ID: 948953195

View in Genome Browser
Species Human (GRCh38)
Location 2:241268476-241268498
Sequence CTGGCTACTGACCGTTTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953195_948953205 29 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953195_948953197 -7 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
948953195_948953206 30 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953195_948953203 24 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953195 Original CRISPR CTGGCTACTGACCGTTTTGC TGG (reversed) Exonic
901032142 1:6313375-6313397 CTGGCTTCTGAGGTTTTTGCTGG - Intronic
911530682 1:99039703-99039725 CTGGCTTCTGCCCGCTTTCCAGG - Intergenic
923555191 1:234994736-234994758 CTGGTTACAGACGGTTGTGCCGG - Intergenic
1070802500 10:79251823-79251845 ATGGCTTCTGTCCGTTTTCCAGG - Intronic
1071116903 10:82232555-82232577 CAGACTTCTGACCGTTTTTCTGG + Intronic
1080121275 11:28680663-28680685 GTGGCTTCAGACCGATTTGCAGG + Intergenic
1084386760 11:68847971-68847993 CTTGCTCCTGACCGCTGTGCTGG + Intergenic
1085082846 11:73648245-73648267 CTGGCTTCAAACCGTTATGCCGG - Intronic
1088992500 11:114966062-114966084 CTGGTTACTCACAGTTTGGCAGG + Intergenic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1094316707 12:29144243-29144265 CTCGTTACTGACCAGTTTGCTGG + Intergenic
1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG + Intergenic
1117531823 14:56667127-56667149 CTGGATACTGACCATGTTTCAGG - Intronic
1117850091 14:59958602-59958624 CTGGCTTCAGTCCGCTTTGCAGG + Intronic
1121704857 14:95983866-95983888 CTGGCTACTGGCCGTTCTTTTGG - Intergenic
1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG + Intronic
1149047143 17:52259897-52259919 CTAGATACTGACTGTTTTGTAGG + Intergenic
1151734101 17:75928060-75928082 CTGGCTACTGACCCACCTGCAGG + Exonic
1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG + Intergenic
1159690613 18:71482986-71483008 CTGGCTTCAGCCCGTTTTCCAGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG + Intronic
944483451 2:200180210-200180232 TTGGCCACTGAGCGTTCTGCAGG - Intergenic
946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1178533010 21:33390867-33390889 CTGCCTTCTGGCCGTTTTGCTGG + Intergenic
1183858927 22:40654997-40655019 CTTGCTGCTGACCATTTGGCAGG - Intergenic
953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG + Intronic
954283457 3:49601095-49601117 CTGGCCACTGACCATATCGCAGG - Intronic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
956384357 3:68701177-68701199 CTGGCTACTGACCATCCTCCAGG + Intergenic
958750266 3:98187014-98187036 TTTGTTACTGACCGTTTTGTTGG + Intronic
964473707 3:157080000-157080022 CCGGCTGCTGACCTTTCTGCTGG - Intergenic
972215902 4:36896518-36896540 CTTGTTACTGACAGTTTTGTTGG - Intergenic
975374023 4:73621431-73621453 CTGCCTGCTGAACTTTTTGCAGG - Intergenic
982148713 4:152427926-152427948 CTGGTTGCTGAACCTTTTGCAGG - Intronic
987248663 5:16076876-16076898 CTGGCCACTGGCCATTTCGCAGG - Intronic
991486490 5:67142610-67142632 CTGGACACTTACCGTTTTCCAGG + Intronic
998404922 5:141868879-141868901 CTGGCTTCAGACCGTGATGCTGG - Exonic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1014702001 6:124700624-124700646 CTGGCTAGTAACTGTTTTGGGGG - Intronic
1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG + Intronic
1018742705 6:166742831-166742853 CTGGCTTCTCAGTGTTTTGCAGG - Intronic
1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG + Intergenic
1048933482 8:139335990-139336012 CTTGCTACAGATCTTTTTGCAGG + Intergenic
1051219472 9:14832964-14832986 TTTGTTACTGACCGTTCTGCTGG - Intronic
1052249439 9:26380185-26380207 CTGGCTACAAACTGTTTTGCAGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056680831 9:88716516-88716538 CTCCCTACTGATCGTTTTGTGGG + Intergenic
1189649985 X:43178345-43178367 TTTGCTACTGACCAGTTTGCTGG - Intergenic
1192777049 X:74256010-74256032 TTTGCCACTGACCGCTTTGCTGG - Intergenic
1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG + Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic