ID: 948949099

View in Genome Browser
Species Human (GRCh38)
Location 2:241237239-241237261
Sequence TAGGGGAGACAGAAAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 616}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948949084_948949099 16 Left 948949084 2:241237200-241237222 CCCACCCAGGAGAGGCAGTGGGA 0: 1
1: 0
2: 3
3: 28
4: 351
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616
948949079_948949099 28 Left 948949079 2:241237188-241237210 CCAGCACGCAGCCCCACCCAGGA 0: 1
1: 1
2: 3
3: 36
4: 448
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616
948949089_948949099 11 Left 948949089 2:241237205-241237227 CCAGGAGAGGCAGTGGGAAGGGG 0: 1
1: 1
2: 15
3: 80
4: 690
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616
948949082_948949099 17 Left 948949082 2:241237199-241237221 CCCCACCCAGGAGAGGCAGTGGG 0: 1
1: 0
2: 0
3: 55
4: 484
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616
948949085_948949099 15 Left 948949085 2:241237201-241237223 CCACCCAGGAGAGGCAGTGGGAA 0: 1
1: 0
2: 8
3: 56
4: 294
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616
948949087_948949099 12 Left 948949087 2:241237204-241237226 CCCAGGAGAGGCAGTGGGAAGGG 0: 1
1: 0
2: 11
3: 79
4: 736
Right 948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG 0: 1
1: 0
2: 5
3: 61
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948949099 Original CRISPR TAGGGGAGACAGAAAGGGCA AGG Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
901023115 1:6264975-6264997 TAGAGGAGACACTAAGGGCATGG + Intronic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902301011 1:15502783-15502805 AATGAAAGACAGAAAGGGCAGGG - Intronic
902377243 1:16035522-16035544 TGGGGGTGTGAGAAAGGGCAAGG + Intergenic
902382420 1:16058777-16058799 TGGGGGTGTGAGAAAGGGCAAGG + Intronic
902407712 1:16194759-16194781 AAAGGGAGAAAGAAAGGGAAAGG + Intergenic
902476839 1:16692900-16692922 TAGGGGCGACAGGAAGTGCTGGG + Intergenic
902783055 1:18716847-18716869 TGGGGGAGAGGGCAAGGGCAAGG - Intronic
902852321 1:19169534-19169556 TGGAGGCGACAGAAAGGACAAGG + Intronic
902910583 1:19594057-19594079 TTAGGGATACAGAAATGGCACGG + Intergenic
903510905 1:23874289-23874311 TAGGCGAGACACAAAAGGCCTGG - Exonic
903642131 1:24867430-24867452 TAGGGCAGGGAGAATGGGCAAGG + Intergenic
903678282 1:25080279-25080301 CAGAGGAGCCAGAAAGGCCAAGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
905249707 1:36640036-36640058 TGGGGGTGACAGAGAGGCCAGGG - Intergenic
905447031 1:38034243-38034265 TGGGGGAGACAGAATAGGAATGG + Intergenic
906035381 1:42747414-42747436 TAAGGGGGACAGAAAGGGAGGGG + Intronic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906776306 1:48532801-48532823 TAGTGGGGACTGAAAGGGAAAGG + Intergenic
906861784 1:49368651-49368673 TAGGTGGGACAGAAAGAGCCAGG - Intronic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907405536 1:54251491-54251513 CAGGGGTGAGAGGAAGGGCATGG - Intronic
907495563 1:54841933-54841955 TGGGGGTGACAGCATGGGCATGG + Exonic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
909410600 1:75345999-75346021 TGGGGGTGAAAGAAAGGGCATGG + Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
909900625 1:81130190-81130212 AAAGGGTGACAGAAAGGGAAAGG - Intergenic
909936086 1:81552473-81552495 GATGGGAGACAGAAAGGAAAAGG - Intronic
910463823 1:87475328-87475350 TAAGTGAGACAGAAGGGACAGGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
911563420 1:99434128-99434150 TAGGTGGGACAGGAAGGGCTGGG - Intergenic
911571903 1:99527703-99527725 TAGAAGAGACTGAAAGGGCAGGG + Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
913052654 1:115130877-115130899 TACGGGGGATAGAAAAGGCAGGG + Intergenic
913087127 1:115449485-115449507 GAGGGGAGACAGGAAGGGAAGGG - Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913300042 1:117360846-117360868 TAGAGGAAGGAGAAAGGGCATGG - Intergenic
915339633 1:155169566-155169588 TGGTGAAGACAGAAAGGTCATGG + Intronic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
915685615 1:157629868-157629890 TATTGGAGACAGAAAGAGGAGGG - Intergenic
915943284 1:160132483-160132505 TAGGGCAGAAACAAAGGGAATGG + Intronic
916070361 1:161166436-161166458 TAGGAGAGACCGAAAAGGCTGGG + Exonic
916116092 1:161486262-161486284 TAAGGGGGACAAAAAGGGCCAGG + Intergenic
916893562 1:169137664-169137686 GAGGGAAGACAAAAAGGGAAAGG - Intronic
917297766 1:173539745-173539767 TAGAGGAGACTGAAAAGGAAAGG + Intronic
917498561 1:175564907-175564929 TAGTGGTGAAGGAAAGGGCAAGG - Intronic
917655600 1:177122520-177122542 TAGGGAAGAGAGAAAAGGGAGGG - Intronic
917789350 1:178489475-178489497 AAGGAGAGAAGGAAAGGGCAAGG + Intergenic
918144267 1:181742036-181742058 AAGGGGAGAGGGAATGGGCATGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919275452 1:195409314-195409336 CAGAGGAGGCAGAAAGGGAAGGG + Intergenic
919770050 1:201152286-201152308 TTGGGGAAACATAAAGGGCGAGG + Intronic
919796671 1:201325220-201325242 TAGGGGAAGCACCAAGGGCAGGG + Intronic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
919993700 1:202728265-202728287 TAGGGGAGAAAGGAAGGGACAGG + Exonic
920112855 1:203599302-203599324 TAGGGGAAGGAGAAAGGGCTGGG - Intergenic
920442398 1:205989675-205989697 CAGGGGAGGCAGAAGGGCCAGGG - Intronic
920944356 1:210514690-210514712 GAGATGAGACAGAAAGGACAAGG + Intronic
921863957 1:220068991-220069013 TAGGGGAGAGTGAATGGGGAGGG + Intronic
922064623 1:222124832-222124854 CAGGAGAGATACAAAGGGCAAGG + Intergenic
922153408 1:223023359-223023381 TGGGGGAGGAGGAAAGGGCAGGG - Intergenic
922775876 1:228213983-228214005 AAGGGGAGACGGAGTGGGCAGGG + Intronic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924947395 1:248855693-248855715 TGGCTGAGACAGAAAGGGCAGGG - Intronic
1063528123 10:6803302-6803324 TAGGGTAGAGAGAGAAGGCATGG - Intergenic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1065045684 10:21746151-21746173 TAGGGGCAGCATAAAGGGCAGGG + Intergenic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1065683930 10:28265000-28265022 TAGGGTAGACAGACAGGACAAGG + Intronic
1066061551 10:31727891-31727913 AAGGGAAGGCAGAAAGGCCATGG + Intergenic
1066977907 10:42386331-42386353 TTGGGGAGACAGACAGGTCCTGG + Intergenic
1068123628 10:52811110-52811132 TAGGTAAGACAGAAAGGCTATGG - Intergenic
1068760973 10:60708701-60708723 TAGGTGAGACAGAAATGCTAGGG - Intronic
1069071221 10:63992166-63992188 TAAAGGGGACAGAATGGGCAGGG + Intergenic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069662449 10:70132544-70132566 TGGGGGAGACAGAGAGGGGCGGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069772181 10:70907047-70907069 GAAGGGAGGCAGGAAGGGCAGGG + Intergenic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1069883256 10:71607266-71607288 CAGGGAAGACAGGAAGGGCCAGG + Intronic
1070037659 10:72742773-72742795 TAGGGGAGACAGAAAACACCAGG + Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070652482 10:78247879-78247901 GAGGGGATGCTGAAAGGGCAGGG - Intergenic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070729638 10:78817470-78817492 AAGGGGAGAGGGAAAGGGAAGGG + Intergenic
1070971129 10:80568252-80568274 TCTGGGAGAGAAAAAGGGCAGGG + Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071789195 10:88936569-88936591 CAGGGGCAACAGAGAGGGCAGGG - Intronic
1071927017 10:90421725-90421747 TAGTGAAGACAGAAAGGGACAGG + Intergenic
1072039237 10:91591443-91591465 AGGGGGAGACAGAGAGGGTAGGG - Intergenic
1073448960 10:103598237-103598259 TAGGGGAAACCCACAGGGCATGG + Exonic
1073761330 10:106631797-106631819 AAGACCAGACAGAAAGGGCAAGG - Intronic
1074202689 10:111253049-111253071 GAGGGGAGATAGAGAGGGAATGG + Intergenic
1075617585 10:123902926-123902948 AAGGGAAGAATGAAAGGGCACGG - Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076135234 10:128041000-128041022 TAGGGGAGGCAGCCAGGGAAAGG - Intronic
1076526156 10:131113447-131113469 CCGGGGAGACGGACAGGGCAAGG + Intronic
1076888909 10:133274568-133274590 TTGGGTAGACAGGAAGGACACGG + Intronic
1077465713 11:2732844-2732866 CAGGGGAGACCGCCAGGGCAGGG - Intronic
1077647713 11:3940624-3940646 TAGGGGAGGCAGTCAGTGCATGG - Intronic
1078149503 11:8746700-8746722 TAGGGCAGAAAGAAAGACCAGGG + Intronic
1078759944 11:14243796-14243818 TAGAGGAGACAGAAAAGAAACGG - Intronic
1079074026 11:17372407-17372429 TAGGGGAGACAGGAAGGATTGGG - Exonic
1079180696 11:18190741-18190763 TTAGCGAGACAGAAAGAGCAGGG - Intronic
1079312151 11:19376685-19376707 TAGGGAAGACAGCAAGTGAAGGG + Intronic
1079321123 11:19452397-19452419 TTTGGAAGACAGAGAGGGCATGG - Intronic
1079451518 11:20603106-20603128 TTAGGGAGAGAGAAAGGGCCAGG - Intronic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1079995755 11:27293563-27293585 TGGGGGAGGCAGAGAGGGAAGGG + Intergenic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1081334063 11:41842562-41842584 TAGGGAAAATGGAAAGGGCATGG - Intergenic
1081701316 11:45154655-45154677 TAGGGGAGACAGGACTGGAAGGG - Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082985056 11:59161257-59161279 TATGTGACACAGTAAGGGCAGGG + Intergenic
1083397475 11:62401628-62401650 CAGGGGAGGGAGAGAGGGCAAGG - Intergenic
1083660331 11:64249082-64249104 GAGGACAGACAGAAAGGTCAGGG - Intergenic
1084493869 11:69492576-69492598 TCTGGAAGCCAGAAAGGGCAAGG + Intergenic
1084945462 11:72635998-72636020 ACTGGGAGACAGGAAGGGCATGG - Intronic
1085305520 11:75483450-75483472 TATGGGAGGGAGAAAGGGTAGGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1087144534 11:94798925-94798947 AAGGGGAGACAGCAAGTGTAGGG + Intronic
1087479680 11:98683496-98683518 TAGGGCAGAAAGAAATGGAACGG - Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1088806788 11:113359769-113359791 TAGGGGAGACAGACATGGGGAGG + Intronic
1089361175 11:117887695-117887717 AAAGAGAGACAGAGAGGGCAGGG - Intergenic
1090754791 11:129780316-129780338 CAGAGGAGACAGAAAGGGATGGG - Intergenic
1091192394 11:133706763-133706785 GAAGGGAAAGAGAAAGGGCAGGG + Intergenic
1091192442 11:133706889-133706911 AAGGGGGGACAGAAAGGGAACGG + Intergenic
1091394044 12:142805-142827 TAGGGGACACAGAAAAGGAAGGG - Intronic
1093262056 12:16950594-16950616 GAAGGGAGACAGGAAAGGCAGGG - Intergenic
1094320706 12:29179729-29179751 TAGAGGAGACAGATGGGGCCAGG - Intronic
1094844374 12:34355004-34355026 GCGGGGAAACAGAAACGGCATGG - Intergenic
1095171674 12:39043285-39043307 TAGGAGTGGCAGAAAGGGAAAGG - Intergenic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096478209 12:51921424-51921446 TTGAGGAGACAGAAAGCCCAAGG - Intronic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1097147299 12:56950672-56950694 TAAGGGACACAGAGAGGGCACGG + Intergenic
1097539735 12:60925161-60925183 GAGGGGAGAGAGAAAGTACAAGG + Intergenic
1097839985 12:64312309-64312331 TAGGGGAGGCAAAGAGGGCCGGG + Intronic
1098384462 12:69904168-69904190 GTGGGGAGACAGAAAGGAAAAGG - Intronic
1098389278 12:69951993-69952015 GATGGGAGACAGAAAGGGTGGGG + Intronic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098640426 12:72832338-72832360 TAGGGGAGGAGAAAAGGGCAAGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101807082 12:108073548-108073570 TAGGGGGCAAAGAAAGGGAAAGG + Intergenic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102152259 12:110696993-110697015 TGTGGGAGACAGAAAAGACAGGG + Intronic
1103058624 12:117841265-117841287 GGGGGAAGGCAGAAAGGGCAAGG - Intronic
1103233496 12:119352120-119352142 TAGGAGAGAGAGAAAGTGAAGGG + Intronic
1103674408 12:122644378-122644400 TAGGGGAGCCAGAAAGGAGATGG + Intergenic
1104066849 12:125313600-125313622 GAGGGGAGAGGGAAAGGGGAGGG - Intronic
1104080354 12:125424890-125424912 AAGAGGAGACAGCAAGGGTAGGG + Intronic
1104349276 12:128030823-128030845 TAGTGGTCCCAGAAAGGGCATGG - Intergenic
1104611487 12:130232128-130232150 AGGGTGAGACAGAAAGAGCAAGG - Intergenic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105287591 13:19018548-19018570 TAAGGGAGGCAGAGAGAGCAGGG + Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105622221 13:22079394-22079416 TAGAAGAGAGAGAAAGGGTAAGG - Intergenic
1106182732 13:27382260-27382282 TAGGGCAGACAACCAGGGCAGGG + Intergenic
1107765271 13:43727585-43727607 GCGGGTAGACAGAAAGGGCCAGG + Intronic
1108347510 13:49560868-49560890 TGGGGGAGACACACAGGGTAAGG + Intronic
1108874523 13:55028477-55028499 TAAGGGAAAGAGAAAGAGCAAGG + Intergenic
1109253577 13:60050391-60050413 AAGGACAGACAGAAAAGGCAGGG + Intronic
1110582882 13:77152721-77152743 AAGGGGAGCTAGAAAGGGCATGG - Intronic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113856283 13:113447923-113447945 TAGGGGACTCAGGAAGGGCTAGG - Intronic
1113955597 13:114098632-114098654 GAGGGGAGGCAGGAAGGGCAAGG + Intronic
1114295838 14:21328492-21328514 TGGGGGAGAAAGAAAGGAGAAGG + Exonic
1114362841 14:21994435-21994457 TAGGGGACAGAGATTGGGCATGG + Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115194426 14:30780750-30780772 TAGAGGAGACATCAAGGGTAGGG - Intergenic
1116101841 14:40448153-40448175 TAGGAGGGACAGAAAGAGCTAGG - Intergenic
1117628092 14:57661202-57661224 TGGAGGTGACTGAAAGGGCAAGG - Intronic
1118956487 14:70487799-70487821 TAGGGGAGACAGGAAGTAAATGG + Intergenic
1119044819 14:71309216-71309238 CAGGGAAGACTCAAAGGGCAAGG + Intergenic
1119529644 14:75350780-75350802 TAGGGGAGAGAGAAGGGCAAAGG + Intergenic
1119603022 14:75990096-75990118 TAGGGGAGTGAGTTAGGGCAGGG + Intronic
1119806851 14:77487770-77487792 TAGGGGAGCGAGACAGGGAAGGG + Intronic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120930266 14:89841382-89841404 TAGGGGAGAGAGAAAGGATGGGG - Intronic
1121066919 14:90976223-90976245 GAGAGGAGACAGAAAGGGCGGGG + Intronic
1121780449 14:96618782-96618804 GAAGGGAGACAGAAAGGTGAGGG - Intergenic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122272310 14:100573721-100573743 CAGGGGAGACACCAAGGGCTGGG + Intronic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1124205943 15:27720279-27720301 TAGGGGAGAGAGAAAGAACAGGG + Intergenic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1124659966 15:31539220-31539242 TTGGGGAGAGAGAAAGCTCAAGG - Intronic
1125582869 15:40799360-40799382 TAGAGGATACAGGCAGGGCATGG - Intronic
1125970243 15:43905553-43905575 TAGGGGAAACAGAGAGGGATTGG - Intronic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1127254079 15:57273604-57273626 TAGGAAAGACATAAAGAGCAGGG - Intronic
1127906537 15:63380296-63380318 TAGGGAAGAAAGGAAGGGGAGGG + Intronic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1128761066 15:70216244-70216266 TAGGAGAGAGGGAGAGGGCATGG + Intergenic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1129115964 15:73365636-73365658 TAAGGGAGATAGGAAGGGCCAGG + Intronic
1129149458 15:73678697-73678719 CCAGGGAGAGAGAAAGGGCAGGG + Intergenic
1129350834 15:74955227-74955249 GAGGGGAGACACAAGGGGCCAGG + Exonic
1129670494 15:77605316-77605338 TAGGGGAGTCTTCAAGGGCAAGG + Intergenic
1129673644 15:77620836-77620858 TAGGGGAGATGGAAGGGGCCTGG + Intronic
1129706920 15:77799619-77799641 AAAGAGAGAGAGAAAGGGCAAGG - Intronic
1129831645 15:78674844-78674866 TATAGGAGACAGAAAAGGAAAGG + Intronic
1130079780 15:80722712-80722734 TAGGGGAGACAGTAATGGGGAGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130391528 15:83459986-83460008 GAGGGGAGAGGGAAAGGGAAAGG - Intronic
1130570659 15:85040458-85040480 TAGAGAAGACAGAAAGGAAAAGG - Intronic
1130841043 15:87701495-87701517 GAGGGGAGAGGGAAAGGCCAGGG - Intergenic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1131511555 15:93051939-93051961 CAGGGCAGAGACAAAGGGCAGGG + Intronic
1132073298 15:98798485-98798507 TAAGAGAGACTGTAAGGGCAAGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132268838 15:100504681-100504703 TCGGGGACACAGAAAGGACAGGG + Intronic
1132908919 16:2298611-2298633 TAGGGGAGACAGAGAGGGGGTGG - Intronic
1133440550 16:5817600-5817622 GAGGGGAGAGAGAAAGGAGAGGG + Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1133891706 16:9885397-9885419 CAAGGGAGAGAGAAAAGGCATGG + Intronic
1133971275 16:10569973-10569995 AAGGGGAGGCTGCAAGGGCAGGG - Intronic
1134570852 16:15289886-15289908 TCAGGGAGAGAGAAAGAGCAGGG + Intergenic
1134731526 16:16466188-16466210 TCAGGGAGAGAGAAAGAGCAGGG - Intergenic
1134935925 16:18245813-18245835 TCAGGGAGAGAGAAAGAGCAGGG + Intergenic
1135518565 16:23156080-23156102 AAGGGAAGACAGGAAGGGAAAGG + Intergenic
1136058125 16:27705992-27706014 TACGGGAGACAGAAAATCCAGGG + Intronic
1136087618 16:27896777-27896799 TCTAGAAGACAGAAAGGGCAAGG + Intronic
1136124914 16:28171900-28171922 TAGAGGAGAAAGAAAGGAAAAGG - Intronic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137412992 16:48244951-48244973 CCGGGGAGAAAGAAAGGGCCTGG - Intronic
1137542865 16:49377090-49377112 CAGGGGAGGCAGGGAGGGCAGGG - Intronic
1137682810 16:50365525-50365547 TGGGAGAGAGAGACAGGGCAGGG + Intronic
1138863930 16:60793805-60793827 TAGAGGAGACAGTTAAGGCAAGG - Intergenic
1141222140 16:82081014-82081036 TTTGGGAGCCAGAAAGGACAGGG - Intronic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141382602 16:83589357-83589379 TGGGGGAGAGGGAGAGGGCAAGG - Intronic
1141918982 16:87122257-87122279 AAGGGGAGACGGAACGGGCAGGG - Intronic
1142119010 16:88376838-88376860 TAGGGCAGCCAGGAAGTGCAGGG + Intergenic
1143131659 17:4682200-4682222 TAAGAGATACAGAAAAGGCAAGG + Intronic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145752871 17:27367759-27367781 TGGGGGAGAAAGAGAAGGCAAGG - Intergenic
1145835674 17:27952597-27952619 AAGGGGAGACTGACAGGGTAAGG + Intergenic
1146133754 17:30300201-30300223 TGTGGGAGAAAGCAAGGGCAAGG + Intergenic
1146787635 17:35732792-35732814 TAGGGGAGGAAGAGAGGGCAAGG - Intronic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1147376590 17:40026333-40026355 TAGGGGAGACGGAAAGGTGATGG + Intronic
1147658012 17:42101950-42101972 GAGGTGAGACAGAGAGGGTAGGG + Intronic
1147688949 17:42303874-42303896 TTGGGGTGACAGGAAGAGCAAGG + Intronic
1147741793 17:42674277-42674299 TAGGGGAGACAGAGAGGATGGGG + Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148394194 17:47295379-47295401 GAGGGGAGCCAGAAAAGGGAGGG - Intronic
1148624755 17:49060741-49060763 TGGGGGTGATAGGAAGGGCACGG + Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148715976 17:49716241-49716263 GAGGGGAGGCAGCAAAGGCAAGG + Exonic
1148765450 17:50036096-50036118 CGGGGGAGACAGGCAGGGCAGGG - Intergenic
1148766889 17:50044735-50044757 TGGAGGAGGCAGACAGGGCAGGG - Intergenic
1149716238 17:58793228-58793250 TAGTAGAGACAGAAAGATCATGG - Intronic
1149888147 17:60361230-60361252 TGGGGAAGACTGAATGGGCACGG - Intronic
1150771990 17:68050171-68050193 GAAGGGAGAAAGAAAGGGAAGGG - Intergenic
1150885996 17:69086394-69086416 TAGAGGAAACAGTGAGGGCAGGG - Intronic
1151229039 17:72668891-72668913 CATGTGAGACAGAAAAGGCAGGG + Intronic
1151291839 17:73156176-73156198 AAGGGGAGACAGAAAACGCCAGG + Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151465132 17:74280152-74280174 TGGGGGAGTCAGAAAGGTCAAGG + Intronic
1152784607 17:82241275-82241297 CAGGGGACCCAGAAAGGGCTTGG + Intronic
1153121431 18:1732167-1732189 TTGGGCAGATAGCAAGGGCATGG + Intergenic
1153592338 18:6686873-6686895 TCTGGAAGCCAGAAAGGGCAAGG - Intergenic
1153633727 18:7096224-7096246 TCATGGAGACAGAAAGAGCAGGG - Intronic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1153888907 18:9494322-9494344 TAGTGTAGCCAGAGAGGGCACGG + Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154380910 18:13849013-13849035 TAGAAAAGACAGAAATGGCAAGG - Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155617364 18:27737673-27737695 CAGGAGAGAGAGAGAGGGCAGGG + Intergenic
1155633880 18:27927611-27927633 GAGGAGAGACAGAAAGGGTCAGG - Intergenic
1156514277 18:37666993-37667015 TAGGACAGAAATAAAGGGCAGGG + Intergenic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157706292 18:49809947-49809969 TAGGGGAAACGGACCGGGCAAGG + Intronic
1157892075 18:51427408-51427430 GAGGGGAAACAGGGAGGGCATGG - Intergenic
1157971445 18:52274219-52274241 TAGGCTAGATAGAAAGGTCATGG - Intergenic
1158443079 18:57494518-57494540 TAGGGGACATAGGTAGGGCAGGG + Intergenic
1158482317 18:57832713-57832735 TTAGGGAGATAGCAAGGGCATGG - Intergenic
1159334014 18:67039787-67039809 AAGGGAAGACAAAGAGGGCATGG - Intergenic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1160731293 19:642779-642801 TGTGGGAGTCAGAAGGGGCAGGG - Intronic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1162663077 19:12185731-12185753 TGGGTGAGACAGACAGGGCTGGG - Intronic
1162835740 19:13316493-13316515 TAAGGAAGCCAAAAAGGGCAGGG + Intronic
1164111443 19:22163175-22163197 TAAGGTAGACAGCAAGGGAAGGG + Intergenic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
1168072494 19:53960733-53960755 TGGGGGAGACAGGCAGGGCTGGG + Intergenic
1168253105 19:55152082-55152104 TGAGGGAGACAGGAAGTGCATGG - Intronic
1202710854 1_KI270714v1_random:18724-18746 TAGGGGCGACAGGAAGTGCTGGG + Intergenic
925113821 2:1360562-1360584 TAAGGGAAATAGAAAAGGCAAGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925610856 2:5701037-5701059 TAGGGGGGAAAGAAAATGCATGG + Exonic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
926056892 2:9779001-9779023 TGGGGGAGACTGGAAGGGAAAGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
927021775 2:19024643-19024665 TTGAGGAGTCAGGAAGGGCAGGG - Intergenic
927866386 2:26590554-26590576 GAAAGGAGACAGAAAGGGAAAGG - Intronic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
928952415 2:36824765-36824787 CATGGGAGACTGATAGGGCAGGG + Intergenic
929311785 2:40434083-40434105 TAGGGAAGGGATAAAGGGCAGGG - Intronic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930288521 2:49465339-49465361 AAGGGGAGAGGGAAAGGGAAAGG - Intergenic
930288540 2:49465396-49465418 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930288548 2:49465415-49465437 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931209989 2:60183643-60183665 TAGGTGAGACAGGAAGGCTACGG - Intergenic
931224832 2:60320737-60320759 TGGGGGAGCCAGCAAGGGGAGGG - Intergenic
931436304 2:62250296-62250318 TTGTAGAGACAGGAAGGGCAGGG - Intergenic
932334739 2:70923711-70923733 TGGAAGAGACACAAAGGGCAAGG + Intronic
932425884 2:71634901-71634923 TAGTGGAGAGAGAAAGAGCCAGG - Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
933513093 2:83265807-83265829 CAGGGGAGAGAGAAAGGGGTGGG - Intergenic
933776531 2:85774409-85774431 TGGGGCAGGTAGAAAGGGCATGG - Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
935308317 2:101759461-101759483 GAGGGGAGAGGGAAAGGGAAAGG - Intronic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937602620 2:123757052-123757074 CATGTGAGAGAGAAAGGGCATGG + Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
939612473 2:144327773-144327795 TAGGGGAGATAGCAAGGAGAGGG + Intronic
940329915 2:152463720-152463742 TAGGGGAGAGGGAAAGGGGATGG - Intronic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
941451229 2:165663099-165663121 TTGAGGAGATACAAAGGGCAGGG - Intronic
942022026 2:171875499-171875521 GGGGAGAGAGAGAAAGGGCAAGG + Intronic
942139690 2:172965532-172965554 GAGGTGAGACAGAAAGGGTGGGG - Intronic
943202398 2:184845523-184845545 TGGGTGAGACAGAAAGGCTATGG + Intronic
943367731 2:186981743-186981765 AAGGCCAGAAAGAAAGGGCAGGG - Intergenic
943713119 2:191120239-191120261 TAGAGGAGACTGAAAAGGTAAGG + Intronic
943881924 2:193156643-193156665 CAAGGGAGACAGAAAAGGTAAGG + Intergenic
944264561 2:197709262-197709284 TAGGGGAACCAGATAGGACAGGG + Intronic
944669652 2:201984341-201984363 AGGTGGAGACAGAAAGAGCAGGG + Intergenic
944881177 2:204014484-204014506 TAGGTGAGACAGGAAGGCTAGGG + Intergenic
944972132 2:205005121-205005143 AAGGGGAGGAAGACAGGGCAAGG - Intronic
945035026 2:205697200-205697222 GAGGGGAGGCAGGAAAGGCAGGG + Intronic
945428774 2:209739795-209739817 AAGGGGAGTCAGAAAGGACAAGG + Intergenic
945992817 2:216410727-216410749 GTTGGGAGACAGGAAGGGCAGGG + Intergenic
946231144 2:218292023-218292045 GAGGGGAGACAGCCAGGGCCTGG - Intronic
946294648 2:218774244-218774266 TAGGAGAGACAGAGAGAGAAAGG + Intergenic
946373476 2:219294655-219294677 GAGGGGAGACAGAAAGCAGAGGG + Intronic
946587055 2:221201494-221201516 CAGGAGAGACAGAAAGGCAAAGG + Intergenic
947593510 2:231397541-231397563 GGTGGGAGAAAGAAAGGGCAGGG + Intronic
948063647 2:235060882-235060904 GAGAAGATACAGAAAGGGCAGGG + Intergenic
948267276 2:236644202-236644224 GAGGGGAGACACAGAGGACAAGG + Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169612105 20:7392986-7393008 ATGGGGAGCCAGATAGGGCAAGG - Intergenic
1170104395 20:12737780-12737802 TGGGGAAGAGAGACAGGGCAAGG - Intergenic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171309345 20:24134147-24134169 GAGGGGTGACAGAAAGAGCATGG + Intergenic
1171504045 20:25618832-25618854 TCGGGGAGACAAGAAGGGGAAGG - Intronic
1171517562 20:25750228-25750250 TGGGGGAGGCAGAAAGGAGATGG + Intergenic
1172050082 20:32110349-32110371 GAGAGAAGACAGGAAGGGCAGGG - Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172979733 20:38931879-38931901 TTGAGGAGAAATAAAGGGCAGGG + Intronic
1173484588 20:43431069-43431091 TGGGGAAGGCAGAGAGGGCAGGG + Intergenic
1174350956 20:49967617-49967639 TAGGGGAGGCAGGGAGGGAAAGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175379794 20:58554881-58554903 AAGGGGAGGCAGAAAGAGCTGGG + Intergenic
1175438890 20:58976742-58976764 TAAGGGAGAGAGAGAGGACATGG - Intergenic
1175587778 20:60159020-60159042 AAGGGGAGAAAGAACGGGAAAGG + Intergenic
1175674338 20:60933960-60933982 CAGGGGAGAGAGAGAGGGCCAGG - Intergenic
1176675441 21:9772853-9772875 TTAGGCAGACAGAAAGGGTAGGG - Intergenic
1176714636 21:10340605-10340627 TCCGGGAGACAGAAGGGGAATGG + Intergenic
1177188504 21:17824002-17824024 AAGGGGAGAGAGACAGAGCAAGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1177968460 21:27759089-27759111 GAGGGGAGATGGAAAGGGGATGG - Intergenic
1178843593 21:36156862-36156884 TGGGGGAGAGAGACTGGGCAGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179012322 21:37565276-37565298 CAGGGCAGACAGATATGGCAGGG - Intergenic
1180199924 21:46218066-46218088 TAGGGGAGGCAGGAAGTGAAGGG - Intronic
1180340606 22:11614754-11614776 TAGGGGAGAAAGAGAGAGAAAGG + Intergenic
1180757307 22:18170966-18170988 AAGGGAAAACAGAAAGGACATGG - Intronic
1180993646 22:19953743-19953765 TGGAGGGGACAGAAAGGACAGGG - Intronic
1181074472 22:20366499-20366521 AAGGGAAAACAGAAAGGACATGG + Intronic
1181860895 22:25817432-25817454 AAGGGGAAAGAGAAAGGGAAAGG - Intronic
1182900352 22:33893350-33893372 TAGTGGATCCAGAAAGGACATGG - Intronic
1182953167 22:34396529-34396551 AAGGGGAGAGAGAGAGGGAAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183247587 22:36705700-36705722 TACTGGAGACAGAATGGGCCTGG + Intergenic
1183561673 22:38579667-38579689 TATGGGAGAGAGAAAGTGGATGG - Intronic
1184251516 22:43263037-43263059 TTAGGGAGAAAGCAAGGGCACGG + Intronic
1184955990 22:47886251-47886273 AAGGGGCGACAGCAAGGGGATGG + Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950306816 3:11921640-11921662 TAGGTGAGACAGGAAGGGTGAGG + Intergenic
950339428 3:12229565-12229587 CAGGGGAGAAAAAAAGTGCAAGG + Intergenic
950918385 3:16668021-16668043 GAGGGGGCACTGAAAGGGCAAGG + Intronic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951725905 3:25758827-25758849 GAGGTGAGAAAGACAGGGCATGG + Intronic
952887592 3:38021132-38021154 TGGGGGGGACAGCAAGGGTAAGG - Intronic
953638577 3:44684772-44684794 TAAGGGAGAGAGAGAAGGCAAGG - Intergenic
954744417 3:52778963-52778985 TATCGGAGACATAAAGGACAAGG + Exonic
954930901 3:54280503-54280525 TAGGGGGGACAGAAATGTGAGGG + Intronic
955023942 3:55148976-55148998 GAGGTAAGAAAGAAAGGGCAGGG + Intergenic
955032872 3:55237707-55237729 TAGGGGAGTCCAAAAGGCCAGGG - Intergenic
955592823 3:60556298-60556320 CAGAGGAGACAGAAAGGTAAAGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
955791747 3:62595220-62595242 TAGTAGAGACAGAGAGGACATGG + Intronic
956163006 3:66374462-66374484 TAAGGGAGAGAGAGAGGGAATGG - Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956823819 3:72978398-72978420 GAGGGAAGAGAGAAAAGGCAGGG - Intronic
958002251 3:87764878-87764900 AAGGGGAGAGAGCTAGGGCAGGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
959950442 3:112174996-112175018 TCCTGGAGACAGCAAGGGCAAGG + Intronic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
961058756 3:123810777-123810799 TTTGGGAGACAGGCAGGGCATGG - Intronic
961153542 3:124659789-124659811 CAAGGGAGAAAGAAAGGGAAAGG + Intronic
961415032 3:126750901-126750923 TTGTGGAGACAGCAAAGGCAGGG - Intronic
961451983 3:127006375-127006397 TAGAGGAGCCAGCCAGGGCAAGG + Intronic
961542199 3:127607602-127607624 TGAGGGAGACAGACAGGGCATGG - Intronic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
962991830 3:140584503-140584525 GAGGGGAAAAAGAAAGGGCATGG + Intergenic
963113103 3:141702479-141702501 TAGGGGAGAGAGAGAGAGAAAGG + Intergenic
963608411 3:147434550-147434572 GAGTGGAGACAGAAAGCCCATGG - Intronic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
964155692 3:153582451-153582473 TGGGTGAGACAGAAGGGGAATGG - Intergenic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
966954610 3:184862135-184862157 TACCAGAGACATAAAGGGCAGGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967546799 3:190739478-190739500 TAGGGGACACATGAAGTGCAGGG + Intergenic
967654265 3:192027485-192027507 TAGATGAGACAGAAAGGCAAAGG - Intergenic
968148515 3:196319243-196319265 CAGGAGAGGCTGAAAGGGCAGGG + Intronic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
968915347 4:3494835-3494857 TAGGGGAGACAGGCAGGGCAGGG - Intronic
969229198 4:5817921-5817943 AAAGTGAGACAGAATGGGCAAGG - Intronic
969619651 4:8272725-8272747 TGGGGAGGACAGAGAGGGCATGG + Intronic
969662178 4:8536731-8536753 GAGGGAAGGCAGACAGGGCAGGG + Intergenic
969669589 4:8582369-8582391 TGGGGGAGAGAGAAAGAACAAGG - Intronic
969926180 4:10587806-10587828 TAGGGGAGACAGTAGGGACCGGG - Intronic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
971445916 4:26748768-26748790 AAGGGGAGAGGGAAAGGGAAGGG - Intronic
972041328 4:34603878-34603900 TTAGGCAGACAGCAAGGGCATGG - Intergenic
972374725 4:38459663-38459685 TTGGGCAGACAAAAAGGACAAGG - Intergenic
973686193 4:53372299-53372321 TGGGGAAGACAGAAAAGTCAAGG + Intergenic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974096904 4:57373852-57373874 TAGAGGAGACACACAGGGCAAGG + Intergenic
974273654 4:59687038-59687060 TAGAGGAGATAGAAATGGAAAGG - Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
974983753 4:68993918-68993940 TGAGGGAGCCAGAAAGGGGACGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975201557 4:71596249-71596271 TTGGAGAGAGAGAAAGGGAAGGG + Intergenic
976461910 4:85321312-85321334 TTGGGCAGACAGTAAGGGAAGGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
979318765 4:119299245-119299267 TAGAGAAGACAGAGAGGGCCAGG - Intronic
979781653 4:124659094-124659116 GAGGGGAGGGAGAAAGGGAAGGG - Intergenic
980867340 4:138568176-138568198 TAGGGGAGAAACAAAGGGGAGGG + Intergenic
981557959 4:146015858-146015880 TAGGAGAGTCAAAAAGGGTAGGG + Intergenic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982335129 4:154227948-154227970 GAGGGGAGATAAAGAGGGCATGG - Intergenic
983537725 4:168876166-168876188 TAAGAGAGACAGCAAAGGCAGGG + Intronic
984073841 4:175150596-175150618 GATGTGAGACAGAAAGGGAAGGG - Intergenic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984248146 4:177300392-177300414 TCGGCAAGCCAGAAAGGGCAAGG - Intergenic
984889314 4:184476788-184476810 CAGGGGAGCCAGACAGGGCCGGG + Intergenic
984911366 4:184676759-184676781 GAAGGGAGAAAGAAAGGGAAGGG - Intronic
985652269 5:1112528-1112550 GAGGGGGTGCAGAAAGGGCAGGG - Intergenic
985923454 5:2997295-2997317 GAGAGGAGGCAGAAATGGCAAGG + Intergenic
985991230 5:3563594-3563616 TAGGGAAGGCAGAGAGGGTAAGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986875507 5:12103212-12103234 TAGGGAAGAAAGAAAGGGGTGGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988412062 5:30899141-30899163 TTGGGGAGATAAAAATGGCAAGG + Intergenic
989281566 5:39649801-39649823 AAGGGGAGACACAATGGCCATGG + Intergenic
990028547 5:51226159-51226181 TAGGGGAAACAGAGAGGGGCAGG + Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990863731 5:60357094-60357116 GAAAGCAGACAGAAAGGGCAAGG + Intronic
990999663 5:61770009-61770031 TAGAGAAGCCAGAAAAGGCAAGG - Intergenic
991344278 5:65646070-65646092 TAGGGGAGACAGAAAGAAACAGG + Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992396706 5:76375259-76375281 TAGGGGAGCCAGAGAGCTCAGGG - Intergenic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
993884428 5:93399132-93399154 TAGGAGAGATAGAGAGGGAAAGG + Intergenic
995831524 5:116360532-116360554 AAGGGGAGAAAGAAAGAGCTGGG + Intronic
996148153 5:120000607-120000629 TCGGGGAGACACAAAGGCCCAGG + Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996542131 5:124641355-124641377 AACGGGAGGCAGAAAGGGAAAGG - Exonic
996693712 5:126369138-126369160 TGGGGAAGGCAGAAAGGGAAAGG - Intronic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997133642 5:131301856-131301878 TAGGGGTATCAGAAAGGGAAGGG - Intronic
997202627 5:132020942-132020964 TAGGGGAAGCAGAAAGCACATGG - Intergenic
997622293 5:135306758-135306780 CAGGGAAGGCAGAAAAGGCAGGG - Intronic
998003077 5:138639919-138639941 CCAGGGTGACAGAAAGGGCAGGG - Intronic
998206095 5:140157688-140157710 CAGGGAAGACGGATAGGGCAAGG + Intergenic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998560928 5:143170937-143170959 TTGGGGAGACAACAAGAGCATGG + Intronic
1000114248 5:158138458-158138480 AAGGGAAGACAGAAAGTGCCAGG - Intergenic
1000531554 5:162428216-162428238 AAGGTGAGACAGAAAGGGTGAGG + Intergenic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001265837 5:170274099-170274121 TAGCTGAGACAGAGAGTGCATGG + Intronic
1001877179 5:175211651-175211673 TAGGGGAGAAATAAAAGACAAGG - Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002008194 5:176253131-176253153 AAGGGGAGACAGAGAGGGAGAGG + Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1003016040 6:2468261-2468283 AATGGGAGACAGAGAGGGAAGGG + Intergenic
1004205264 6:13586698-13586720 TAGGGAAGAGAGGAAGGGAAGGG + Intronic
1004426364 6:15509857-15509879 CAGGAGAGAAAGAAAAGGCAGGG + Intronic
1005151501 6:22756927-22756949 TTGGAGAGAAAGAAAAGGCAGGG + Intergenic
1005511599 6:26516834-26516856 CAGGGGACACACAGAGGGCACGG - Intergenic
1005874134 6:29998493-29998515 TGGGGGACACAGAAAGTCCATGG + Intergenic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006300286 6:33190462-33190484 TAGGGGAGCAAGTGAGGGCAAGG - Intronic
1007127157 6:39435135-39435157 TAGGCCTGACAGAAAGGGCAAGG + Intronic
1007187024 6:39980562-39980584 GAGGGGAGACGGTAGGGGCAGGG + Intergenic
1007732479 6:43955570-43955592 TGGGGGAGACTGAAAGAGCTTGG + Intergenic
1007924884 6:45642895-45642917 GAGAGGAGAGAGAAAGGGAAGGG - Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1010643975 6:78364832-78364854 GAGGGGAGCCAGAGAGGGCCAGG - Intergenic
1011006522 6:82651517-82651539 TAATGGAGACACAAAGGGCAGGG + Intergenic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1012153321 6:95783557-95783579 CAGGAGAGAGAGAAAGGGCAGGG + Intergenic
1013071962 6:106737570-106737592 TGGAGGAGACACACAGGGCAAGG + Intergenic
1013144971 6:107380390-107380412 TATGTTAGACAGAAAGGCCATGG + Intronic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1013814421 6:114080784-114080806 TAGGAGGGAGAGAAGGGGCAAGG + Intronic
1014106605 6:117571446-117571468 TAGTAGAGACAGAAAGAGTAAGG - Intronic
1014562227 6:122905218-122905240 TAGAGGATAGAGAAAGGGAAGGG - Intergenic
1014676488 6:124373545-124373567 TAGGGGAGACACTTAGGGAAAGG + Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1014816900 6:125945905-125945927 GAGGGGAGATACAAAGGGAAGGG + Intergenic
1014846708 6:126286664-126286686 TGGTGGAGAAAGAAAGGCCAAGG - Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015053575 6:128872712-128872734 TATGAGAGACAAAGAGGGCACGG - Intergenic
1015113465 6:129619534-129619556 AAGGGGAGAGAGAAAAGGAAGGG + Intronic
1015190631 6:130468006-130468028 AAGAGGAGACAGCAAGGGTAGGG + Intergenic
1015567931 6:134593120-134593142 TTGGGGACACAGGAAGGGTAGGG - Intergenic
1015866765 6:137734997-137735019 AACGGGAGACAGAAAGGACAGGG + Intergenic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016369468 6:143357209-143357231 TAAAGGACACAGAGAGGGCAAGG - Intergenic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1017622639 6:156315023-156315045 TCGGGGAGACAGACAGAGGAGGG + Intergenic
1017768351 6:157625248-157625270 TGGGGGTGAGAGAAAGGGCGGGG + Intronic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1019069138 6:169327114-169327136 TTTGGTAGAGAGAAAGGGCATGG - Intergenic
1020185205 7:5953729-5953751 TCGGGGAGAGAGAGAGGGGAGGG - Intronic
1020297710 7:6771015-6771037 TTGGGGAGAGAGAGAGGGGAGGG + Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021448590 7:20760004-20760026 TAGAGGAGAAGCAAAGGGCAAGG - Intronic
1021606242 7:22412208-22412230 AGAGGGAGAGAGAAAGGGCAAGG + Intergenic
1022508519 7:30921407-30921429 AAGGAGAGACAGGGAGGGCAGGG + Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023166597 7:37349349-37349371 TAGGTTAGGCAGAAAGGGAAAGG + Intronic
1024142731 7:46478667-46478689 AAGGGGAGAGAGGAAGGGCAGGG + Intergenic
1024355634 7:48411137-48411159 AAGGGGAGAAAGAAAAGGAAAGG - Intronic
1025210496 7:57017464-57017486 GAGGGGACCCAGAGAGGGCAGGG - Intergenic
1025661460 7:63559383-63559405 GAGGGGACCCAGAGAGGGCAGGG + Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026305196 7:69134451-69134473 AAGGGGAGACAGGGAGGGAAAGG - Intergenic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1027512403 7:79098830-79098852 GAGAGGAGAGAGAAAGGGGAGGG + Intronic
1027676711 7:81168246-81168268 TAGTGAAGACTGACAGGGCATGG + Intergenic
1028618222 7:92794634-92794656 AAGGGGAGACAGTAAGGATATGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030797819 7:113810538-113810560 TAATGGAGACAGAATGAGCAGGG + Intergenic
1031119029 7:117699532-117699554 TGGGGGAGATAGAAAGGACAGGG - Intronic
1031652209 7:124304473-124304495 GAGGAGAGACAGAGAGTGCAGGG - Intergenic
1032016078 7:128381155-128381177 CAGGGGAGAGAGAAAAGGAATGG - Intergenic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034446955 7:151118650-151118672 TGGTGGGGACAGGAAGGGCAGGG - Intronic
1036548237 8:9792594-9792616 AAGGGGAAAGAGAAAGGGAAAGG + Intergenic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1036656376 8:10679870-10679892 GAGTGGAGAGAGAAAGGGGACGG - Intronic
1036929003 8:12934802-12934824 TTTGAGAGAAAGAAAGGGCATGG - Intergenic
1037044062 8:14275567-14275589 TAGGGGAAACATAAAAGGAAAGG + Intronic
1037114913 8:15213073-15213095 GAGGGGCGACATAAAGGGGAAGG + Intronic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039194728 8:35018295-35018317 TAAAAGAGACAGAAAGGGAATGG - Intergenic
1041142994 8:54842860-54842882 AAGACGGGACAGAAAGGGCAGGG - Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1043043147 8:75287866-75287888 TTAGGAAGACAGAAAGTGCAGGG + Intergenic
1043102324 8:76061180-76061202 TAGGAGAGACAGAAAGTGAGAGG - Intergenic
1043512261 8:80961136-80961158 TAGGGGGCACAGTAAAGGCAGGG + Intergenic
1044734040 8:95259353-95259375 AAGTGGAGGCAGGAAGGGCAGGG + Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1046439218 8:114236628-114236650 TATGGGAGCCAGAAGGGGAACGG - Intergenic
1047071342 8:121347382-121347404 TAGGGGAGACTGAAAGAAGAGGG - Intergenic
1047153975 8:122296346-122296368 AAGGGGATAAAGAAAGGGAAGGG + Intergenic
1047476468 8:125236598-125236620 TCTGAGAGACAGGAAGGGCATGG + Intronic
1047613967 8:126547607-126547629 ATGGGGTGACAGGAAGGGCAGGG + Intergenic
1047800689 8:128306663-128306685 CGGGGGAGACTGATAGGGCAAGG - Intergenic
1048800409 8:138189268-138189290 AAGGGGAGCTGGAAAGGGCATGG - Intronic
1049499310 8:142953160-142953182 TGGGGGTGACAGGAAGGGGAGGG - Intergenic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1049978858 9:885408-885430 TAGGGGAGTCAGAAAGGAGATGG + Intronic
1050652575 9:7789958-7789980 TCGGGGAGACAGAAAGGCATTGG - Intergenic
1050900359 9:10940650-10940672 TAGGGACAAAAGAAAGGGCATGG - Intergenic
1051134931 9:13909432-13909454 AAGGGAAGACAGAAAGGCCTAGG + Intergenic
1051500214 9:17768558-17768580 TAGGAGAGACAGAAAGCACAGGG - Intronic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058692610 9:107532262-107532284 GAGGGGAGGTGGAAAGGGCAAGG - Intergenic
1059191548 9:112332809-112332831 TTGGGGAGAGAGAAAGGTGAGGG + Exonic
1059336538 9:113572595-113572617 TGGGGCAGACAGATAAGGCAAGG + Intronic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061451434 9:130669001-130669023 CAGAGGAGACAGACAGGGCCAGG + Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1062025321 9:134337581-134337603 TACTGGAGACAGAAGGGACACGG + Intronic
1062298413 9:135847973-135847995 AAGGGAAGCCAGAAAGGACAGGG + Intronic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186785809 X:12955180-12955202 TAGGGGAGAGAGAATGGGAGGGG - Intergenic
1186904184 X:14093637-14093659 GTGGGGAGAAATAAAGGGCAGGG + Intergenic
1187682980 X:21786642-21786664 TGGGGAAGTGAGAAAGGGCAGGG - Intergenic
1188558533 X:31440489-31440511 AAGAGGAGACAAAAAGAGCATGG + Intronic
1189105186 X:38228302-38228324 TAGGTGAGACAGGAAGGCTAAGG - Intronic
1189524506 X:41805636-41805658 AAGGGGAAAGAGAAAGGGAAGGG + Intronic
1189648300 X:43158451-43158473 TATGGGGGACATAAAGGGAATGG - Intergenic
1190742861 X:53301614-53301636 AAGGGGAGATAGACAGGGCTTGG + Intronic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191945393 X:66528975-66528997 TCAGGGGGACAGAAAGGGAAGGG + Intergenic
1192099607 X:68250135-68250157 TATGTTAGACAGAAATGGCAAGG + Intronic
1192211821 X:69132702-69132724 TGAGTGAAACAGAAAGGGCAGGG - Intergenic
1192502641 X:71663965-71663987 TGGGGGAGACAGGGAGGACAGGG - Intergenic
1195907800 X:109862916-109862938 CATAGGAGACATAAAGGGCAAGG + Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1196713347 X:118786666-118786688 AAAGGTAGACAGAAAGGGCCAGG - Intronic
1196943218 X:120798163-120798185 CAGGGGAGAGAGAAAAGGAAAGG - Intergenic
1197457488 X:126695860-126695882 TAAGGAAGACAGAAAATGCAGGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1198750017 X:139930499-139930521 TGGGGGTGACAAAAAGGGAAAGG - Intronic
1199209211 X:145187137-145187159 GAGGTGAGGCTGAAAGGGCAGGG + Intergenic
1199622622 X:149713698-149713720 TATGGGAGGCAGAAAGTGAAGGG - Intronic
1199686789 X:150272242-150272264 TGAGGGAGACGGAAAGGTCAAGG + Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1199805871 X:151299868-151299890 AAGAGGAAACAGAATGGGCAGGG - Intergenic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1200087045 X:153612044-153612066 TAGAGAAAACAGAAAGGACAAGG - Intergenic
1200154984 X:153970494-153970516 GAGGGGAGAGAGAGAGGGAAGGG + Intronic
1200442174 Y:3223621-3223643 TAGGGAAGACTGAAAGGAAAAGG - Intergenic
1201075244 Y:10181826-10181848 TAGGGGAGAAAGAGAGAGAAGGG + Intergenic
1201412375 Y:13713199-13713221 TGGGGGAGCCAGAAAGGAAATGG + Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1201696180 Y:16829012-16829034 GAGGGGAGACAGAGAAGGAAAGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201895282 Y:18986025-18986047 CAGGGAAGCCAGAATGGGCATGG - Intergenic