295490 CAATATTAGCAGATAAAAGGTGG + Intronic
1045465412 8:102465003-102465025 CATTCTGAGCTGATAAAGGACGG - Intergenic
1046039310 8:108883120-108883142 CTTTATTCCCAGATAATTGATGG + Intergenic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046342860 8:112881331-112881353 CATTAATACAAGATAATGGAAGG + Intronic
1046797724 8:118390742-118390764 GATGATTAGCAGTTAATTGAAGG + Intronic
1047797470 8:128272769-128272791 CATCATTAACATTTAATGGAAGG + Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1051555022 9:18373582-18373604 CCCTGTTGGCAGATAATGGAAGG - Intergenic
1052411819 9:28131042-28131064 CATTATGAGGAGATAAGGGGAGG - Intronic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1058331356 9:103764895-103764917 CATTATTAACAGATAAAAAATGG + Intergenic
1058713299 9:107700037-107700059 CATTATGATAAGACAATGGAAGG + Intergenic
1186668260 X:11741665-11741687 TATTATCAGCATATAAAGGAAGG + Intergenic
1189789405 X:44589050-44589072 CATTATTACCACAAAATGAATGG - Intergenic
1190527392 X:51341836-51341858 CATAATTAGCTGGAAATGGAAGG + Intergenic
1193942612 X:87694744-87694766 CACTCATAGCAGAAAATGGAAGG + Intergenic
1194564094 X:95461567-95461589 TATTATTAACAGAAAATAGATGG + Intergenic
1201628600 Y:16043135-16043157 CATTAGTACCAGATAATCCAGGG - Intergenic
1201640913 Y:16176044-16176066 CATTATTAAAAGAGAATGGCAGG + Intergenic
1201661903 Y:16409282-16409304 CATTATTAAAAGAGAATGGCAGG - Intergenic
1201940929 Y:19459063-19459085 CATTAGAACCAGATAATGGAGGG - Intergenic