ID: 948953191

View in Genome Browser
Species Human (GRCh38)
Location 2:241268440-241268462
Sequence GTCTGAAGACTTCCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953191_948953197 29 Left 948953191 2:241268440-241268462 CCAGGGACAGGAAGTCTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
948953191_948953194 2 Left 948953191 2:241268440-241268462 CCAGGGACAGGAAGTCTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 948953194 2:241268465-241268487 GGTCAAACTTACCAGCAAAACGG 0: 1
1: 0
2: 0
3: 3
4: 108
948953191_948953196 17 Left 948953191 2:241268440-241268462 CCAGGGACAGGAAGTCTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 948953196 2:241268480-241268502 CAAAACGGTCAGTAGCCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953191 Original CRISPR GTCTGAAGACTTCCTGTCCC TGG (reversed) Intronic
902820797 1:18942033-18942055 TTCTGAGCACTTCCTCTCCCCGG - Intronic
905823082 1:41009220-41009242 GGCTGAAGGCCTCCTGTCCAGGG - Intronic
906095745 1:43222820-43222842 GCCTGACGTCTTCCTGTGCCTGG - Intronic
913296047 1:117321354-117321376 TTCTGAAGGCTTCCTGTATCAGG + Intergenic
914872786 1:151489371-151489393 TTTTGATGACTTCCTCTCCCAGG - Intergenic
914882435 1:151557736-151557758 GGCTGAGGACTTCCAGTCTCTGG - Intronic
916239840 1:162628306-162628328 TTCTTAAGACTCCCTGTTCCTGG - Intergenic
916559172 1:165918131-165918153 CTCTGAAGCCTTCATGTTCCAGG - Intergenic
917515055 1:175700194-175700216 GTCAGAGGAGTCCCTGTCCCAGG + Intronic
917542076 1:175923881-175923903 GTCTCAACCCTTGCTGTCCCTGG + Intergenic
920329110 1:205192437-205192459 GTGTGAAGACTCCTTGACCCTGG + Intronic
924104401 1:240636012-240636034 GCCTGGAGAATTCCAGTCCCAGG - Intergenic
924290646 1:242533284-242533306 GTCTGCACATTTCCTGTTCCAGG + Intergenic
924639270 1:245817562-245817584 GTCTGAAGCCTTCTTCTCTCAGG - Intronic
1062850197 10:737183-737205 GTCTGAAGCCTTACTCTACCCGG - Intergenic
1063423006 10:5928578-5928600 GCCTGAACACTTACTCTCCCCGG - Intronic
1066072463 10:31833708-31833730 GTCTGATGTCTTTCTCTCCCAGG - Intronic
1068363579 10:56013032-56013054 GTCTGAAGACTTAGTCTCCAGGG - Intergenic
1072107836 10:92291089-92291111 GTCCGAAGACTACATCTCCCAGG + Intergenic
1072921261 10:99579065-99579087 GACTGAGGAAGTCCTGTCCCTGG + Intergenic
1076119617 10:127925140-127925162 GACTGAAGGCCTCCTGTCCATGG - Intronic
1076589508 10:131573670-131573692 ATCTGAAGTCTCCCTTTCCCAGG - Intergenic
1076915475 10:133421250-133421272 ACCTGAATACTTCCTGCCCCAGG - Exonic
1077608959 11:3632228-3632250 GTCTGAGTAGTTCCTATCCCTGG - Intergenic
1079703802 11:23587649-23587671 GTCTGAAGACTTATTCTCACTGG - Intergenic
1081429990 11:42966371-42966393 CTCTGAAGTCCTCCTGCCCCTGG - Intergenic
1083486290 11:62984718-62984740 GGCTGAGGCCTTCCAGTCCCAGG + Exonic
1088698414 11:112390131-112390153 GGCTGAAGACTTCTTGTCCTTGG + Intergenic
1088831952 11:113544331-113544353 CTCTGAAGCCTTGCTGACCCTGG - Intergenic
1089991762 11:122868293-122868315 GTTTGCAGACCTCCTGTCCAAGG - Intronic
1090289088 11:125526215-125526237 GTCTTAAGACCTCCTATCCTAGG + Intergenic
1090758260 11:129814092-129814114 CTCTGAAGAGTTCCTGGTCCCGG + Intergenic
1091596520 12:1882512-1882534 GTCTGACCCCTTTCTGTCCCGGG + Intronic
1094104903 12:26800965-26800987 CTCTGAGTACCTCCTGTCCCTGG - Intronic
1094780164 12:33782036-33782058 GTCAGATGAGTTCCTCTCCCTGG - Intergenic
1096622450 12:52873073-52873095 GAATGAAGGCGTCCTGTCCCTGG + Intergenic
1101240312 12:102832158-102832180 GTCTGAAGCCTTCTTCTCTCAGG + Intergenic
1101754896 12:107613720-107613742 GCCTGAAGACCTGCTCTCCCTGG + Intronic
1102474679 12:113180929-113180951 GTCTGGAGGCTTCCAGTCCATGG - Exonic
1103025745 12:117572373-117572395 GTCTGCAGATTTCCTGGACCAGG - Intronic
1103557357 12:121774769-121774791 GCCTGAAGACCTTCTGTTCCTGG - Intronic
1105750839 13:23420708-23420730 GCCTGAGGACTTCCTGGGCCTGG + Intronic
1105906037 13:24811618-24811640 GTCTGAAGCCTTCTTCTCTCAGG + Intronic
1109255638 13:60077678-60077700 GTCTGAATACTCCCTTTCCTGGG - Intronic
1111002476 13:82204157-82204179 GTCTGAAGACATCTTGACCTTGG + Intergenic
1111558871 13:89917337-89917359 GTCTGAAGCATTACTGTCCAAGG - Intergenic
1113060709 13:106319786-106319808 GTCTGAACACTTCCAGTGGCAGG + Intergenic
1113442194 13:110337720-110337742 ATCTGAAGTCTGCCTGTCCCAGG + Intronic
1114539292 14:23442963-23442985 GTCTGTAGCCTGCCTGTCCTGGG + Intergenic
1118724837 14:68621650-68621672 GCCTGAAGACTTGATGTCCTTGG - Intronic
1119416618 14:74474636-74474658 GCCTGAAGGCTCCCTGGCCCTGG - Intergenic
1119758108 14:77132979-77133001 GGCTGGATGCTTCCTGTCCCTGG - Exonic
1122623845 14:103074284-103074306 GCCTGGAGACCTCCAGTCCCAGG - Intergenic
1125498750 15:40223413-40223435 GTCTGAAGTCTTACTGCTCCAGG - Intergenic
1130435317 15:83892548-83892570 GTCTTATGACTCCCAGTCCCAGG + Intronic
1132004971 15:98218620-98218642 GCCTGAGGTCTTCCTGACCCAGG - Intergenic
1133360943 16:5173363-5173385 GAATGAAGACTTCCTTTCCTAGG + Intergenic
1135945629 16:26862439-26862461 GGCTGAACACCACCTGTCCCAGG - Intergenic
1136573039 16:31108317-31108339 GTCTGAGGACGTGCCGTCCCGGG - Intronic
1143955911 17:10669107-10669129 GTGGGAAGACCTCATGTCCCAGG + Intergenic
1144118853 17:12129534-12129556 GTCTCCAGACTTCCAGTACCTGG + Intronic
1144650313 17:17003009-17003031 GCCTGGAGAGTCCCTGTCCCAGG - Intergenic
1148075257 17:44932101-44932123 GTCTGAAGAGTTCCCTTCCATGG + Exonic
1150346798 17:64410947-64410969 GTCTCAGGACTTCCTGGCCAGGG + Intronic
1151654143 17:75487825-75487847 GTCTGCCCACTTCCTCTCCCAGG - Intronic
1151794213 17:76332369-76332391 CACTGAAGACTGCCTGTGCCAGG - Exonic
1152108472 17:78343838-78343860 CTCAGCTGACTTCCTGTCCCTGG + Intergenic
1152257632 17:79249408-79249430 ATCTGAAGCCTTGCTGGCCCTGG + Intronic
1152300053 17:79490405-79490427 GGCTGGAGACTGCCTGACCCGGG + Intronic
1153061236 18:997228-997250 GTCAAAAGACTTCCTGGGCCGGG + Intergenic
1153943247 18:9995106-9995128 CTCAGATGACTTCCTGTCTCTGG - Intergenic
1154027930 18:10725342-10725364 GAGTGAAGACCTGCTGTCCCAGG + Intronic
1157190481 18:45577175-45577197 GTCTGAGGCCTTGCTGACCCTGG - Intronic
1157362760 18:47034431-47034453 GTCCGAAGGCTGCCTGTCCCTGG + Exonic
1159934316 18:74350212-74350234 TTCTGAAGACTCCCTGTACAAGG - Intronic
1159989957 18:74893368-74893390 GTTTGAACACTTTCTGTTCCTGG + Intronic
1160025107 18:75209780-75209802 GGCTGGTGGCTTCCTGTCCCCGG + Intergenic
1160035812 18:75300742-75300764 CTCTGAGGAGTACCTGTCCCAGG - Intergenic
1160220455 18:76973712-76973734 CTCTGACGGCTGCCTGTCCCTGG + Intergenic
1160577507 18:79864724-79864746 GCCAGAAGCCTTCCTGGCCCTGG - Intronic
1167855146 19:52231200-52231222 TTCTGAAGACTTCATGACTCAGG - Intergenic
1168166245 19:54549894-54549916 GTGTGCAGGCTTCCAGTCCCTGG + Intergenic
927149091 2:20185626-20185648 GCCCGAGGACTTCCTTTCCCAGG + Intergenic
928132449 2:28662513-28662535 GTGAGAATACTACCTGTCCCTGG + Intergenic
932621037 2:73265140-73265162 GTCACAAGAGTTCCTGCCCCAGG + Intronic
934104853 2:88686152-88686174 GTTGGGAGACTTCCTTTCCCTGG - Intergenic
935336522 2:102021932-102021954 GACTGAAGACCTCCTGTCAGCGG + Intronic
937030138 2:118732064-118732086 GTCTGAAGAACTCCTAGCCCAGG + Intergenic
937356514 2:121201316-121201338 GTCTGGAGGCTCCCTGTGCCGGG - Intergenic
937734309 2:125271205-125271227 GTCTGTCTACTTCCTGTCACAGG - Intergenic
939182031 2:138814887-138814909 GTCTGAAAACTTCAGGTGCCAGG + Intergenic
941998231 2:171621835-171621857 CTCTGATGTCTTCCTCTCCCAGG + Intergenic
943609726 2:190018194-190018216 GGCTGAAGACTTCCTATATCTGG - Intronic
944114990 2:196176313-196176335 GTCTGCAGTTTTCCTCTCCCAGG + Intronic
945322150 2:208436711-208436733 GTCTGGAGACATCCTGTTTCTGG + Intronic
948953191 2:241268440-241268462 GTCTGAAGACTTCCTGTCCCTGG - Intronic
1170290712 20:14765320-14765342 GGCTGAAAGCTCCCTGTCCCTGG + Intronic
1172501879 20:35433482-35433504 GCCTGGTGACTTCCTGTCCCTGG - Exonic
1175864166 20:62165800-62165822 GGCTGAATCCTTCCTGTCGCAGG - Intronic
1175942916 20:62546178-62546200 GGCTGAAGACCCCCTCTCCCTGG + Intergenic
1176389256 21:6155156-6155178 GCCAGAACACTTCCTGTCCAGGG - Intergenic
1178677410 21:34642873-34642895 GTCTGCACACTTCCTGCCCATGG + Intergenic
1178909704 21:36664753-36664775 GTCTGACAACTTGCTGTCCCTGG + Intergenic
1178915595 21:36704123-36704145 GTCTGAACTCTTCCAGTGCCTGG + Intronic
1179517271 21:41917218-41917240 GTCTGAAGACTTTGTTTCACTGG - Intronic
1179734215 21:43383091-43383113 GCCAGAACACTTCCTGTCCAGGG + Intergenic
1181485742 22:23230718-23230740 GCCTGAAGGCTTTCTCTCCCTGG - Intronic
1184209759 22:43028557-43028579 GTCTGAAAACTGCCTGCCCGGGG + Intergenic
1184742500 22:46437218-46437240 GTCTGAAGACCCCCTGCCCGGGG - Intronic
1185267598 22:49912422-49912444 GCCTGTGGACTTCCTTTCCCTGG + Intronic
949444568 3:4120099-4120121 GCCTGCAGACTTCCAGTCTCAGG + Intronic
950687518 3:14629081-14629103 GGCTGACAACTTCCTGCCCCTGG - Intergenic
951354644 3:21649564-21649586 GTCTGAAGAGTTGCTTTGCCAGG - Intronic
954524687 3:51259622-51259644 ATCTGAAGAAAACCTGTCCCAGG - Intronic
954532915 3:51336439-51336461 TTATGAAGCCTTCCTTTCCCAGG + Intronic
955177861 3:56635067-56635089 GTTTGAAAACTACCTGTACCTGG - Intronic
956688092 3:71850720-71850742 GTATAAGGACTTCCTTTCCCAGG + Intergenic
957301214 3:78393730-78393752 GTCTGAAAACTTATTCTCCCAGG - Intergenic
959567696 3:107849382-107849404 CTCTGGGGTCTTCCTGTCCCTGG - Intergenic
960684085 3:120279849-120279871 GACTGAAGACTGACTTTCCCGGG + Intronic
962471491 3:135712971-135712993 GAATGAACTCTTCCTGTCCCTGG + Intergenic
962493867 3:135920220-135920242 GACTTAAGACTTCGTGGCCCTGG - Intergenic
965308893 3:167103232-167103254 GGCTGAAGTCTTCCTCTCCCAGG + Intergenic
965510979 3:169567665-169567687 GTCTGTAGACTTCCAGCCCAGGG + Intronic
967117794 3:186357212-186357234 GTCTTAAGAGAACCTGTCCCTGG - Intronic
972831376 4:42817741-42817763 GTGTGACAACTTCATGTCCCAGG + Intergenic
973005170 4:44996412-44996434 GTTGGAAGACTGCCTTTCCCTGG - Intergenic
974340089 4:60603759-60603781 GGCTGAAGACTGCCTGTGACAGG - Intergenic
975054358 4:69910144-69910166 TTCTGGAGACTTCCATTCCCTGG - Intergenic
978979286 4:114922144-114922166 GTCAGGAGACTGCCTTTCCCTGG - Intronic
980425327 4:132620174-132620196 GTTTGAAGCCTTACTGTCACAGG - Intergenic
981315015 4:143333655-143333677 CTCTGAAACCTCCCTGTCCCGGG + Intergenic
984820155 4:183875107-183875129 GTCTGCAGACTTAGTGGCCCTGG + Intronic
989965056 5:50457965-50457987 GTCTGAAGCCTTCTTCTCTCAGG + Intergenic
992454907 5:76908035-76908057 GTGGGAAGACTACCTGACCCTGG + Intronic
994948798 5:106430360-106430382 GTCTGAAGCCTTCTTCTCTCAGG + Intergenic
996092859 5:119367688-119367710 TACTGAATACTTCCTGTCCAAGG - Intronic
997920036 5:137969625-137969647 GTCTGAAGCCTTCTTCTCTCAGG - Intronic
998449360 5:142222505-142222527 GGCGGAACACTTCCTATCCCAGG - Intergenic
999552313 5:152702781-152702803 TTCTGAAGGCTTCCTTTCCAAGG - Intergenic
1001430316 5:171655838-171655860 GTGTAAAGGCTTCCTGACCCAGG - Intergenic
1006372159 6:33651845-33651867 GCATGAGGACTCCCTGTCCCTGG - Intronic
1009703281 6:67211612-67211634 GTTTGAAGACTGACTTTCCCTGG + Intergenic
1012961477 6:105626713-105626735 GACTGAGGACTTCTTGTCACTGG - Intergenic
1014007914 6:116442579-116442601 GTCTGGAGAATTCCTGAACCAGG - Intergenic
1014403378 6:121018391-121018413 ATCTGAAAACTACCTGTCCTTGG + Intergenic
1016668155 6:146668695-146668717 TTCTGATGATTTCCTGTCTCTGG - Intronic
1016867308 6:148779985-148780007 GTCTGGAGACCTCCTGTATCTGG - Intronic
1017067569 6:150543408-150543430 GAGTGAAGAGTTGCTGTCCCAGG - Intergenic
1022466246 7:30654920-30654942 ATCTCAAGGCTTCCTCTCCCTGG + Intronic
1023816639 7:43955657-43955679 GTCTGCAGAATTCCTTTCCTAGG + Exonic
1024954181 7:54898883-54898905 GTCTGAGGTCATCCTGTCCTTGG + Intergenic
1026161504 7:67873297-67873319 CTCATAAGAATTCCTGTCCCCGG - Intergenic
1026366132 7:69650397-69650419 TTCTGTAGCCTTCCTATCCCAGG + Intronic
1028724107 7:94067880-94067902 GTCTGAAGACCTGCTGTGCCAGG - Intergenic
1037744028 8:21629190-21629212 GTCTCCAGGCTGCCTGTCCCAGG + Intergenic
1038636616 8:29292588-29292610 GTCTGAAACCTTGCTGACCCCGG - Intergenic
1039459576 8:37732245-37732267 TTCTGAAGACTTCTTCTCCCTGG + Intergenic
1040661146 8:49577288-49577310 ATCTGAGGACTTACTATCCCTGG - Intergenic
1041336228 8:56787566-56787588 GTCTGAAGTCTTTATGTCACCGG - Intergenic
1042577649 8:70238651-70238673 GTCTGTGGACTGTCTGTCCCTGG + Intronic
1043344822 8:79286914-79286936 ATCTGAAGACCTCCTGTGCAGGG + Intergenic
1043578351 8:81683478-81683500 ATCTGAACTCTTCCTGTCCCTGG - Intronic
1044362963 8:91310064-91310086 GTTGGGAGACTTCCTTTCCCTGG + Intronic
1044929817 8:97241231-97241253 GACTGAATACTTCCTGTCTTAGG + Intergenic
1044988769 8:97776797-97776819 GTCTGAAGACCAACTGTCCACGG - Intronic
1048814928 8:138323570-138323592 GTCTGAGTCCTTACTGTCCCTGG + Intronic
1048877334 8:138847136-138847158 GTCTGAAGACTCCCACTCCCTGG - Intronic
1052594515 9:30540472-30540494 GTCTGAAGCCTTCTTCTCTCAGG - Intergenic
1052801369 9:32971078-32971100 ATCTGAAGCCTTACTGCCCCTGG - Intergenic
1055829075 9:80359036-80359058 GACTTCAGACTCCCTGTCCCTGG - Intergenic
1060436258 9:123595591-123595613 GCCTGGAGACTTTCTGGCCCTGG - Intronic
1061001114 9:127903606-127903628 GATTGGAGGCTTCCTGTCCCTGG + Intronic
1061714003 9:132507390-132507412 GTCTGAAGGCTTTCTGCACCAGG - Intronic
1062463480 9:136671429-136671451 GTCTGAAAAGGTCCTGGCCCTGG + Intronic
1062702739 9:137916537-137916559 GGCTGGAGACCTCCTGGCCCAGG - Intronic
1186211663 X:7256464-7256486 GTCTGATTATTCCCTGTCCCTGG + Intronic
1187084774 X:16030595-16030617 GTCTTAAGAGATGCTGTCCCTGG - Intergenic
1188389702 X:29604712-29604734 GTCTGAAGAGTTTATGTCACTGG - Intronic
1189510929 X:41660381-41660403 GTCTGAACACTTCCAGTGACAGG - Intronic
1193490647 X:82144272-82144294 ATCTGAAGACTGACTGTGCCTGG + Intergenic
1193852043 X:86549642-86549664 TTCTGAAGACTTTTTGTACCTGG + Intronic
1194626352 X:96230415-96230437 GTTTTAAGACTTTCTGTCCCAGG - Intergenic
1197930463 X:131689795-131689817 GTCTCAAGACGTCCTGACCAAGG + Intergenic
1199546061 X:149008326-149008348 GTCTGAAGAATTTCTGCCCTTGG + Intergenic
1200274401 X:154718066-154718088 TACAAAAGACTTCCTGTCCCAGG - Intronic
1200803042 Y:7403790-7403812 GTCTCTAGACTTCCTCTTCCTGG + Intergenic
1201584804 Y:15548789-15548811 ATCTGAGTATTTCCTGTCCCTGG + Intergenic