ID: 948953198

View in Genome Browser
Species Human (GRCh38)
Location 2:241268495-241268517
Sequence CGGCCTCAGGACGGACCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 379}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953198_948953206 11 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953198_948953211 23 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953211 2:241268541-241268563 GCTGGTATGGGATGGGAAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 353
948953198_948953212 28 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953212 2:241268546-241268568 TATGGGATGGGAAGTGGGAGAGG 0: 1
1: 0
2: 8
3: 90
4: 822
948953198_948953210 22 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953210 2:241268540-241268562 TGCTGGTATGGGATGGGAAGTGG 0: 1
1: 0
2: 3
3: 49
4: 399
948953198_948953208 15 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953208 2:241268533-241268555 CAGCTTTTGCTGGTATGGGATGG 0: 1
1: 0
2: 13
3: 88
4: 682
948953198_948953205 10 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953198_948953203 5 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953198_948953209 16 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953209 2:241268534-241268556 AGCTTTTGCTGGTATGGGATGGG 0: 1
1: 0
2: 3
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953198 Original CRISPR CGGCCTCAGGACGGACCTTC TGG (reversed) Exonic
900106127 1:981869-981891 CGGCCTCAGGTCAGCCCCTCTGG + Intronic
900177109 1:1295766-1295788 CGGGCTCAAGCCGGACCTTGCGG + Exonic
900238730 1:1604745-1604767 CGGGCTCACGGCGGACCCTCAGG + Intergenic
900386840 1:2414502-2414524 CGCCCTCAGGAAGGACCCTCGGG - Intergenic
901712527 1:11126996-11127018 CTGCCTCAGGTAGGATCTTCAGG - Exonic
903322117 1:22549635-22549657 CAGGCTCAGGACAGACCTCCAGG - Intergenic
903998968 1:27327072-27327094 AGGCCACAGGATGGACATTCAGG - Intronic
904436352 1:30500248-30500270 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
904722264 1:32519166-32519188 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
905643817 1:39610363-39610385 CGGCCCCAGGACGGTGCTCCTGG - Intergenic
905804600 1:40866789-40866811 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
905829243 1:41051432-41051454 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
906203698 1:43975684-43975706 CAGCCTGAGGACGCCCCTTCAGG + Intronic
906920302 1:50056983-50057005 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
907087679 1:51691944-51691966 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
907117499 1:51982021-51982043 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
907624866 1:56020170-56020192 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
908925855 1:69254122-69254144 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
909314834 1:74202980-74203002 TGGCCTCAGGCAGGTCCTTCAGG - Intronic
909610297 1:77544738-77544760 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
909765182 1:79346959-79346981 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
910667135 1:89737993-89738015 CAGCCTCAGGAAGGTCCTTCGGG - Intronic
911211240 1:95140060-95140082 CAGCCTCAGGAAAGTCCTTCAGG - Intronic
912550004 1:110479388-110479410 GGGCCTCAGGAGGGAACCTCAGG - Intergenic
913043374 1:115052102-115052124 CTGCCTCAGGACTGTCCTTTGGG + Intronic
914778030 1:150756297-150756319 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
916406646 1:164504352-164504374 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
917260536 1:173162529-173162551 CAGCCTCAGGCAGGGCCTTCAGG - Intergenic
917297623 1:173538291-173538313 AGGCCTCAGGACTGAACTTCTGG - Intronic
917487959 1:175472313-175472335 CAGCCTCAGGCCGGTCCTTCAGG - Intronic
917547866 1:175991908-175991930 CAGCCTCAGGCAGGCCCTTCAGG - Intronic
918031465 1:180816887-180816909 CAGCCTCAGGCAGGTCCTTCGGG + Intronic
918278418 1:182978136-182978158 CAGCCTCAGGCTGGTCCTTCAGG - Intergenic
918767370 1:188503979-188504001 CAGCCTCAAGCAGGACCTTCAGG + Intergenic
920388146 1:205582236-205582258 CGGGCTTAAGCCGGACCTTCCGG - Intronic
920680236 1:208066686-208066708 CAGCCTCAGGGAGGACCTTCAGG + Intronic
921141547 1:212311622-212311644 CAGCCTCAGGCAGGCCCTTCAGG + Intronic
921563840 1:216692143-216692165 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
922122724 1:222688881-222688903 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
923128178 1:231050652-231050674 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
923192338 1:231631411-231631433 CCGCCTCAGGCAGGTCCTTCAGG + Intronic
924166830 1:241292168-241292190 CAGCGTCAGGAAGGTCCTTCAGG - Intronic
924188261 1:241519412-241519434 CGGCCTCGGGACGCCTCTTCCGG - Intronic
1065631105 10:27681951-27681973 CAGCCTCAGGCAGGCCCTTCAGG + Intronic
1066511096 10:36097210-36097232 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1066757797 10:38728402-38728424 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1067250820 10:44585657-44585679 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1067826214 10:49575247-49575269 TGGCCTCAGGCAGGGCCTTCTGG - Intergenic
1068912472 10:62393196-62393218 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1071356649 10:84803254-84803276 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1072325155 10:94290634-94290656 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1074342764 10:112650425-112650447 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1075296589 10:121281976-121281998 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1075422998 10:122317854-122317876 CAGCCTCAAGCAGGACCTTCAGG - Intronic
1076075928 10:127533782-127533804 AGGCCTGAGGACTGACCTGCGGG + Intergenic
1076158065 10:128218795-128218817 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1076787173 10:132756748-132756770 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1076885244 10:133259135-133259157 GGGTCTCAGGAAGGAACTTCAGG - Intergenic
1077459113 11:2699957-2699979 TCGCCTCAGCACGGACCTCCAGG - Intronic
1078125015 11:8552782-8552804 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1080282450 11:30573470-30573492 CTGCCTCAGGCAGGTCCTTCAGG + Intronic
1080480566 11:32645235-32645257 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1081508784 11:43746565-43746587 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1083605210 11:63974676-63974698 CGGCGTCAGGACGGACATGATGG - Exonic
1087345643 11:96967544-96967566 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1087432439 11:98070628-98070650 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1087819704 11:102698023-102698045 CAGCCTCAGGCAGGCCCTTCAGG - Intronic
1087884077 11:103457322-103457344 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1089995382 11:122902082-122902104 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1090093344 11:123719450-123719472 CAGCCTCAGGAAGATCCTTCAGG - Intergenic
1090361239 11:126174221-126174243 CAGCCTCAGGCAGGGCCTTCAGG - Intergenic
1090516723 11:127436473-127436495 CAGCCTCAGGCGGGGCCTTCAGG - Intergenic
1090731013 11:129573508-129573530 CTGTCTCAGGACGGACCTCTGGG + Intergenic
1091097020 11:132833461-132833483 CAGCCTCAGGCAGGGCCTTCAGG - Intronic
1091361244 11:134979975-134979997 TGGCCTCAGGCAGGTCCTTCAGG - Intergenic
1091567833 12:1661694-1661716 CCGCCTCAGCACGGCCCTCCCGG + Intergenic
1091695076 12:2622889-2622911 GGGCCTCAGGACAGATCTTCAGG + Intronic
1091745036 12:2986276-2986298 CAGCCTCAGGCAGGCCCTTCGGG - Intronic
1091780043 12:3208009-3208031 AGGCCTCAGCACGGCCCTACAGG - Intronic
1091857799 12:3753211-3753233 CGGCCTCAGGTCGCGCCTGCAGG - Intronic
1091953972 12:4620927-4620949 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1092865504 12:12757246-12757268 CTGCCTCAGAACTGAGCTTCAGG - Intronic
1093566586 12:20613493-20613515 CGGCCTCATTACCGACCTCCTGG + Exonic
1094030064 12:26001750-26001772 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1094446616 12:30537900-30537922 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1095863419 12:46945297-46945319 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1097003249 12:55896339-55896361 CAGCCTCAGGAAGATCCTTCAGG - Intergenic
1097630870 12:62060608-62060630 CAGCCTCAGGGAGGTCCTTCAGG + Intronic
1097649427 12:62278277-62278299 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1098515368 12:71369605-71369627 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1098745117 12:74227023-74227045 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
1099541920 12:83921584-83921606 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1100967185 12:100025845-100025867 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1101164704 12:102016564-102016586 CAGCCTCAGGGAGGTCCTTCAGG + Intronic
1101672996 12:106894165-106894187 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1103989080 12:124786273-124786295 GGGCCTCAGATCGGACCCTCTGG - Intronic
1104611099 12:130228451-130228473 CTTCCTCAGGAAAGACCTTCAGG - Intergenic
1105545430 13:21347513-21347535 CATCCTTAGGACGGACCTTCAGG - Intergenic
1105760306 13:23508005-23508027 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1105778737 13:23687727-23687749 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1105795920 13:23852744-23852766 CAGCCTCAGGCCGGTCCTTCAGG + Intronic
1105832928 13:24181726-24181748 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1106059408 13:26272506-26272528 CTGCCTCAGGCAGGTCCTTCAGG - Intronic
1108384846 13:49889785-49889807 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1108904866 13:55456034-55456056 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1109431546 13:62242365-62242387 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1111269075 13:85856190-85856212 CGGCCACAGGCAGGTCCTTCAGG - Intergenic
1113030542 13:105989446-105989468 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1113594089 13:111519256-111519278 CAGCCTCTGGACTCACCTTCTGG + Intergenic
1114382143 14:22218200-22218222 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1114856856 14:26457735-26457757 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1115157099 14:30353389-30353411 AGGCCTCAGGCCTGACCTTCAGG - Intergenic
1116824494 14:49658917-49658939 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1117235202 14:53767060-53767082 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1117558889 14:56915407-56915429 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1117802640 14:59461085-59461107 CAGCCTCAGCAAGGACCTTGTGG - Exonic
1117863323 14:60116723-60116745 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1117873806 14:60228955-60228977 CGGCCTCAGGCAGGTCCTTCAGG - Intergenic
1118698264 14:68407037-68407059 CAGCCTCAGGAAGATCCTTCAGG - Intronic
1119890792 14:78180702-78180724 AGGTCTCAGGATGGACCCTCTGG + Intergenic
1120634233 14:86931510-86931532 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1121971424 14:98359966-98359988 CTGCCTAAGTAAGGACCTTCTGG + Intergenic
1122080714 14:99265396-99265418 TGGCTTAAGGATGGACCTTCTGG - Intronic
1122147541 14:99700808-99700830 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1122559910 14:102605740-102605762 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1124449178 15:29769935-29769957 CAGCCTCAGGTAGGTCCTTCAGG + Intronic
1124665909 15:31592545-31592567 TGGCCTCAGGCAGGTCCTTCAGG - Intronic
1125147080 15:36483735-36483757 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1126329688 15:47518861-47518883 CAGCCTCAGGGAGGTCCTTCAGG - Intronic
1126624417 15:50672388-50672410 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1127191440 15:56535151-56535173 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1127690946 15:61396961-61396983 CGTCCTCAGGCAGGTCCTTCAGG + Intergenic
1128297363 15:66535235-66535257 GAGCCTCAGGCAGGACCTTCAGG - Intronic
1128493183 15:68171304-68171326 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1129490617 15:75921956-75921978 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1130156238 15:81352623-81352645 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1136018157 16:27419396-27419418 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1136720020 16:32312428-32312450 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1136725073 16:32350822-32350844 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1136838397 16:33518707-33518729 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1136843400 16:33556875-33556897 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1138356870 16:56388886-56388908 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1140489546 16:75323400-75323422 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1141257861 16:82419837-82419859 CAGCCTCAGGCAGGATCTTCAGG + Intergenic
1203001357 16_KI270728v1_random:166932-166954 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1203006411 16_KI270728v1_random:205341-205363 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
1203132960 16_KI270728v1_random:1703336-1703358 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1203148561 16_KI270728v1_random:1818992-1819014 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1203153565 16_KI270728v1_random:1857173-1857195 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1142470714 17:161847-161869 AGGCCCCAGGAAGCACCTTCAGG + Intronic
1143517458 17:7426978-7427000 GGGCCTCAGGCCGGGCGTTCCGG - Exonic
1143639951 17:8190095-8190117 CGGGCCCGAGACGGACCTTCTGG - Exonic
1146078048 17:29751069-29751091 CTGCCTCAGGCAGGTCCTTCAGG - Intronic
1146643526 17:34559900-34559922 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1147683129 17:42267310-42267332 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1148920519 17:51027856-51027878 CAGCCTCAGGTAGGTCCTTCAGG + Intronic
1148929935 17:51120234-51120256 CGGCCTCAGGCCCGCCCTCCAGG + Intronic
1149261589 17:54885928-54885950 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1151691981 17:75692179-75692201 CAGCATCAGGAGGGACTTTCTGG + Intronic
1153238750 18:3012828-3012850 CCGCCGCAGGACGGACCGGCGGG - Intronic
1153692853 18:7610868-7610890 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1153728546 18:7982485-7982507 CAGCCTCAGGCAGGACCTTCAGG - Intronic
1153955691 18:10093913-10093935 CAGCCTCAGGCGGGTCCTTCAGG + Intergenic
1155040346 18:22060096-22060118 CGGCCTCAGAATGTATCTTCTGG - Intergenic
1156249752 18:35341523-35341545 TGGCCTCAGGCAGGTCCTTCAGG + Intronic
1156454817 18:37287001-37287023 CGCCCTCAGGACAGCCCTTCAGG + Intronic
1158111606 18:53946077-53946099 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1158256011 18:55549695-55549717 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1160368049 18:78346165-78346187 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1160368153 18:78347185-78347207 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1162231733 19:9272202-9272224 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1162733253 19:12731510-12731532 CGGCGTCAGGACGGGCCACCAGG - Intronic
1163035647 19:14567416-14567438 CAGCCTCAGAACTGACCATCCGG + Intronic
1165699167 19:37924383-37924405 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1168399177 19:56074157-56074179 CAGCCTCAGGCAGGTCCTTCTGG - Intergenic
1168419551 19:56192407-56192429 CTGCCTCAGGATGGGACTTCTGG + Intronic
925064916 2:922275-922297 CGGCCTCCGGAAGGTGCTTCCGG + Intergenic
929262010 2:39876297-39876319 CAGCCTCAGGACCTACATTCAGG - Intergenic
930033859 2:47073740-47073762 CGGCATCACGAAGCACCTTCTGG - Exonic
930525018 2:52517829-52517851 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
930892809 2:56410827-56410849 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
932585722 2:73027092-73027114 CAGCCTCAGGCAGGCCCTTCAGG + Intronic
934220101 2:90074636-90074658 CAGCCTCAGGAGGCACCTTGTGG + Intergenic
934321107 2:91972843-91972865 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
935221412 2:101017237-101017259 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
935716250 2:105941667-105941689 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
936047415 2:109198165-109198187 TGGCCACAGCAGGGACCTTCTGG + Intronic
936579548 2:113685899-113685921 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
937682704 2:124661538-124661560 CAGCCTCAGGCAGGCCCTTCGGG - Intronic
937725586 2:125161386-125161408 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
938123374 2:128650417-128650439 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
939037665 2:137151576-137151598 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
939330227 2:140749697-140749719 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
939694592 2:145308880-145308902 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
940038596 2:149335163-149335185 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
940066077 2:149631399-149631421 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
940283637 2:152012127-152012149 CAGCCTCAGGCAGGTCCTTCTGG + Intronic
940354690 2:152727049-152727071 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
942264833 2:174212888-174212910 CAGCCTCAGGCAGGTCCTTCCGG - Intronic
942493508 2:176513785-176513807 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
942913343 2:181272670-181272692 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
946816398 2:223582893-223582915 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
947038121 2:225883309-225883331 CAGCCTCAGGCAGGTCCTTCTGG + Intergenic
947159269 2:227195720-227195742 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
948476873 2:238226204-238226226 AGGCCTCGGGAGGGACCTTGAGG + Intronic
948735339 2:240000207-240000229 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
948821562 2:240551900-240551922 CTTCCTCAGGAAAGACCTTCAGG + Intronic
948925029 2:241090386-241090408 TGGCCTCAGGCAGGTCCTTCAGG - Intronic
948941883 2:241200905-241200927 CGGCCCCATGACGGAGCTTCAGG + Intronic
948953198 2:241268495-241268517 CGGCCTCAGGACGGACCTTCTGG - Exonic
1169057873 20:2638517-2638539 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1170253287 20:14310653-14310675 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1170381803 20:15769013-15769035 CAGCCTCAGGAAGGTCCTTCAGG - Intronic
1170515464 20:17125199-17125221 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1175843077 20:62042807-62042829 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1178000054 21:28151174-28151196 CAGCCTCAGGCAGGAACTTCAGG + Intergenic
1178425981 21:32478710-32478732 CGGCCTCAGGCCCAGCCTTCGGG - Intronic
1179252203 21:39680639-39680661 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1179580701 21:42342050-42342072 CAGCCTCAGGCGGGCCCTTCAGG - Intergenic
1179888811 21:44325746-44325768 CGGCCTCGGGAGGCAGCTTCTGG + Intronic
1180309349 22:11156815-11156837 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1180547826 22:16518626-16518648 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1180909043 22:19435803-19435825 TGGCCTCAGCATGGAGCTTCGGG - Exonic
1182211631 22:28681743-28681765 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1182869234 22:33631645-33631667 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1182975053 22:34616056-34616078 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
1183561510 22:38577967-38577989 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1183691037 22:39388601-39388623 CGGCCTCAGGGTCGGCCTTCAGG - Intergenic
1184452210 22:44590080-44590102 AGACCTCAGGCCAGACCTTCTGG + Intergenic
1185003819 22:48263448-48263470 GGGCCGCAGGATGGGCCTTCAGG + Intergenic
951561699 3:23974053-23974075 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
953517557 3:43610317-43610339 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
953802349 3:46034823-46034845 CTTCCTCAGGAAAGACCTTCAGG + Intergenic
953819785 3:46196696-46196718 CAGCCTCAGGCAGGTCCTTCGGG + Intronic
954975834 3:54693582-54693604 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
955578297 3:60390521-60390543 CGGCCTCAGGCAAGTCCTTCAGG + Intronic
956139635 3:66132426-66132448 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
956247068 3:67195831-67195853 CAGCCTCAGGCAGGCCCTTCAGG + Intergenic
956896064 3:73661175-73661197 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
957268401 3:77997572-77997594 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
958168051 3:89902551-89902573 CAGCCTCAGGCCAGTCCTTCTGG - Intergenic
959060182 3:101609487-101609509 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
959396910 3:105852142-105852164 GGGCCTCAGGCAGGCCCTTCAGG + Intronic
959652588 3:108765729-108765751 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
960091164 3:113639946-113639968 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
960138279 3:114127488-114127510 CTGCCTCAGGCAGGTCCTTCAGG - Intergenic
960357053 3:116666388-116666410 CAGCCTCAGGCAGGTCCTTCGGG - Intronic
960458802 3:117907327-117907349 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
961204557 3:125071277-125071299 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
961306035 3:125959515-125959537 CTGGCTCAGCAGGGACCTTCGGG - Intergenic
961398274 3:126613907-126613929 CTGCCTCAGGCAGGTCCTTCAGG + Intronic
961616991 3:128190201-128190223 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
962208407 3:133455084-133455106 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
962256653 3:133875001-133875023 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
962495069 3:135931335-135931357 CAGCCTCAGGAAGGTCCGTCAGG + Intergenic
962614562 3:137111979-137112001 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
964201951 3:154127563-154127585 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
966499063 3:180617415-180617437 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
968255723 3:197269046-197269068 CGGCCTCAGGCAGGCCCTTCAGG - Intronic
969284039 4:6191324-6191346 GGGCCTCAGGAGGGACATGCAGG - Intronic
969669246 4:8580678-8580700 CAGCCTCAGGACAGTCCTGCCGG + Exonic
970797626 4:19932725-19932747 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
970845910 4:20537058-20537080 CAGCCTCAGGCAGGTCCTTCCGG - Intronic
971383683 4:26123892-26123914 CAGCCTCAGGAAGGTACTTCTGG - Intergenic
971390731 4:26182981-26183003 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
971858727 4:32077565-32077587 CAGCCTCAGGCCGGTCCTTCAGG - Intergenic
972272674 4:37526887-37526909 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
973561970 4:52146012-52146034 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
973952450 4:56030226-56030248 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
976002894 4:80392923-80392945 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
976459891 4:85298005-85298027 CAGCCTCAGGCAGGCCCTTCAGG - Intergenic
976896155 4:90114754-90114776 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
977658378 4:99551696-99551718 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
977676359 4:99752276-99752298 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
978640079 4:110860164-110860186 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
979194727 4:117906917-117906939 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
979794283 4:124827040-124827062 CAGCCTCAGGAAGCTCCTTCAGG + Intergenic
980433190 4:132730795-132730817 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
980515570 4:133854172-133854194 CAGCCTCAGGCGGGTCCTTCTGG + Intergenic
981811324 4:148778964-148778986 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
982154568 4:152505713-152505735 CAGCCTCAAGAAGGCCCTTCAGG - Intronic
983014014 4:162586943-162586965 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
983591733 4:169420282-169420304 CGGCCTCAGGCAGGTCCTTCAGG - Intronic
985235953 4:187874491-187874513 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
987857188 5:23435733-23435755 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
987987546 5:25167667-25167689 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
988102787 5:26704319-26704341 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
989135129 5:38146393-38146415 CAGCCTCAGGAAGGTCCTTTAGG + Intergenic
989175285 5:38518757-38518779 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
990102790 5:52213810-52213832 CAGCCTCAGGCAGGAACTTCAGG + Intergenic
991984854 5:72274533-72274555 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
992501026 5:77344074-77344096 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
993502666 5:88680399-88680421 CGGCCTAAGGAAGTACCTTCGGG - Intergenic
994144387 5:96376810-96376832 CAGCCTCAGGTAGGTCCTTCAGG + Intergenic
995900240 5:117057184-117057206 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
998212756 5:140213071-140213093 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
998791501 5:145770529-145770551 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
999215220 5:149928031-149928053 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1000709292 5:164550738-164550760 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1001225291 5:169939405-169939427 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1002868257 6:1143196-1143218 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1003103250 6:3193630-3193652 CGGCCTCAGCACTGAGCTCCCGG - Intergenic
1003406192 6:5828974-5828996 CAACCTTAGGACGGACCTTCAGG + Intergenic
1004587697 6:17018121-17018143 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1004891296 6:20103122-20103144 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1006754675 6:36404985-36405007 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1007020050 6:38510894-38510916 CGACCTCAGGCAGGTCCTTCAGG - Intronic
1007682647 6:43645152-43645174 GGGCCTCAGCCCGGACCGTCGGG + Exonic
1008001881 6:46369263-46369285 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1011763198 6:90590680-90590702 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1011847245 6:91581463-91581485 CGGCCTCAGGCAGGTCTTTCAGG - Intergenic
1011958767 6:93059340-93059362 CAGCCTCAGGCGGGTCCTTCAGG - Intergenic
1012533976 6:100273344-100273366 CAGCCTCAGGCTGGTCCTTCAGG + Intergenic
1013304632 6:108837207-108837229 CGGCCCCAGGACTGATGTTCCGG - Intergenic
1013411018 6:109883365-109883387 CAGCCTCAGGCAGGACCTTCAGG - Intergenic
1014052919 6:116976743-116976765 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1014142312 6:117957937-117957959 CGGCCTCAGGCAGGTCCTTCAGG + Intronic
1014722228 6:124931176-124931198 CAGCCTCAGGAGGGTTCTTCAGG - Intergenic
1015043714 6:128753600-128753622 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1015721165 6:136243745-136243767 CAGCCTCAGGAAGGTCCTTCAGG + Intronic
1015914078 6:138197336-138197358 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1016716762 6:147241984-147242006 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1016891863 6:149015054-149015076 AGGCCTCAGGAAGGACTCTCTGG + Intronic
1017669265 6:156754677-156754699 CAGCCTCAGGCAGGCCCTTCAGG + Intergenic
1018041600 6:159928872-159928894 CAGCCTCAGGCAGGCCCTTCAGG + Intergenic
1019583278 7:1780213-1780235 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1020388693 7:7635096-7635118 CAGCCTCAGGAGAGTCCTTCAGG - Intergenic
1020832223 7:13106989-13107011 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1021696538 7:23281776-23281798 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1022628380 7:32061612-32061634 AGCCCTCATCACGGACCTTCTGG - Intronic
1023223629 7:37946596-37946618 CTGCCTCAGGCAGGTCCTTCAGG + Intronic
1023308682 7:38858902-38858924 CAGCCTCAGGCAGGTCCTTCTGG + Intronic
1027344512 7:77243703-77243725 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1030276746 7:107729222-107729244 CAGCCTCAGGCGGGTCCTTCAGG - Intergenic
1030276899 7:107731126-107731148 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1030707644 7:112711177-112711199 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1032099333 7:128960360-128960382 CAGCCTCAGGCAGGTCCTTCGGG + Intronic
1032578758 7:133083507-133083529 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1032627158 7:133604207-133604229 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1032857919 7:135851621-135851643 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1033480617 7:141736744-141736766 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1034092093 7:148373109-148373131 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1034609316 7:152351129-152351151 CAGCCTCAGGCAGAACCTTCAGG - Intronic
1035398450 7:158550029-158550051 CGGCGTCAGGAAGGACCTCATGG + Intronic
1035917059 8:3636277-3636299 CAGCCTCAGGCAGGGCCTTCAGG - Intronic
1036021235 8:4848966-4848988 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1036444973 8:8813373-8813395 CAGCCTCAGGCAGGCCCTTCGGG + Intronic
1037458988 8:19090239-19090261 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1038371913 8:27002686-27002708 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1038710147 8:29936258-29936280 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1038834415 8:31103196-31103218 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1038922899 8:32104872-32104894 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1039116631 8:34098565-34098587 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1039305917 8:36262712-36262734 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1040392106 8:46959022-46959044 CAGCCTCAGGTAGGTCCTTCAGG - Intergenic
1040764121 8:50886101-50886123 CAGCCTCAGGAAGGTCCTTCAGG - Intergenic
1040902857 8:52434886-52434908 CTGCCTCAGGCAGGTCCTTCAGG + Intronic
1041141800 8:54828115-54828137 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1041785689 8:61630834-61630856 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1041798937 8:61776950-61776972 CTGCCTCAGGACTGACCTACAGG - Intergenic
1041835775 8:62213314-62213336 CGGCCTCAGGCAGGTCTTTCAGG - Intergenic
1041861801 8:62522489-62522511 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1041994215 8:64033791-64033813 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1042543359 8:69929012-69929034 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1043278652 8:78435120-78435142 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1044098897 8:88104718-88104740 CAGCCTCAGAAAGGTCCTTCGGG + Intronic
1044538046 8:93380252-93380274 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1044733898 8:95257877-95257899 CAGCCTCAGGCAGGTCCTTCGGG + Intronic
1044821306 8:96157842-96157864 TGACCTCAGGCTGGACCTTCCGG - Intronic
1045196547 8:99937236-99937258 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1047384957 8:124400493-124400515 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1048346506 8:133579645-133579667 CAGCCTCAGGCAGGACCTTCAGG - Intergenic
1048751687 8:137684241-137684263 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1049259324 8:141630312-141630334 CGGCCTCAGGCCAGCCCTTCAGG + Intergenic
1049394295 8:142391991-142392013 CAGCCTCAGGCAGGGCCTTCAGG - Intronic
1050525944 9:6546598-6546620 CAGCTTCAGGGCGGTCCTTCAGG - Intronic
1051046221 9:12877475-12877497 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1051263899 9:15292556-15292578 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1052514821 9:29466612-29466634 CAGCCTCAGGCTGGTCCTTCAGG - Intergenic
1052744655 9:32428456-32428478 CAGCCTCAGGAAGGTTCTTCAGG - Intronic
1052953670 9:34234892-34234914 CAGCCTCAGGTAGGTCCTTCAGG + Intronic
1053049480 9:34947582-34947604 CAGCCTCAGCAAGGTCCTTCAGG + Intergenic
1054978498 9:71176176-71176198 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1056432029 9:86537382-86537404 CAGCCTCAGGCAGGCCCTTCAGG + Intergenic
1056645127 9:88405073-88405095 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1057547919 9:96031864-96031886 CGGACTCAGGACGGCCACTCAGG - Intergenic
1058662371 9:107278341-107278363 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1059951508 9:119467523-119467545 TGGCCTCAGGCAGGTCCTTCAGG + Intergenic
1060011565 9:120047800-120047822 CAGCCTCAGGCAGGTCCTTCAGG - Intergenic
1060924033 9:127443069-127443091 CAGCCTCAGGCGGGTCCTTCAGG - Intronic
1187192565 X:17049268-17049290 CAGCCTCAGGCAGGAACTTCAGG + Intronic
1187773117 X:22724384-22724406 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1189132301 X:38512640-38512662 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1189428537 X:40926212-40926234 CGTCCTCAGGCAGGTCCTTCAGG + Intergenic
1190096189 X:47482914-47482936 CGGCCTCAGGCCGTCCCTACCGG + Exonic
1192344896 X:70294319-70294341 CAGCCTCAGGCAGGTCCTTCAGG - Intronic
1192569759 X:72193343-72193365 CAGCCTCAGGCAGGTCCTTCAGG + Intronic
1193656695 X:84206865-84206887 CCACCTCAGCCCGGACCTTCTGG + Intergenic
1194180816 X:90709970-90709992 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1194586992 X:95747507-95747529 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1194820969 X:98506580-98506602 CAGCCTCAGGCAGGGCCTTCGGG + Intergenic
1194918696 X:99736303-99736325 CAGCTTCAGGCAGGACCTTCAGG + Intergenic
1195424299 X:104710993-104711015 CAGCCTCAGGTGGGTCCTTCAGG + Intronic
1199270375 X:145875415-145875437 CAGCCACAGGCCGGTCCTTCAGG + Intergenic
1200527478 Y:4292126-4292148 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic
1201188594 Y:11427965-11427987 CAGCCTCAGGCAGGTCCTTCAGG + Intergenic