ID: 948953197

View in Genome Browser
Species Human (GRCh38)
Location 2:241268492-241268514
Sequence TAGCCAGAAGGTCCGTCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953190_948953197 30 Left 948953190 2:241268439-241268461 CCCAGGGACAGGAAGTCTTCAGA 0: 1
1: 0
2: 2
3: 23
4: 190
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
948953195_948953197 -7 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
948953191_948953197 29 Left 948953191 2:241268440-241268462 CCAGGGACAGGAAGTCTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953197 Original CRISPR TAGCCAGAAGGTCCGTCCTG AGG Exonic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
904493458 1:30874124-30874146 GAGCCAGAAGGCAGGTCCTGGGG + Intronic
911845249 1:102744753-102744775 GAGCCAGCAGGTCAGTCCAGGGG + Intergenic
916507276 1:165439470-165439492 TAGCCAGCTGGTCCGAACTGGGG + Intronic
918041558 1:180916901-180916923 CACCCAGCAGGGCCGTCCTGGGG - Exonic
920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG + Intronic
923615180 1:235531405-235531427 TAGCCAGCAGGCCCATCATGGGG + Intergenic
1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG + Intronic
1089895006 11:121921311-121921333 TAGCCAGTAGGTGGGTGCTGGGG + Intergenic
1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG + Intergenic
1098738068 12:74132781-74132803 TAGCCATAAATTCCTTCCTGAGG + Intergenic
1103989079 12:124786270-124786292 TGGCCAGAGGGTCCGATCTGAGG + Intronic
1104735718 12:131135040-131135062 AAGGCAGAAGGTCCCTGCTGTGG + Intronic
1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG + Intergenic
1106543119 13:30707581-30707603 TCGTCAGAAGGTCGGTACTGTGG - Intergenic
1108284127 13:48889078-48889100 CAGCCAGAAGGTCAGTTCTGTGG + Intergenic
1109725304 13:66332709-66332731 TGCCCAGAATGTCCTTCCTGTGG - Intronic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1113594090 13:111519259-111519281 AAGCCAGAAGGTGAGTCCAGAGG - Intergenic
1117802639 14:59461082-59461104 AAGCCACAAGGTCCTTGCTGAGG + Exonic
1127294692 15:57598927-57598949 TATCCCGAGGGTCCTTCCTGAGG + Intronic
1128475487 15:67993625-67993647 TAATCTGAAGGTCAGTCCTGGGG + Intergenic
1132667036 16:1086089-1086111 TAGCCATAAGGTAGGTGCTGTGG - Intergenic
1132667108 16:1086546-1086568 TAGCCAGAAGGTAGCTGCTGTGG - Intergenic
1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG + Intronic
1148491244 17:48025206-48025228 TAGTCAGCAGGTCGGTCCGGCGG + Intergenic
1160322297 18:77906949-77906971 TAGCCAGAATGTCCGACCAGAGG - Intergenic
1162003944 19:7765298-7765320 TAGCCAAAAGGCCAGGCCTGGGG - Intronic
934501298 2:94862042-94862064 TGGCCAGAAGCTCTGGCCTGCGG - Intergenic
935494234 2:103758736-103758758 TAGCCTGAAGATCCATCCTCTGG + Intergenic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
946046539 2:216826161-216826183 TTCCCAGAAGGTTCCTCCTGCGG + Intergenic
947755822 2:232564270-232564292 TAGCCACATGGTACGTCCTGGGG + Exonic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1169166934 20:3432126-3432148 GAGTCAGTAGGTCTGTCCTGGGG - Intergenic
1170658122 20:18309613-18309635 TAGCCAGAGGCTCAGCCCTGTGG + Intronic
1170902302 20:20476812-20476834 TAGCCACAAGGTCCATCCAGAGG + Intronic
1171892505 20:30728840-30728862 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175746216 20:61459200-61459222 TCTCCAGAAGGTTGGTCCTGTGG + Intronic
957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG + Intergenic
960534932 3:118805075-118805097 TAGCAAGAAGGCCCATGCTGAGG + Intergenic
962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG + Intronic
962461939 3:135622123-135622145 TAGGCAGAATGTCTGTCCTTTGG - Intergenic
963140125 3:141940085-141940107 GAACCAGAAAGTCCTTCCTGTGG + Intergenic
972327291 4:38028714-38028736 GAGACAGAAGGTCCGGCCTCTGG + Intronic
990966240 5:61451031-61451053 TAGCCAGATGGTCAGTCTTCAGG - Intronic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
997359518 5:133285823-133285845 TAGCCTGCAGGCCCATCCTGAGG - Intronic
1003406193 6:5828977-5828999 ATGCCTGAAGGTCCGTCCTAAGG - Intergenic
1013337814 6:109182777-109182799 AAGGCAGAATGTCCGTCCTTTGG + Intergenic
1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1035524607 8:302588-302610 AAGCCAGAGGGGCAGTCCTGGGG - Intergenic
1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG + Intronic
1061713735 9:132505520-132505542 TAGACATAGGGTCAGTCCTGGGG + Intronic
1061964452 9:134005124-134005146 AAGCCAGCAGGTCCCTCCTGGGG - Intergenic
1203561869 Un_KI270744v1:64360-64382 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1190357385 X:49618403-49618425 TGCCCAGAAGGACCTTCCTGGGG + Intergenic
1194486942 X:94496642-94496664 TAGCTAGGAGGTCTGTCATGGGG + Intergenic
1195128600 X:101832631-101832653 TAGTCAGCATGTCTGTCCTGGGG - Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1200880306 Y:8205663-8205685 GAGCCAGAGGGTCAGTCCAGGGG + Intergenic
1201602716 Y:15748689-15748711 GAGCCAGCAGGTCAGTCCAGGGG - Intergenic
1202258848 Y:22948461-22948483 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202458946 Y:25087853-25087875 AAGCCAGATGGTCCTTTCTGGGG - Intergenic