ID: 948949894

View in Genome Browser
Species Human (GRCh38)
Location 2:241242620-241242642
Sequence AAGCTGCACAACTCCCTCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948949894_948949903 30 Left 948949894 2:241242620-241242642 CCAATGAGGGAGTTGTGCAGCTT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948949903 2:241242673-241242695 GTTGGCCTGAAACCAAACACAGG 0: 1
1: 0
2: 0
3: 13
4: 132
948949894_948949900 12 Left 948949894 2:241242620-241242642 CCAATGAGGGAGTTGTGCAGCTT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948949900 2:241242655-241242677 GACCTCTACCTCGGCTATGTTGG 0: 1
1: 0
2: 0
3: 6
4: 36
948949894_948949899 3 Left 948949894 2:241242620-241242642 CCAATGAGGGAGTTGTGCAGCTT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948949899 2:241242646-241242668 AGGGATGGAGACCTCTACCTCGG 0: 1
1: 0
2: 2
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948949894 Original CRISPR AAGCTGCACAACTCCCTCAT TGG (reversed) Exonic
901112891 1:6813069-6813091 AACCCTCACAACTCCCCCATGGG - Intronic
905117344 1:35653712-35653734 AATCTGCACAATTTACTCATTGG - Intergenic
905127563 1:35726207-35726229 AAGCTCCCCAACTCCCTGCTGGG - Intronic
907518107 1:55006160-55006182 AAGGTGAACAACTGCCTCAGTGG + Intronic
912715209 1:111978660-111978682 AGGCTGCTCACCTCCCTCCTGGG + Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
914959213 1:152191340-152191362 AAGGGGCACAACTCCCAAATAGG - Intergenic
916688137 1:167166387-167166409 CAGCTGCACATTTCCCTCGTGGG + Intergenic
922586168 1:226736579-226736601 GAGCTGCCTAGCTCCCTCATTGG - Exonic
923994791 1:239481548-239481570 AACTTGCACAATTCCCTGATAGG + Intronic
1064308737 10:14192080-14192102 AAGGTGCACAGCTACCTCCTTGG + Intronic
1068545828 10:58344831-58344853 CAGCTGCACAGCTGCCTTATAGG + Intronic
1069990343 10:72311374-72311396 AAGCTGCTCAACTGCCTTCTGGG - Intergenic
1071776152 10:88790426-88790448 AATTTGTATAACTCCCTCATGGG - Intergenic
1073540697 10:104314613-104314635 AAGCTCCACCACTTCTTCATCGG - Exonic
1076706091 10:132302424-132302446 AAGCTGCACAGCTGCCCCAAGGG + Intronic
1079308440 11:19344824-19344846 AGGCTGGACAGCTCCCTGATGGG + Intergenic
1081887698 11:46512988-46513010 GAGCTGCAAAACTCCCACACTGG + Intronic
1083603545 11:63963004-63963026 ATGGGGCACACCTCCCTCATTGG + Intergenic
1085362172 11:75899459-75899481 AAGCAGGAGAACTACCTCATGGG - Intronic
1085904952 11:80749180-80749202 AGGCTGCAATACTGCCTCATTGG + Intergenic
1085942591 11:81222775-81222797 AATCTGCACAGCTCCATGATTGG + Intergenic
1097124514 12:56763245-56763267 AGGCTGCTTCACTCCCTCATAGG - Exonic
1097260647 12:57718183-57718205 ATGCTGCAGAAGTCCCTCAGAGG + Exonic
1098094762 12:66943219-66943241 AAGCTGCACCATTCTCTCTTTGG - Intergenic
1103468589 12:121162067-121162089 AAGGGGCACAAGTCCCTCAAGGG - Intronic
1110154751 13:72302558-72302580 CAGCTGTACAACTGCCTCTTGGG + Intergenic
1117555480 14:56879124-56879146 AAGCTTCACAACTCTCTAACAGG - Intergenic
1118687577 14:68306514-68306536 AAGCTGAACAGCTCTCTCAGAGG + Intronic
1119102447 14:71892545-71892567 GATCTGCACAACTGCCTCATAGG - Intergenic
1119647037 14:76355412-76355434 AAGCCTCACCACTCCCTCTTGGG + Intronic
1120393645 14:83940467-83940489 AAGCTGATCAGCTCCCTCACTGG - Intergenic
1126600791 15:50425112-50425134 AAGCTGCAGACCACCCTCCTGGG + Intronic
1127730744 15:61800021-61800043 AAACTGAACAACTCCCACATAGG - Intergenic
1127914296 15:63442596-63442618 AAGCTGCACATCTGGCTGATGGG + Intergenic
1134374522 16:13659491-13659513 AGGCTGCACAACTCCCTTGAGGG + Intergenic
1135723207 16:24834340-24834362 CAGCTGCACAGCTCCCTGAGAGG - Intergenic
1137622575 16:49885831-49885853 AATTACCACAACTCCCTCATTGG - Intergenic
1137692478 16:50438643-50438665 TAGCTGCCCATCACCCTCATTGG - Intergenic
1140544466 16:75792903-75792925 AAGCTGCAGGACTGCCTGATGGG + Intergenic
1149808747 17:59645372-59645394 AAGCTGCACAGTTCCCTTGTTGG - Intronic
1150659825 17:67065599-67065621 AAGCTGCACACCGACCACATTGG + Intergenic
1151842298 17:76627100-76627122 ATCCTGAACAACTCCCACATGGG - Exonic
1152392844 17:80013014-80013036 AATTTGCACAACAACCTCATGGG - Intronic
1152786932 17:82253171-82253193 AAGCCAGACAACTTCCTCATGGG - Exonic
1153025928 18:672290-672312 AAGCAGCCAAACTCCCTCAAAGG - Intronic
1156229451 18:35139627-35139649 AAGCTCCTGAGCTCCCTCATTGG + Intronic
1156537990 18:37882343-37882365 CAGCAGCACAAATCCCTCAGTGG - Intergenic
1157345593 18:46828402-46828424 GAGCTGCACAAATCCTTCAGTGG - Intronic
1158644150 18:59229344-59229366 AATCTACATAACTCCCCCATTGG - Intronic
1164113274 19:22191185-22191207 AAGTTTCACAATTCCCTCACTGG - Intronic
1167762298 19:51457424-51457446 AAGATGCCCAGGTCCCTCATGGG - Intronic
925629142 2:5871010-5871032 AAGCTGCCTAATTTCCTCATTGG + Intergenic
927314193 2:21663383-21663405 ATGCTGCCCAACTGCTTCATAGG + Intergenic
928875385 2:36032724-36032746 AAGCTACACAGGTCTCTCATTGG + Intergenic
929005736 2:37391165-37391187 AAGCAGCACAACACCCTGACGGG + Intergenic
929545241 2:42851315-42851337 AAGCTGAATAGCTCCTTCATGGG + Intergenic
934861087 2:97764149-97764171 AGGCTGCACAACTCCCCCAGCGG + Intronic
934880421 2:97972352-97972374 AAACTGCACTACTCCCACCTGGG + Intronic
942466779 2:176216519-176216541 AAGCTGCACAAATGCATCACTGG + Intergenic
948702109 2:239766990-239767012 AGGCTGAACTTCTCCCTCATGGG - Intronic
948949894 2:241242620-241242642 AAGCTGCACAACTCCCTCATTGG - Exonic
1172500904 20:35426414-35426436 AAGCAGCACAAGGCCCTCACTGG + Intergenic
1172874820 20:38157638-38157660 AAGCTTCACAACAACCTTATAGG - Intronic
1179469699 21:41602343-41602365 AAGCTTCACAACTCTCTGAGTGG - Intergenic
1183521998 22:38300879-38300901 AAGCCCGACAACTTCCTCATGGG - Exonic
954583150 3:51714333-51714355 AGGCTGCACTATTCACTCATGGG + Intronic
956711547 3:72042551-72042573 AAGCTGCCCTACCCCCTGATTGG - Intergenic
956838573 3:73116094-73116116 AAGTTGCTCACCTCTCTCATGGG - Intergenic
961513239 3:127417058-127417080 TAGCTGCTCAACACCCTCACAGG - Intergenic
962577888 3:136771387-136771409 AGTTGGCACAACTCCCTCATTGG + Intergenic
963999532 3:151753415-151753437 AAACTGCAAAACTCCCACATGGG - Intronic
968353279 3:198080493-198080515 AAGCTGAAGAGCTTCCTCATGGG + Intergenic
972270754 4:37509341-37509363 ACGCTGCTCACCTCCCACATGGG + Intronic
972291880 4:37697255-37697277 CAGCTGCAGAACTGTCTCATAGG + Intergenic
974839374 4:67283158-67283180 AGGCTGCACATGGCCCTCATGGG - Intergenic
978606616 4:110487144-110487166 AACCTCCACAAATTCCTCATGGG - Intronic
981248900 4:142574822-142574844 CAGCTGCACAGCTCCCTAAAGGG + Intronic
985195260 4:187421532-187421554 AAGCTGCTGATCTCTCTCATAGG - Intergenic
985489659 5:171929-171951 GAGCTGCACAACCCCCGCAGAGG - Intronic
986989293 5:13532883-13532905 AAGCTGAACATTTCCATCATGGG - Intergenic
987336250 5:16900519-16900541 AAGCTGCTCACCTCCCTGCTGGG - Intronic
988014968 5:25544177-25544199 AAACTGAGCAACTCCCACATAGG - Intergenic
989445064 5:41518313-41518335 AACCTCCACATCTCCCTCACTGG + Intergenic
990440466 5:55839683-55839705 AAGCTGTACAAAGCCATCATTGG + Intergenic
994610724 5:102036181-102036203 AAGTTATACAACTCCCTGATGGG - Intergenic
995243111 5:109907595-109907617 AAGCAGCATCTCTCCCTCATTGG - Intergenic
1001261845 5:170236524-170236546 AATCTGCAGAAAACCCTCATTGG + Intronic
1004349856 6:14881567-14881589 AAGATCCACAACTTCCTCAAAGG - Intergenic
1006278907 6:33030325-33030347 AATCGGGACAACTCCCTCCTGGG - Intergenic
1007195014 6:40052884-40052906 AAGCTGAAATACTTCCTCATGGG + Intergenic
1010715049 6:79218998-79219020 AAGCTCCACAACTATCTAATAGG + Intronic
1013227029 6:108126985-108127007 ATGCTTCACCTCTCCCTCATGGG - Intronic
1014912740 6:127113603-127113625 AAGCTGCAAAAATTACTCATTGG + Intergenic
1015815023 6:137200547-137200569 AAGCTGGACAAAGTCCTCATGGG + Intronic
1022109914 7:27222522-27222544 AAACTGCACAACAGCCTTATGGG - Intergenic
1030994467 7:116341687-116341709 CAGCTGCACTACTGCCTCCTTGG + Intronic
1031986002 7:128165207-128165229 AAGCTGCACATCTCCCTGCTGGG - Intergenic
1040953311 8:52956795-52956817 AAGGACCACAACTCCCCCATCGG + Intergenic
1041240365 8:55844199-55844221 ACGCTTCACAACGCCGTCATTGG + Intergenic
1048416460 8:134232604-134232626 AAGATGCCCAACTCCCTTGTTGG + Intergenic
1048683622 8:136875557-136875579 ACTGTACACAACTCCCTCATTGG - Intergenic
1048833267 8:138496623-138496645 CAGCTGCAAAACTCTCTCGTCGG - Intronic
1049934352 9:486446-486468 AATCTTCACAACTGCCTTATGGG + Intronic
1050289671 9:4140605-4140627 GAGCTGCTCAACTATCTCATAGG + Intronic
1051172585 9:14333488-14333510 AGGCCCCACAACTCCCTAATGGG + Intronic
1053051784 9:34967674-34967696 ATGCTGCTCAAATGCCTCATGGG - Intronic
1060435742 9:123591293-123591315 TAGCTGCCCAATTCCCTCCTTGG - Intronic
1191169151 X:57423421-57423443 AGGCTGCCGAACTCCCTGATTGG - Intronic
1192163697 X:68809294-68809316 AATCTGCACAACACCCTGGTAGG + Intergenic
1193557220 X:82969851-82969873 AAGCTGAATAACACCTTCATAGG + Intergenic
1199044306 X:143150902-143150924 AAACTGAAAAACTTCCTCATAGG + Intergenic
1201605623 Y:15781285-15781307 CAGCTGTACCACTCCTTCATGGG + Intergenic