ID: 948950862

View in Genome Browser
Species Human (GRCh38)
Location 2:241250453-241250475
Sequence AATCTGAGCCAACAGTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948950862 Original CRISPR AATCTGAGCCAACAGTAGAT GGG (reversed) Intronic
900769312 1:4528269-4528291 AATCTGAGACAACTTTAGAAAGG - Intergenic
905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG + Intergenic
906259748 1:44378021-44378043 AAGCTGAGCCCTCAGTAGACTGG + Intergenic
908770932 1:67594879-67594901 AATCTGAGCCAAAATTTGAGAGG - Intergenic
909010113 1:70324929-70324951 ATTGTGAGCCAAAAGTAAATGGG + Exonic
910485272 1:87706220-87706242 AGGCTGAGCCAACTCTAGATTGG - Intergenic
911411238 1:97510175-97510197 AGGCAGAGCCAACAGTAGATAGG + Intronic
915370261 1:155343657-155343679 AATGTGAGATAACAGTCGATAGG + Exonic
916353088 1:163874447-163874469 AATCTGAGAGAAGGGTAGATAGG + Intergenic
916366213 1:164030735-164030757 AGTGTGAACCAACAGTTGATTGG - Intergenic
917167904 1:172133872-172133894 AATCAGAGGTACCAGTAGATGGG + Intronic
918623012 1:186626299-186626321 AATTTCAGCCAACAGTAGGTAGG + Intergenic
920608035 1:207409067-207409089 AATCTGAAGCCACAGTAGAGTGG - Intergenic
924211175 1:241768817-241768839 AATCTGGGTCAACAGGAGACTGG + Intronic
1067530613 10:47069007-47069029 AATCTGGGTCCACAGTGGATTGG - Intergenic
1068493359 10:57752784-57752806 GATCTGAGCAAACAGAAAATAGG - Intergenic
1069793456 10:71038295-71038317 CATCTGTAACAACAGTAGATTGG + Intergenic
1072211962 10:93254353-93254375 ACTCTGAGCCAACAGTGCTTGGG - Intergenic
1072267786 10:93746991-93747013 AATGTGAGCCAGCAGTAGGCTGG + Intergenic
1072730789 10:97845067-97845089 GATCTGAGCCATCAGAAGAAAGG - Intergenic
1074229896 10:111523341-111523363 GATCTCAGGCAACAGAAGATTGG - Intergenic
1075087644 10:119424152-119424174 AATCAGATCCAACAGTGGGTGGG + Intronic
1078439231 11:11350538-11350560 AAACTGAGCCAGGAGTAGAGTGG + Intronic
1085817519 11:79755978-79756000 AATTTGAGCCAACAGAACTTAGG - Intergenic
1086126629 11:83355500-83355522 AGTCTGAGCCAACAGAACTTTGG - Intergenic
1089926067 11:122259093-122259115 AATATGATCCAACAGGAGCTTGG - Intergenic
1090389610 11:126380400-126380422 CATCAGAGCCACCAGTAGAGTGG + Intronic
1090591503 11:128275069-128275091 CATCTGAGAAAACAGTAGAAGGG + Intergenic
1091641955 12:2244117-2244139 AATCTGAGCCAAGAGCAGCAGGG - Intronic
1092165140 12:6337680-6337702 GATAAGAGCCAAAAGTAGATAGG - Intronic
1092443700 12:8533451-8533473 AATGTGAGTCAACAATAGATTGG + Exonic
1092596815 12:10015331-10015353 AACCTGGGCTAACAGTAGAAAGG + Exonic
1093258096 12:16897594-16897616 AATCTGAGACAATATAAGATAGG - Intergenic
1093976686 12:25430785-25430807 AACCAGAGCCAACAGAAGGTGGG - Intronic
1096289574 12:50330298-50330320 AATCTAATCTAACACTAGATAGG - Intronic
1100556589 12:95700571-95700593 ACTCTGAGTCAAAAGTAGAACGG - Intronic
1101535807 12:105615261-105615283 AATGTTAGCCAACATTAGATTGG - Intergenic
1103493642 12:121343976-121343998 AATCTCAGATAACAGTAGTTAGG + Intronic
1110097447 13:71546175-71546197 GATCTGAGGAAACAGTTGATAGG - Intronic
1110316311 13:74111957-74111979 AATCTGAGCCAAAATATGATTGG - Intronic
1114587168 14:23825673-23825695 AATCAGAGCAAACAGGAGATGGG + Intergenic
1116185306 14:41592962-41592984 AATGTCCACCAACAGTAGATTGG + Intergenic
1116628162 14:47293741-47293763 ATTCTGAGAGAATAGTAGATAGG + Intronic
1117263211 14:54058159-54058181 AATCTGAGCAGACTGTAGAGAGG - Intergenic
1117294686 14:54368496-54368518 GAAATGACCCAACAGTAGATTGG + Intergenic
1120701469 14:87703753-87703775 AATCTGAGCCATGAGAAGAATGG + Intergenic
1122148029 14:99705597-99705619 AATCTGAGTAAAGAGTACATGGG - Intronic
1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG + Intergenic
1123681099 15:22764671-22764693 ATTCTGAGACAAAAGTAGAATGG - Intergenic
1124333316 15:28839132-28839154 ATTCTGAGACAAAAGTAGAATGG - Intergenic
1126806775 15:52358365-52358387 CTTCTGAGCCTTCAGTAGATAGG - Intronic
1127005606 15:54566068-54566090 AAACTGAGCCAAGAGTAGGGGGG - Intronic
1127704703 15:61535412-61535434 AATCTGAGCCTCCAGTCGATTGG - Intergenic
1127757835 15:62110435-62110457 AATCTGGGCCAAGAGAAGAAGGG + Intergenic
1138232672 16:55350470-55350492 AATATGAGACAGAAGTAGATAGG + Intergenic
1138846018 16:60567587-60567609 TATCTGGGCCATCAGTGGATAGG - Intergenic
1141851451 16:86649115-86649137 AATCTGGGCCAACAGAGGAAGGG - Intergenic
1147487257 17:40828520-40828542 TATCTTAGCCAAGAGTAGAAAGG - Intronic
1150516328 17:65813481-65813503 TATCTGAGCCAACAGATGGTTGG + Intronic
1151200654 17:72465535-72465557 AATCCCAGCCAAAAGGAGATGGG - Intergenic
1154359684 18:13649158-13649180 AATAGGGGCCAACAGTAAATGGG + Exonic
1156941407 18:42771084-42771106 AATTTGAGCCAAGAGTAAAGAGG - Intronic
1159787689 18:72733818-72733840 ATTCAGAGCAAACAGTAGATTGG + Intergenic
1164530574 19:29045272-29045294 AATCTGAGCCAATAGTAAACAGG + Intergenic
927131646 2:20065188-20065210 TGTCTGATCCAACAGTATATTGG - Intergenic
929078354 2:38096918-38096940 CATCTGAGCCACCAGGAGTTGGG + Intronic
929988223 2:46759184-46759206 AATCTGAGCCAGCAGGAAAAGGG - Exonic
939794201 2:146621108-146621130 AACCCGAGCCAAAATTAGATAGG - Intergenic
941715339 2:168757481-168757503 ATTCTTAGCCAACAGGACATGGG - Intronic
942624130 2:177881078-177881100 TATCTGAGCCCTCAGTGGATTGG - Intronic
947269300 2:228316192-228316214 AATCAGAGCCAACACTTGAAAGG - Intergenic
948950862 2:241250453-241250475 AATCTGAGCCAACAGTAGATGGG - Intronic
1169649224 20:7848328-7848350 AAACTGACCCTAGAGTAGATAGG + Intergenic
1172073934 20:32279295-32279317 AATCAGAGGCAACAGTGAATGGG - Intronic
1177203756 21:17987189-17987211 AATCTCAGCCAACAGGAGGCAGG + Intronic
1183242587 22:36668929-36668951 TATCTGGGCCATCAGTGGATTGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953641229 3:44710211-44710233 AATCTGAGCCAGCAGGAAAAGGG + Intergenic
957834740 3:85572793-85572815 TCTCTGAGCCACCAGCAGATTGG + Intronic
958710556 3:97711691-97711713 TATCTGGGCCCTCAGTAGATTGG + Intronic
961148465 3:124615576-124615598 AATCTGAGTAAAGAGTATATAGG + Intronic
962152058 3:132903331-132903353 ATTCTGAGCCACCTGTAGCTGGG - Intergenic
962605768 3:137031793-137031815 AAACTGAGCAAACTGTATATTGG + Intergenic
967848138 3:194060532-194060554 AATCTGATCCAATAATTGATTGG + Intergenic
969968169 4:11018194-11018216 AATCTCACCCAACAGTAAATTGG - Intergenic
972641953 4:40933390-40933412 AATCTCAACCCACAGCAGATGGG + Intronic
976712802 4:88090892-88090914 AAGCTGAGCAAAGAGTAGACAGG + Exonic
978848227 4:113300659-113300681 AACCTGAGCCAAGAGAAGAGGGG + Intronic
981034311 4:140153606-140153628 AAACTGAGCCAGCAGCAAATCGG + Exonic
984305000 4:177977864-177977886 AATCTGAGAAAATAATAGATTGG - Intronic
986392092 5:7296662-7296684 ATTCTGAGACAAAAGTAGAATGG - Intergenic
987734558 5:21824131-21824153 AATTAGAGCCAGCAGCAGATGGG + Intronic
987829479 5:23076848-23076870 AATATGAGCCAAAAGCAGACTGG - Intergenic
994406367 5:99350882-99350904 AATCTGAGACAACTGTACACTGG + Intergenic
995597497 5:113763717-113763739 AATCTGAGCCAAAATTAAATTGG - Intergenic
1001230355 5:169981734-169981756 CATCTGAGCCTTCAGTAAATAGG - Intronic
1003909867 6:10733510-10733532 AACCGGAGCCAACAGCAGCTTGG - Intergenic
1008640666 6:53459100-53459122 ACTCTGAGCCCCCAGTGGATTGG + Intergenic
1008642153 6:53475004-53475026 ATTCTGAGCCCCCAGTTGATTGG - Intergenic
1013413088 6:109898947-109898969 AATCTAAGTCAAGAGTATATGGG - Intergenic
1013735614 6:113223130-113223152 AATCTGAGCCAGCAGGAAAGGGG - Intergenic
1014042506 6:116845824-116845846 AATATCAGCCAATAGTAGAATGG - Intergenic
1020224477 7:6269196-6269218 GATCTGAGCCAACAGGACATGGG + Intronic
1021908524 7:25360921-25360943 TACCTGAGACAACAGGAGATGGG - Intergenic
1021984697 7:26087229-26087251 GTTCTGAGCCAACAGTCAATGGG + Intergenic
1022478011 7:30724279-30724301 AATCTGAGTGAAGGGTAGATGGG - Intronic
1028016458 7:85719796-85719818 AAACTGAGAAAACAGGAGATTGG - Intergenic
1029055638 7:97738568-97738590 AGTCTGAGCCAACACTGGACAGG - Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1030938301 7:115614172-115614194 AACCTAAGACAACAGTCGATGGG + Intergenic
1031658683 7:124392863-124392885 AAACTGAGTCAAGAGTAAATAGG - Intergenic
1035572990 8:686344-686366 AATATGTGCCAACAATAGCTTGG + Intronic
1036407720 8:8469900-8469922 AATCTTAGCCAACAGTAGGGTGG + Intergenic
1043723994 8:83585794-83585816 AATCTGAGCCACCAGAATATAGG + Intergenic
1043727528 8:83629533-83629555 AATCTGAGGCAACTATGGATTGG - Intergenic
1047025888 8:120824225-120824247 AATCTGAACCAACATTTGAGAGG + Intergenic
1048949740 8:139486094-139486116 AATGTGAGCCAACAGGACAAAGG + Intergenic
1049984421 9:935284-935306 TATCAGAGCTAACAGCAGATTGG + Intronic
1053470660 9:38344156-38344178 GATCAGAGCCAAAAGCAGATGGG - Intergenic
1057998233 9:99840094-99840116 AGTCTGAGCCACCAGTAACTTGG - Intronic
1060271161 9:122142954-122142976 AATCTGAGGCAAAAGTTGGTTGG + Intergenic
1189156901 X:38767172-38767194 AATATCTGCCAACAGTAGAATGG - Intergenic
1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG + Intergenic
1189485916 X:41431603-41431625 AATTTAAGCCATCATTAGATAGG - Intergenic
1190591499 X:52007193-52007215 AATTTCAGTCAACAGTAGAGGGG - Intergenic
1192209870 X:69121113-69121135 AATCTGAGTCAACAGTCAACAGG - Intergenic
1192422342 X:71044806-71044828 AATCTGAGCCAGCAGGAAAAGGG + Intergenic
1194213229 X:91094803-91094825 AATCTAAGGCAAGAGTAAATAGG - Intergenic
1195656091 X:107332806-107332828 AAGCTGAGGCAAAAATAGATAGG - Intergenic
1198656266 X:138916774-138916796 AATCTGTACCAAGAGTAGGTTGG - Intronic