ID: 948953190

View in Genome Browser
Species Human (GRCh38)
Location 2:241268439-241268461
Sequence TCTGAAGACTTCCTGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953190_948953194 3 Left 948953190 2:241268439-241268461 CCCAGGGACAGGAAGTCTTCAGA 0: 1
1: 0
2: 2
3: 23
4: 190
Right 948953194 2:241268465-241268487 GGTCAAACTTACCAGCAAAACGG 0: 1
1: 0
2: 0
3: 3
4: 108
948953190_948953197 30 Left 948953190 2:241268439-241268461 CCCAGGGACAGGAAGTCTTCAGA 0: 1
1: 0
2: 2
3: 23
4: 190
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
948953190_948953196 18 Left 948953190 2:241268439-241268461 CCCAGGGACAGGAAGTCTTCAGA 0: 1
1: 0
2: 2
3: 23
4: 190
Right 948953196 2:241268480-241268502 CAAAACGGTCAGTAGCCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953190 Original CRISPR TCTGAAGACTTCCTGTCCCT GGG (reversed) Intronic
900950502 1:5855831-5855853 TCTGAAGCCTCTCTGTGCCTTGG - Intergenic
904783723 1:32969879-32969901 ACTGAAGGCTTCCTGTAGCTGGG - Intergenic
906061604 1:42952709-42952731 CTTGAGGACTTCCTGCCCCTAGG - Intronic
908010344 1:59769794-59769816 TCTGAAGGCTTCCTGATCCATGG + Intergenic
910063314 1:83119935-83119957 CTTGAATACTTCTTGTCCCTTGG - Intergenic
915017368 1:152746494-152746516 TCTTAACTCTTCGTGTCCCTTGG + Intronic
916059421 1:161088615-161088637 TCTGACCCCTTCCTTTCCCTGGG - Intronic
916117785 1:161502442-161502464 ACTGTAGACTCCCTCTCCCTTGG + Intergenic
916221682 1:162450981-162451003 TCTGCAGTCTTTGTGTCCCTGGG + Intergenic
916626175 1:166557840-166557862 TCTGAAGATTTATTGTCTCTAGG - Intergenic
917542077 1:175923882-175923904 TCTCAACCCTTGCTGTCCCTGGG + Intergenic
920329111 1:205192438-205192460 TGTGAAGACTCCTTGACCCTGGG + Intronic
1065941501 10:30568492-30568514 TCAGAAGATTTCCTGTTGCTAGG - Intergenic
1067479269 10:46584744-46584766 TCACAAGACGTGCTGTCCCTCGG + Intronic
1067615470 10:47757057-47757079 TCACAAGACGTGCTGTCCCTCGG - Intergenic
1069308102 10:66997752-66997774 TTTGAGGACTTCCTCTGCCTGGG - Intronic
1069350726 10:67523659-67523681 TTAAAAGACTTCCTGTCCTTTGG - Intronic
1069872329 10:71540744-71540766 CCAGGTGACTTCCTGTCCCTTGG + Intronic
1070523814 10:77277444-77277466 GCTGAGGTCTTCCTTTCCCTGGG - Intronic
1078333345 11:10444207-10444229 TCTGTAGCCTTCCTGTCCCACGG - Intronic
1078667895 11:13341248-13341270 TCTGCAGGCTTCCTGTCCCACGG + Intronic
1079703801 11:23587648-23587670 TCTGAAGACTTATTCTCACTGGG - Intergenic
1082075001 11:47969369-47969391 TCTGAAGAATTCCTCTGCCCTGG - Intergenic
1083762822 11:64827893-64827915 TCTGAAGACTCCCTGTCGCCCGG + Intronic
1084276442 11:68053521-68053543 TCTGCTCACTTGCTGTCCCTTGG + Exonic
1084858847 11:72005241-72005263 TCTGAAGACCTGCTATCCCCTGG - Exonic
1085088347 11:73688569-73688591 TCTTAAGAGATCTTGTCCCTGGG + Intronic
1086642403 11:89175936-89175958 ACACAAGACTTCTTGTCCCTGGG - Intergenic
1088578787 11:111297709-111297731 TCTGGAGACTTTCTGACTCTGGG - Intergenic
1089352856 11:117831255-117831277 GCTGAGGACTGCCTGACCCTGGG + Intronic
1089486024 11:118846720-118846742 CCTGCATGCTTCCTGTCCCTAGG + Intergenic
1089974475 11:122720540-122720562 TCTAAAGCCTTCCTGTCTCTAGG + Intronic
1090410661 11:126507423-126507445 TCTCAACACCTCCTTTCCCTAGG + Intronic
1090545787 11:127766389-127766411 TCCGAGCACATCCTGTCCCTTGG + Intergenic
1090693321 11:129208888-129208910 TCTGAATACTTTCTGTTCTTTGG - Intronic
1091876564 12:3939310-3939332 TCTGAAGCCTTCCTGTTCCTAGG + Intergenic
1093087650 12:14884525-14884547 TCTGAAGACGTCATAGCCCTTGG - Intronic
1094104902 12:26800964-26800986 TCTGAGTACCTCCTGTCCCTGGG - Intronic
1094848100 12:34370229-34370251 TTTCAAGACTTCCTGTCACTTGG + Intergenic
1096622451 12:52873074-52873096 AATGAAGGCGTCCTGTCCCTGGG + Intergenic
1102474678 12:113180928-113180950 TCTGGAGGCTTCCAGTCCATGGG - Exonic
1102744062 12:115234111-115234133 TCTTCAGACTTCCTGTCACCAGG - Intergenic
1103557355 12:121774768-121774790 CCTGAAGACCTTCTGTTCCTGGG - Intronic
1106188603 13:27429812-27429834 TCTTAAAACTTCTTCTCCCTTGG + Intronic
1106313585 13:28574956-28574978 ACTGAAAACTTCCTGTTCCCAGG - Intergenic
1107974299 13:45674854-45674876 TCTGAAAACTTTCATTCCCTGGG - Intergenic
1110793901 13:79614971-79614993 TCTGCAGAACTTCTGTCCCTTGG - Intergenic
1110870527 13:80447724-80447746 TCTGAAGACTTGCTGAGGCTTGG + Intergenic
1111314680 13:86538087-86538109 TATGAAGTCTTCCTTTCCTTTGG - Intergenic
1113442195 13:110337721-110337743 TCTGAAGTCTGCCTGTCCCAGGG + Intronic
1114803768 14:25809516-25809538 TCTGAATTCTGCCTGTTCCTGGG + Intergenic
1117954732 14:61113719-61113741 GCTGAAGAGTGCCAGTCCCTTGG + Intergenic
1118724835 14:68621649-68621671 CCTGAAGACTTGATGTCCTTGGG - Intronic
1119416616 14:74474635-74474657 CCTGAAGGCTCCCTGGCCCTGGG - Intergenic
1120670700 14:87359703-87359725 TCTGAAGCCTTCCTCTCACCTGG + Intergenic
1120850610 14:89165594-89165616 TCTGCAGACTTCCTATTTCTTGG + Intronic
1122519500 14:102333596-102333618 TCAGAAGACTTCCTGTTTCTAGG + Intronic
1123965414 15:25451039-25451061 TCTGGATATTTCCTTTCCCTTGG - Intergenic
1124159185 15:27253511-27253533 CCTGAGGGTTTCCTGTCCCTGGG + Intronic
1126663021 15:51050839-51050861 GCTGAAAAATTCCTGTCACTTGG - Intergenic
1127497107 15:59523763-59523785 TCTGCAGCCTTCTTGTCTCTTGG + Intergenic
1129233287 15:74208674-74208696 TCTGCTCACTTCCTGCCCCTAGG + Intronic
1129757821 15:78109090-78109112 TCTGAAGAGTGCCTGTCCAGTGG - Intronic
1130554006 15:84910162-84910184 TCTGAAGTCTTCTTGCCCCCTGG + Intronic
1131294293 15:91133682-91133704 TCTCCACACTTCCTGTCCCCAGG + Intronic
1131756629 15:95571039-95571061 TCTGAAGATTTCCCATCCTTAGG - Intergenic
1132651126 16:1021861-1021883 TGTGAAGACTCCCGCTCCCTAGG - Intergenic
1134398836 16:13890038-13890060 TCTGCAGAGTTTGTGTCCCTGGG - Intergenic
1135227396 16:20673640-20673662 TCTGAAGGCACCCAGTCCCTGGG + Intronic
1137707390 16:50545073-50545095 TTTGAAGATTTCCTATCCTTTGG - Intergenic
1138536276 16:57662045-57662067 CCTGAAGACTTCCCTTCTCTGGG + Intronic
1138814406 16:60187766-60187788 TCTGAATACTTCCCTTCCCCTGG - Intergenic
1139969883 16:70767513-70767535 ACTGAAGACATCATGACCCTTGG + Intronic
1143918589 17:10313088-10313110 TATGAAGACTCCTGGTCCCTTGG + Intronic
1144582867 17:16469733-16469755 TCAGGACACTTCCTGTCCTTGGG + Intronic
1146675825 17:34773273-34773295 TTTCAAGACTTCCTGTTCCGAGG - Intergenic
1146826660 17:36029018-36029040 CCAGAAGTCTTCCTCTCCCTTGG + Intergenic
1149160961 17:53692284-53692306 TCTGATGATCTCTTGTCCCTGGG + Intergenic
1152090259 17:78242557-78242579 TCTGATGACTTGCTTCCCCTAGG - Intergenic
1152257633 17:79249409-79249431 TCTGAAGCCTTGCTGGCCCTGGG + Intronic
1154500938 18:14997690-14997712 GCTGAAAACTTCCTGTGCTTTGG - Intergenic
1159934315 18:74350211-74350233 TCTGAAGACTCCCTGTACAAGGG - Intronic
1159989958 18:74893369-74893391 TTTGAACACTTTCTGTTCCTGGG + Intronic
1160035811 18:75300741-75300763 TCTGAGGAGTACCTGTCCCAGGG - Intergenic
1160079605 18:75712771-75712793 TCTGGGGACTTCCTGTGTCTAGG + Intergenic
1160220456 18:76973713-76973735 TCTGACGGCTGCCTGTCCCTGGG + Intergenic
1160312281 18:77807125-77807147 TTTGAAGTCTTCCTGCCTCTTGG + Intergenic
1162712964 19:12610116-12610138 TCTGAAGAGTCCCTGTGCCCAGG + Intronic
1165828525 19:38719171-38719193 TCTGAAGGCTTCCAGACCCCTGG - Intronic
1165932504 19:39369042-39369064 TCTGAACAACTCCTGTCCCCAGG - Intronic
1166282323 19:41802466-41802488 TCTGCAGGGTTTCTGTCCCTGGG - Intronic
1167855145 19:52231199-52231221 TCTGAAGACTTCATGACTCAGGG - Intergenic
926487300 2:13477800-13477822 TGTAAAGACTCCCTGTCTCTTGG + Intergenic
928529135 2:32172884-32172906 TCTGATTACTTCTTTTCCCTTGG - Intronic
930786814 2:55279540-55279562 TCCGTAGTGTTCCTGTCCCTGGG - Intergenic
931077236 2:58729330-58729352 TCTGAACATTTGCTGTCTCTGGG - Intergenic
931128606 2:59305662-59305684 TCTCAAGAATTCCTGTCTCCTGG - Intergenic
931424353 2:62157400-62157422 TCTTAAGCCTTCCTCTACCTAGG - Intergenic
931998089 2:67858040-67858062 TGTGAAGACTGCCTGCCTCTAGG - Intergenic
932153048 2:69390425-69390447 TCTGACAACATTCTGTCCCTGGG - Intergenic
932563099 2:72889261-72889283 TCACAAGACTCCCTGTCCTTTGG - Intronic
933702580 2:85266264-85266286 TCTGAAGGCTTACTGTCTCTAGG - Intronic
934681563 2:96287359-96287381 TATGTAGTCTTCCTGTTCCTAGG - Intronic
936729851 2:115368244-115368266 ACTGTAGACTTCCTGTCCCCAGG - Intronic
939462801 2:142518475-142518497 TCTGAGGTCTTCCTATCACTTGG + Intergenic
941834467 2:170001297-170001319 TTTGAAGAGTTCATGTCTCTTGG + Exonic
943609725 2:190018193-190018215 GCTGAAGACTTCCTATATCTGGG - Intronic
943686878 2:190827801-190827823 TCTGAAGTACTACTGTCCCTCGG - Intergenic
943715768 2:191150858-191150880 TCTGAAGCTTTGCTTTCCCTTGG - Intronic
943912776 2:193590017-193590039 TCTAAAGACATCCAGTCCCATGG - Intergenic
945322151 2:208436712-208436734 TCTGGAGACATCCTGTTTCTGGG + Intronic
945818204 2:214631485-214631507 TCTGTAGGCTTCATGCCCCTTGG - Intergenic
948708523 2:239810726-239810748 TCTGATGACTCCCTGCCCCATGG - Intergenic
948745452 2:240089576-240089598 CCTCAAGACTTCATGTCCTTTGG - Intergenic
948953190 2:241268439-241268461 TCTGAAGACTTCCTGTCCCTGGG - Intronic
1168974683 20:1955388-1955410 TCTTAAAACTCCCCGTCCCTAGG + Intergenic
1168995808 20:2132392-2132414 TGTGAAGAGTGCCTATCCCTGGG + Intronic
1169995698 20:11553733-11553755 ACTGCATACTTCCTGTACCTTGG - Intergenic
1171372277 20:24669561-24669583 TCTGAAGACCTCCTTTGTCTTGG - Intergenic
1172501877 20:35433481-35433503 CCTGGTGACTTCCTGTCCCTGGG - Exonic
1172672078 20:36641529-36641551 TCTGAAGGCTTCCTGCACATTGG + Intronic
1172818666 20:37712095-37712117 GCTGAAGCCATGCTGTCCCTGGG + Intronic
1178907173 21:36646384-36646406 TCTGGAGGCTGCCTGGCCCTCGG + Intergenic
1178915596 21:36704124-36704146 TCTGAACTCTTCCAGTGCCTGGG + Intronic
1182432411 22:30307609-30307631 TCTGAAGGGTTACTGTCACTTGG - Intronic
1184368187 22:44065991-44066013 TCTGATGACTTCTTTTCCCTTGG + Intronic
1185081308 22:48710812-48710834 GCTGCAGACTCCCTTTCCCTTGG + Intronic
950687517 3:14629080-14629102 GCTGACAACTTCCTGCCCCTGGG - Intergenic
950883693 3:16344666-16344688 TCTGATGCCATCCTGTGCCTTGG - Intronic
952399261 3:32948592-32948614 CCTGAAGACTGACTGTCCCCAGG + Intergenic
952969027 3:38639049-38639071 CTTGAAGATTTCCTGTTCCTAGG + Intronic
954524670 3:51259471-51259493 TCTGAGGAGTTCCTGACGCTTGG - Intronic
954963899 3:54593055-54593077 TCTGCAAACTTCGTCTCCCTAGG - Intronic
955786611 3:62547427-62547449 TCTGAAGAACTCCCGTTCCTCGG + Intronic
956144466 3:66178292-66178314 TCTGAAGCCTTCCTGGCTCATGG + Intronic
959567695 3:107849381-107849403 TCTGGGGTCTTCCTGTCCCTGGG - Intergenic
960006122 3:112782849-112782871 TCTGTAGCATTCCTTTCCCTGGG - Intronic
961051298 3:123749345-123749367 TCTGAGAACTTCCTCTCCCGTGG - Intronic
961367465 3:126409180-126409202 GCTGAAGAGTGCCTGTCTCTGGG - Intronic
963768498 3:149364308-149364330 ACTGAAGGCTTCCTGTCTTTGGG - Intergenic
964005930 3:151828981-151829003 TCTGAAGACTGCCTGTAGTTGGG - Intergenic
964030320 3:152130914-152130936 TATAAAGACTTCTTGTCCTTTGG - Intergenic
965925428 3:173973136-173973158 TCTAAAGACTTCCAGTGCATTGG - Intronic
966242186 3:177766892-177766914 TCTGAAGATATCCTGTTTCTGGG - Intergenic
968039636 3:195578469-195578491 CCTTAAGACTTCCTCTCCTTAGG - Intronic
972680117 4:41298209-41298231 TCTAAAGAATTGATGTCCCTGGG + Intergenic
976397444 4:84571277-84571299 TCTGATGGCTTCCTATCTCTGGG + Intergenic
977405572 4:96593544-96593566 TCTGACCATTTCCTGTGCCTGGG + Intergenic
977962332 4:103100190-103100212 TCTGGAGCCTTCCTGTCACTTGG + Intergenic
978359029 4:107908453-107908475 TCTGGTGACTTCCTGATCCTGGG + Intronic
982562661 4:156949064-156949086 TCTGAAAACATCCAGTTCCTTGG + Intronic
983636733 4:169905385-169905407 TCTGAAAACTTCCAGGACCTGGG - Intergenic
984820156 4:183875108-183875130 TCTGCAGACTTAGTGGCCCTGGG + Intronic
987691587 5:21273912-21273934 TCTGAAGACTCCATCTGCCTGGG - Intergenic
989148546 5:38273428-38273450 TCTGAGGCCTTCCTGTCACTAGG - Intronic
989257386 5:39380169-39380191 TCTAAAGACTTCATGTCTCTTGG - Intronic
990061022 5:51648490-51648512 TCTGAAGACTTCATACTCCTTGG + Intergenic
991748792 5:69776225-69776247 TCTGAAGACTCCATCTGCCTGGG + Intergenic
991800370 5:70356037-70356059 TCTGAAGACTCCATCTGCCTGGG + Intergenic
991828230 5:70654004-70654026 TCTGAAGACTCCATCTGCCTGGG - Intergenic
991892728 5:71355477-71355499 TCTGAAGACTCCATCTGCCTGGG + Intergenic
992454908 5:76908036-76908058 TGGGAAGACTACCTGACCCTGGG + Intronic
996092858 5:119367687-119367709 ACTGAATACTTCCTGTCCAAGGG - Intronic
997106549 5:131026650-131026672 TTTGAAAACTTGCTGTCTCTTGG - Intergenic
999435982 5:151563639-151563661 TTTGCTGACTTACTGTCCCTAGG - Exonic
999470480 5:151850404-151850426 CCTGAACACTTCCTGTTCCCAGG - Intronic
999576667 5:152986232-152986254 TCTGAAGACTGTCTGTTTCTAGG - Intergenic
1002132194 5:177088398-177088420 TCTGGAAACATCCTCTCCCTCGG - Intronic
1002430227 5:179199108-179199130 TATGAAGTCAGCCTGTCCCTAGG - Intronic
1005316069 6:24603996-24604018 TCTGGTTCCTTCCTGTCCCTTGG - Intronic
1013293227 6:108736482-108736504 ACTGGAGAGTTCCAGTCCCTGGG + Intergenic
1017400307 6:154053744-154053766 TCTAAAGAATTCCTGTACATGGG - Intronic
1017911378 6:158795902-158795924 GCTGATGACTTCCTGCCACTGGG + Intronic
1019292435 7:257290-257312 TCTGCAGCATTCCTGTGCCTCGG - Intronic
1019391509 7:789864-789886 ACTGAAGACTTTGTGTCCTTGGG - Intergenic
1019583207 7:1779615-1779637 TCTGAAGATTCCCTGTCGCCTGG + Intergenic
1020142780 7:5621717-5621739 TCTGAAGCCTTCCTGGCCACAGG - Intronic
1027188345 7:75984614-75984636 TCTGATGCCTCCCTGGCCCTGGG - Intronic
1028944507 7:96561778-96561800 TGTGGAGACTTACTTTCCCTGGG + Intronic
1029649540 7:101881744-101881766 ACTGATGACTTTCTGTCACTTGG + Intronic
1030585613 7:111414920-111414942 TCTGAAGATTCCCTTCCCCTTGG + Intronic
1031987722 7:128174125-128174147 TCTCAAGATTCCCTGTTCCTAGG + Intergenic
1034972215 7:155426480-155426502 TCTCCACACCTCCTGTCCCTGGG + Intergenic
1036686271 8:10913762-10913784 TCTGCAGCCTTCCTGTCACCTGG - Intronic
1037244535 8:16817774-16817796 TCTGGGGACTTCCTGTCCCTAGG - Intergenic
1037307536 8:17521603-17521625 TGTGAAGAGTCCCTGTCTCTGGG - Intronic
1039624649 8:39036363-39036385 TCTTAAGACTTCCTAATCCTAGG + Intronic
1040661145 8:49577287-49577309 TCTGAGGACTTACTATCCCTGGG - Intergenic
1042029581 8:64461366-64461388 TTTTAAGACTTTCTGTCTCTGGG + Intergenic
1043344823 8:79286915-79286937 TCTGAAGACCTCCTGTGCAGGGG + Intergenic
1044965262 8:97568265-97568287 TCTGAGGACTTCCTTGTCCTTGG + Intergenic
1048877333 8:138847135-138847157 TCTGAAGACTCCCACTCCCTGGG - Intronic
1049186599 8:141258195-141258217 TCTGGCGACTTCCTGACCCTAGG - Intronic
1050278177 9:4022082-4022104 TCTAAAGACTTGCTATGCCTAGG + Intronic
1055494329 9:76839675-76839697 TCTGAAGACTTCATGGCAATAGG + Intronic
1059175503 9:112166632-112166654 CCTGGAGAATTCCTCTCCCTTGG - Intronic
1060180651 9:121531368-121531390 TCTGATGACTTCCACTACCTAGG - Intergenic
1060436256 9:123595590-123595612 CCTGGAGACTTTCTGGCCCTGGG - Intronic
1061365113 9:130168594-130168616 TCTGAAGACTTCCTGGGGCCCGG - Intergenic
1061365520 9:130170992-130171014 TCTGAAGACTTCCTGGGGCCTGG + Intergenic
1061540052 9:131273345-131273367 TCTGACTCCATCCTGTCCCTGGG + Intronic
1062463481 9:136671430-136671452 TCTGAAAAGGTCCTGGCCCTGGG + Intronic
1186211664 X:7256465-7256487 TCTGATTATTCCCTGTCCCTGGG + Intronic
1186562899 X:10631788-10631810 TCTTAAGGATTCCTGTGCCTTGG - Intronic
1186580718 X:10815024-10815046 TGTGAACATTTCATGTCCCTGGG + Intronic
1189247080 X:39571594-39571616 TTTGAAGAGATCCTGTGCCTAGG - Intergenic
1191868702 X:65727122-65727144 TCTGAAGCCATGCTGTGCCTGGG - Intronic
1193490648 X:82144273-82144295 TCTGAAGACTGACTGTGCCTGGG + Intergenic
1194626351 X:96230414-96230436 TTTTAAGACTTTCTGTCCCAGGG - Intergenic
1194756076 X:97741474-97741496 TCTGGAAATTTCCTGTCACTTGG + Intergenic
1197181433 X:123541085-123541107 TCTTTATACTTCCAGTCCCTAGG + Intergenic
1198711082 X:139505119-139505141 GCTGAAGTCTTTCTGTCCCCAGG + Intergenic
1199546062 X:149008327-149008349 TCTGAAGAATTTCTGCCCTTGGG + Intergenic
1200274400 X:154718065-154718087 ACAAAAGACTTCCTGTCCCAGGG - Intronic
1201584805 Y:15548790-15548812 TCTGAGTATTTCCTGTCCCTGGG + Intergenic
1201586745 Y:15569520-15569542 TATGAAGACTTGGTGTCACTGGG + Intergenic