ID: 948953199

View in Genome Browser
Species Human (GRCh38)
Location 2:241268504-241268526
Sequence TGACAGAGGCGGCCTCAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953199_948953213 28 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953213 2:241268555-241268577 GGAAGTGGGAGAGGAGAGAGAGG 0: 2
1: 5
2: 41
3: 558
4: 3195
948953199_948953206 2 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953199_948953210 13 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953210 2:241268540-241268562 TGCTGGTATGGGATGGGAAGTGG 0: 1
1: 0
2: 3
3: 49
4: 399
948953199_948953205 1 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953199_948953211 14 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953211 2:241268541-241268563 GCTGGTATGGGATGGGAAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 353
948953199_948953208 6 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953208 2:241268533-241268555 CAGCTTTTGCTGGTATGGGATGG 0: 1
1: 0
2: 13
3: 88
4: 682
948953199_948953209 7 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953209 2:241268534-241268556 AGCTTTTGCTGGTATGGGATGGG 0: 1
1: 0
2: 3
3: 9
4: 184
948953199_948953203 -4 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953199_948953212 19 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953212 2:241268546-241268568 TATGGGATGGGAAGTGGGAGAGG 0: 1
1: 0
2: 8
3: 90
4: 822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953199 Original CRISPR TGACAGAGGCGGCCTCAGGA CGG (reversed) Exonic
900142998 1:1146295-1146317 GGCCAGAGGTGGCCACAGGAAGG - Intergenic
900169126 1:1257719-1257741 TGAGAGGGGCGGCCTCAGCTGGG - Intronic
900648010 1:3717763-3717785 TGACACAGGTGGCCACAGGAGGG - Intronic
901773227 1:11541642-11541664 TGACAGAGGCAGGGTGAGGAAGG - Intergenic
901871367 1:12140867-12140889 TGAGAGAGGAGACCCCAGGAGGG - Intronic
901872282 1:12145116-12145138 AGTCAGAGGAGGCCTCAGGCTGG - Intergenic
902800014 1:18823541-18823563 ACGCAGAGGGGGCCTCAGGAAGG + Intergenic
902901047 1:19516394-19516416 TGGCTGGGGAGGCCTCAGGAAGG + Intergenic
903753119 1:25642177-25642199 TAGCAGAGGCAGCCACAGGAGGG - Intronic
904305457 1:29585884-29585906 TGGCAGAGCCAGCCCCAGGATGG + Intergenic
905240422 1:36577401-36577423 TGACAGAGGAGGCCTGAGTGCGG + Intergenic
907249508 1:53128807-53128829 TGACAGAGGTGGCCACGGGCTGG + Intronic
907335960 1:53699842-53699864 TGAGGGTGGGGGCCTCAGGATGG - Intronic
920501058 1:206485752-206485774 TGACAGAGGTGGCTTCAGGTCGG + Intronic
920776525 1:208943463-208943485 AGACAGAGAAGGCCTCAGCATGG + Intergenic
920886847 1:209938043-209938065 TGCCAGCGGCGGCCCCGGGAAGG + Intergenic
922504425 1:226118428-226118450 AGACAGAGGCCGCCTGAGGCAGG - Intergenic
924643790 1:245858180-245858202 TGACAAAGACGGGCTCAGGGTGG - Intronic
1065115199 10:22477382-22477404 AAACAGAAGCGGCCCCAGGAGGG + Intergenic
1065891744 10:30127120-30127142 TGAGAAAGGAGGACTCAGGAAGG + Intergenic
1068810089 10:61245484-61245506 TGACAGAGACTGTCTCAGGTTGG + Intergenic
1070785851 10:79161935-79161957 TGACAGAGGGGGACTCTGAAGGG - Intronic
1074855066 10:117467327-117467349 GGACACAGGCAGCCTCTGGAAGG - Intergenic
1075044801 10:119138486-119138508 TTACAGAGGCAGCTCCAGGAAGG - Intergenic
1076741629 10:132488550-132488572 TCACACAGGAGACCTCAGGAGGG + Intergenic
1077718376 11:4603356-4603378 TGCCGGAGGTGGCCTCATGAGGG - Intronic
1078063181 11:8061382-8061404 TGAGAGAGCTGGCCTCAGGATGG + Intronic
1079052368 11:17173413-17173435 TGACAAAGACGGCCACAGCAGGG - Intronic
1082997042 11:59262946-59262968 TGACAGGGGCAGGCTCAGGAGGG + Intergenic
1083233307 11:61336808-61336830 GGCCACAGGCAGCCTCAGGAGGG - Intronic
1084321768 11:68377245-68377267 AGTCAGTGCCGGCCTCAGGAAGG - Intronic
1084556530 11:69879319-69879341 TGGCAGTGGCGGCCCCAGGGCGG + Intergenic
1084728768 11:71059884-71059906 GTACAGAGGCGGCCTCAGTGGGG - Intronic
1085346759 11:75773203-75773225 GGACAGAGGAGGCCCAAGGAAGG - Intronic
1085519439 11:77129510-77129532 ACCCAGAGACGGCCTCAGGAAGG - Intronic
1085622207 11:78045989-78046011 AGTTAGAGGCAGCCTCAGGAGGG + Intronic
1087992066 11:104757636-104757658 TTACTGAGGGGGCTTCAGGATGG + Intergenic
1089979083 11:122757633-122757655 TGAGGGAGGAGGGCTCAGGAGGG + Intronic
1091211665 11:133865648-133865670 TGACAGGCGCGGCGGCAGGACGG + Intergenic
1091988919 12:4938529-4938551 TGTCAAAGGAGGCCTGAGGAAGG - Intergenic
1092569727 12:9709023-9709045 GGACTGAGTTGGCCTCAGGAAGG + Intergenic
1095600724 12:44010185-44010207 TGTCAGAGGTGGCCCCAGGTGGG - Intronic
1096320952 12:50612306-50612328 TCACAGAAGGGCCCTCAGGAGGG - Intronic
1096799791 12:54102540-54102562 TGACAGAGGAGGACCAAGGATGG - Intergenic
1097475324 12:60047990-60048012 TGGCTGGGGAGGCCTCAGGAAGG - Intergenic
1099600003 12:84722627-84722649 TGACACAGGAGGCTTCAGAAAGG - Intergenic
1100930994 12:99609385-99609407 TGAGAGAGACGTCCTCAAGAGGG + Intronic
1102770091 12:115468327-115468349 TGGCAGAGGCAGCCTTAGGTGGG - Intergenic
1104660925 12:130611055-130611077 TCACAGAGGAGGCCTCAAAAAGG + Intronic
1104845678 12:131845627-131845649 CTACAGCGGCTGCCTCAGGACGG - Intronic
1104845827 12:131846261-131846283 AGACAGAGGCGGTGGCAGGAGGG - Intronic
1108120384 13:47179335-47179357 TCACAGAGAATGCCTCAGGAGGG + Intergenic
1113655448 13:112065867-112065889 TGAAAGGCGGGGCCTCAGGACGG - Intergenic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1115956672 14:38788255-38788277 TGCCAGAGGCGGCTTCATAAGGG - Intergenic
1121579281 14:95014675-95014697 TCACACAGGGGGCCTCAGGTGGG + Intergenic
1121885402 14:97538463-97538485 TGGCAGAGGCGGGCTGTGGAGGG - Intergenic
1122389240 14:101369018-101369040 TGGCAGAGGCAGCATCTGGAGGG + Intergenic
1122390047 14:101373882-101373904 TGGCGGAGGCGGCAGCAGGAGGG + Intergenic
1122778502 14:104133730-104133752 GGAGAGAGGGTGCCTCAGGAAGG - Intergenic
1123467777 15:20529166-20529188 GGACTGAGGCGGACTCAGGTGGG - Intergenic
1123469809 15:20541503-20541525 TGTCAGAGGGGGCCTCGGGTTGG + Intronic
1123648254 15:22459196-22459218 TGTCAGAGGGGGCCTCGGGTTGG - Intronic
1123650336 15:22471876-22471898 GGACTGAGGCGGACTCAGGTGGG + Intergenic
1123728090 15:23124375-23124397 GGACTGAGGCGGACTCAGGTGGG - Intergenic
1123730087 15:23136489-23136511 TGTCAGAGGGGGCCTCGGGTTGG + Intronic
1123740744 15:23280718-23280740 GGACTGAGGCGGACTCAGGTGGG + Intergenic
1123746254 15:23321840-23321862 GGACTGAGGCGGACTCAGGTGGG - Intergenic
1123748257 15:23333971-23333993 TGTCAGAGGGGGCCTCGGGTTGG + Intergenic
1124209939 15:27754286-27754308 TGTCACAGGTGCCCTCAGGATGG - Intergenic
1124267258 15:28247929-28247951 TGACAGAGAAAGCCTCATGATGG + Intronic
1124278521 15:28345157-28345179 GGACTGAGGCGGACTCAGGTGGG - Intergenic
1124280620 15:28357823-28357845 TGTCAGAGGGGGCCTCGGGTTGG + Intergenic
1124302077 15:28553789-28553811 TGTCAGAGGGGGCCTCGGGTTGG - Intergenic
1124304179 15:28566451-28566473 GGACTGAGGCGGACTCAGGTGGG + Intergenic
1126375715 15:47995022-47995044 TGAGAGGGGCTGCCTAAGGATGG - Intergenic
1127838200 15:62807700-62807722 TGACAGAGAGGGGCTGAGGATGG - Intronic
1129119889 15:73389821-73389843 AGATAGAGGGAGCCTCAGGAAGG + Intergenic
1129457770 15:75684792-75684814 TGACAGTGAAGGCCACAGGATGG + Exonic
1129726034 15:77902212-77902234 TGACAGTGAAGGCCACAGGATGG - Intergenic
1130274091 15:82467579-82467601 TGACAGTGAAGGCCACAGGATGG - Intergenic
1130466438 15:84194953-84194975 TGACAGTGAAGGCCACAGGATGG - Intergenic
1130497826 15:84478583-84478605 TGACAGTGAAGGCCACAGGATGG + Intergenic
1130588733 15:85199546-85199568 TGACAGTGAAGGCCACAGGATGG - Intergenic
1131516531 15:93081295-93081317 TTACAGATGAGGCCTCAGAATGG - Intronic
1132086903 15:98916077-98916099 TGGCAGCGGCAGCCTCAGGACGG + Exonic
1132392259 15:101447598-101447620 GGACAGCGGTGGACTCAGGAAGG + Intronic
1132480061 16:162930-162952 TGACAAAGGGGCCCTCAGGTGGG - Intronic
1132681588 16:1144652-1144674 TGCCAGTGGCGGCCTCAGAGGGG - Intergenic
1133919783 16:10141746-10141768 TCACAGAGGTGCCCTGAGGATGG - Intronic
1137686891 16:50392555-50392577 TGGCAGATGAGGTCTCAGGAGGG + Intergenic
1138278079 16:55750726-55750748 TGAAAGAGACAGCCTCAGGGAGG - Intergenic
1138540498 16:57684680-57684702 TGAGAGAGGGGGCCTGAGAAAGG + Intronic
1139517245 16:67459330-67459352 TGACACAGGCAACCTCAGGGTGG - Intronic
1139776810 16:69321514-69321536 TGACGGAGGAGGCCGCAGCAGGG - Intronic
1142986282 17:3696980-3697002 AGACACAGGCAGCCTCAGGTGGG - Intergenic
1143481182 17:7228078-7228100 GGGAAGAGGAGGCCTCAGGAGGG + Intronic
1144964852 17:19070491-19070513 GGGCAGAGGCGGCCATAGGATGG - Intergenic
1144983115 17:19181687-19181709 GGGCAGAGGCGGCCATAGGATGG + Intergenic
1144985110 17:19196552-19196574 GGGCAGAGGCGGCCATAGGATGG - Intergenic
1145979401 17:29002941-29002963 TGATAGAGGGGGCCTGGGGATGG - Intronic
1147897491 17:43760201-43760223 AGACAGAAGCCCCCTCAGGAAGG + Intergenic
1148051023 17:44769956-44769978 AGACAGAGGGGGCAGCAGGAAGG - Intronic
1149035987 17:52135035-52135057 TCTCACAGGCGACCTCAGGAGGG - Intronic
1151693431 17:75701448-75701470 TGCCACAGGCGTCCTCAGGAAGG - Intronic
1152576664 17:81144147-81144169 TGAAAGAGGCTGCCTCGGGGAGG - Intronic
1152749806 17:82057402-82057424 TGACTGAGGCGGGAACAGGAGGG - Exonic
1155396005 18:25387430-25387452 GGACAGATGTGGCCTCAGGGAGG + Intergenic
1157100968 18:44729390-44729412 TGACAGAGACAGCATCAGAAGGG + Intronic
1160191126 18:76714671-76714693 TGACAGAGACAGACTCAGGAGGG - Intergenic
1161170992 19:2812493-2812515 TGCTGGAGGCTGCCTCAGGAGGG - Intronic
1161515364 19:4693314-4693336 TGACAGTGTCAGCCTCGGGATGG - Intronic
1162030301 19:7914377-7914399 CGACACTGGCGGCCTGAGGAGGG - Exonic
1165652840 19:37506420-37506442 AGACAGAGACAGCCTAAGGACGG - Intergenic
1165893576 19:39128732-39128754 GGACAGAGGCTGCCCCTGGAAGG - Intronic
1168116400 19:54223296-54223318 TGAAAGGGGCTGACTCAGGAAGG - Intronic
1168130204 19:54312901-54312923 TGAAAGGGGCTGACTCAGGAAGG - Intronic
1168636735 19:58002691-58002713 TGGGAGAGGCGGCGTCAGGGTGG - Exonic
925201425 2:1970168-1970190 TCCCAGAGCCGGACTCAGGAGGG + Intronic
927153937 2:20211202-20211224 TGACAGAGTCAGCCTCTGGGCGG - Intronic
928907334 2:36381409-36381431 TGGCAGAGCCAGGCTCAGGAAGG + Intronic
929537311 2:42791892-42791914 TGGCAGAGGTGGCCTAGGGAGGG + Intronic
931022866 2:58069661-58069683 TGACAGTGGCGGCAGCAGCAGGG - Intronic
931588356 2:63853540-63853562 AGACAGAGGTGGCCTAGGGATGG + Intronic
933633592 2:84682884-84682906 TGCTAGAAGCAGCCTCAGGAGGG - Intronic
934734914 2:96685284-96685306 TGAGAGAGCCCGCCTCAGCATGG - Intergenic
935574184 2:104691885-104691907 TGACAGTGGAGTCCTCATGATGG + Intergenic
936348250 2:111691543-111691565 TGGGAGAGGGGGCCTCAGGCAGG - Intergenic
936863945 2:117055984-117056006 TGACCGAGGCGGACTCCGGGGGG - Intergenic
937136506 2:119558235-119558257 TGACAGGGCCCGCCTGAGGATGG - Intronic
938072466 2:128315947-128315969 TGGCAGAGGGGGCCTCCTGACGG + Intronic
941693782 2:168529046-168529068 TGACAGAGTGGCCCTCATGATGG - Intronic
942726832 2:179018657-179018679 TGACAAAGGAGCCCACAGGAAGG - Intronic
945013707 2:205491888-205491910 TGCCACAGGCAGCATCAGGATGG + Intronic
945798779 2:214398128-214398150 GGACAGAGTCTGCCTCAGTATGG + Intronic
946161879 2:217840514-217840536 TCACAGAGGTGGTCTCAGGCAGG + Intronic
947367200 2:229408921-229408943 TCACAGGGGTGGTCTCAGGAAGG - Intronic
947529349 2:230898953-230898975 GGACTGAGGCTGCCACAGGAGGG - Intergenic
948533950 2:238632363-238632385 TGAGATAGGCGGCCTCAGCCTGG - Intergenic
948586394 2:239022728-239022750 GGACAGAGTCTGCCTCAGGCGGG - Intergenic
948953199 2:241268504-241268526 TGACAGAGGCGGCCTCAGGACGG - Exonic
948984168 2:241509690-241509712 TGAGAGATGCGGACCCAGGAGGG - Intronic
1170462249 20:16588222-16588244 TGAAGGAGTGGGCCTCAGGACGG + Intergenic
1171392719 20:24811760-24811782 TGGCACAGGCAGCATCAGGAGGG - Intergenic
1171796648 20:29571807-29571829 TGACAGAGGAGGACCAAGGATGG + Intergenic
1172149638 20:32780726-32780748 TGACAGGGGTGGTCTCAGCATGG + Intronic
1172308955 20:33902215-33902237 TGAAGGAGGCTGTCTCAGGAGGG - Intergenic
1173178452 20:40783381-40783403 AGACAGAGGCAGCCTCAGCTTGG + Intergenic
1173863024 20:46296766-46296788 AGAGGGAGGCTGCCTCAGGAGGG - Intronic
1178033609 21:28555909-28555931 TGACAGAAGTGGCTTCAGAAAGG + Intergenic
1178249744 21:30991001-30991023 AGACACAGGCAGCCTCAGCAGGG + Intergenic
1179593548 21:42427377-42427399 TTACAGAGGAGCCCTCAGGAAGG + Intronic
1179594603 21:42433918-42433940 TGGCAGAGCAGGTCTCAGGAAGG + Intronic
1180042100 21:45285788-45285810 TGATAGAGGCGGCCCCATGGAGG + Exonic
1180839939 22:18954574-18954596 GGACAGAGGCGGCCGGCGGAGGG + Intergenic
1181140178 22:20798726-20798748 TGACAGGAGGGGCCTCATGAGGG - Intronic
1183337265 22:37256934-37256956 TGACAGAGGTGGCCTCTGGAAGG - Intergenic
1184786366 22:46673914-46673936 GGCCAGAGGAGCCCTCAGGATGG + Intronic
1185045705 22:48527739-48527761 CGACAGAGGCTGACCCAGGAAGG - Intronic
1185165719 22:49261133-49261155 TGGCAGAGGGGACATCAGGAGGG + Intergenic
1185341589 22:50293553-50293575 TGGCAGAGGCAGCCTCAGCCAGG + Intronic
949300253 3:2575489-2575511 TGACAGAGCCAGACTCAGGAAGG + Intronic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950161461 3:10764163-10764185 AGGCAGAGGCTGCCTCGGGACGG - Intergenic
955735891 3:62037859-62037881 TGACAGTGGGGCCCTCATGATGG - Intronic
955791104 3:62589611-62589633 TGACTGTGGCTGCCTCAGTAGGG + Intronic
959200867 3:103245151-103245173 TGAAAGAGGGAGCCTCAGCAGGG - Intergenic
961464169 3:127071454-127071476 TGACAGTGGAGGCATCAGCAGGG + Intergenic
961595302 3:128011305-128011327 AGACTGAGGCGGACTCAGGGAGG - Intergenic
967072752 3:185976091-185976113 AGACAGAGGAGGCATCAAGAAGG + Intergenic
967979707 3:195058547-195058569 TCCCAGAGGGGGCCACAGGAGGG - Intergenic
969711375 4:8846220-8846242 TGACAGTGGGAGCCTCTGGATGG - Intronic
969725203 4:8914520-8914542 GGACAGGGGCAGCCTCAGGGCGG + Intergenic
972323977 4:37998042-37998064 TGACAGATGAGGGCTGAGGACGG - Intronic
972330246 4:38057507-38057529 AGACAGAGGAGGCATGAGGAGGG - Intronic
973967798 4:56181732-56181754 TGACAGAGGCGGAGACTGGAGGG - Intronic
980671012 4:136008098-136008120 TGGCAGTGGCGGCCCCAGGCAGG - Intergenic
982114585 4:152087160-152087182 TGTCAGGGGCTGCCTGAGGAGGG - Intergenic
986004642 5:3657677-3657699 TGACAGAGGGGAATTCAGGATGG - Intergenic
986523115 5:8642953-8642975 GTACAGAGGCGGCCTCAGAGGGG - Intergenic
987010288 5:13756050-13756072 TGAGAGAGTGGGCCTGAGGAGGG - Intronic
987090665 5:14505740-14505762 TGACAGTGGGTGTCTCAGGAAGG + Intronic
987149996 5:15028807-15028829 TGACTGGGGAGGCCTCAGGAAGG + Intergenic
992676072 5:79107670-79107692 GGTCAGAGCCGGGCTCAGGAAGG + Intronic
995179605 5:109218672-109218694 TGACATAGTCGGCCTCAGTCAGG + Intergenic
997565974 5:134886685-134886707 TGTCAGAGGCCACCTCAGGAAGG + Intronic
999096100 5:148979353-148979375 TGACAGATGAGGCATTAGGAGGG + Intronic
1000635754 5:163641829-163641851 TGACAGTGGAGCCCTCATGATGG - Intergenic
1001516312 5:172357591-172357613 TGACAGAGGCGCTCTCACGGTGG + Intronic
1002096635 5:176835104-176835126 GGAGAGAGGTGGCCTCAGGGTGG + Intronic
1003861509 6:10326455-10326477 TGACAGAGACATACTCAGGAAGG - Intergenic
1005969943 6:30752894-30752916 TGACAGTGGAGGCCTCAGCAGGG - Intergenic
1006937834 6:37730695-37730717 TGAGAGAGGGGGACTGAGGAAGG + Intergenic
1007130741 6:39471189-39471211 CTAGAGAGGCTGCCTCAGGAAGG - Intronic
1012248598 6:96955100-96955122 TGACAGTGGCGCACTCATGATGG - Intronic
1015595898 6:134866359-134866381 TGACAGAGCAAGACTCAGGAAGG + Intergenic
1017103167 6:150865964-150865986 GGACAGCGGCGGCCGCAGGATGG + Exonic
1017633362 6:156421149-156421171 AGACAGGGATGGCCTCAGGAAGG - Intergenic
1017684779 6:156901370-156901392 TGACAGATGCCACCTCAGTATGG + Exonic
1017884952 6:158591282-158591304 TGACTGGGGCAGCTTCAGGAAGG - Intronic
1018947274 6:168356630-168356652 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947339 6:168356850-168356872 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947372 6:168356960-168356982 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947471 6:168357290-168357312 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947504 6:168357400-168357422 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947604 6:168357729-168357751 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947636 6:168357839-168357861 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947794 6:168358333-168358355 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947827 6:168358443-168358465 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019934997 7:4249065-4249087 ACACAGAGGTGGCCTCAGGGAGG + Intronic
1024516606 7:50264752-50264774 GGACAGGGAAGGCCTCAGGAGGG + Intergenic
1025028901 7:55539743-55539765 GGACAGAGGTGGCCACAGGCAGG + Intronic
1033638585 7:143237865-143237887 TGACAGTGGCAGCCCCAGGTAGG + Intergenic
1034319313 7:150164958-150164980 CCACAGAGGGGGCCCCAGGAGGG - Intergenic
1034434036 7:151054609-151054631 TGACAGAAGCAGCCCCAGGCAGG + Intronic
1034830598 7:154304845-154304867 GGGCAGAGGTGGCCCCAGGAGGG - Intronic
1034854396 7:154528417-154528439 TGACAGAGGTGGAGTAAGGACGG - Intronic
1035874708 8:3175605-3175627 TGGCAAAGGCAACCTCAGGAAGG - Intronic
1036010311 8:4714204-4714226 TGACAGAGGAGGCGTCAACACGG - Intronic
1036068591 8:5413540-5413562 TGACAAATGCAGGCTCAGGATGG - Intergenic
1037298344 8:17425130-17425152 TGACAGATGGGGCCTAATGATGG + Intergenic
1038065507 8:23959561-23959583 TGAGAGTGGAGCCCTCAGGATGG - Intergenic
1042891880 8:73621345-73621367 TGGCTGGGGAGGCCTCAGGATGG - Intronic
1044923639 8:97190717-97190739 TGAAAGGGGCTGACTCAGGAAGG - Intergenic
1045717466 8:105065528-105065550 TGACAGGGGAGGCTTCAGAAAGG + Intronic
1047272321 8:123373865-123373887 TAACAGATGCAGCCTAAGGATGG - Intronic
1048873281 8:138816223-138816245 GGACAGAGGCGTTCTCAGGTGGG + Intronic
1049237438 8:141519154-141519176 TGATAGAGGGGGCAGCAGGATGG + Intergenic
1049651577 8:143772167-143772189 TGTCGGAGGCGGCCGCAGGCGGG + Intergenic
1049783355 8:144439022-144439044 GGACAGAGGGGGCCTCGGGCAGG - Intronic
1050150642 9:2616432-2616454 TGACAGAGGTGCCCTCTTGAGGG - Intergenic
1053789372 9:41675614-41675636 TGACAGAGGAGGACCAAGGATGG - Intergenic
1054155770 9:61639148-61639170 TGACAGAGGAGGACCAAGGATGG + Intergenic
1054177653 9:61886967-61886989 TGACAGAGGAGGACCAAGGATGG - Intergenic
1054475539 9:65570149-65570171 TGACAGAGGAGGACCAAGGATGG + Intergenic
1054659878 9:67693841-67693863 TGACAGAGGAGGACCAAGGATGG + Intergenic
1055731639 9:79284801-79284823 TGACAGAGCAGGCCTCTTGAGGG - Intergenic
1057044700 9:91876387-91876409 TGAAAGTGAAGGCCTCAGGAAGG + Intronic
1057142640 9:92736921-92736943 TGGCAGAATAGGCCTCAGGATGG + Intronic
1057476363 9:95406128-95406150 TGAAAGGGGAGACCTCAGGATGG + Intergenic
1059417421 9:114170466-114170488 TGGGAGAGCCGGCTTCAGGAAGG - Intronic
1059560966 9:115334024-115334046 GGAAAGAGGTGGCATCAGGAAGG - Intronic
1059665826 9:116445859-116445881 TGCCAGTGGGGGCCTCGGGATGG + Intronic
1060764349 9:126282805-126282827 TCACAGAGGCGGCCTCACCCCGG + Intergenic
1060816899 9:126639702-126639724 GGGCAGAGGAGGGCTCAGGATGG + Intronic
1061164561 9:128914740-128914762 TGAAGGAGGCAGCCTCGGGACGG + Intronic
1061209978 9:129185858-129185880 TCACAATGCCGGCCTCAGGAGGG + Intergenic
1061260394 9:129477379-129477401 TCTCAGAGGCAGGCTCAGGAAGG - Intergenic
1061801666 9:133116291-133116313 CCACAGAGGCGGCCTCAGACCGG + Intronic
1185616747 X:1426554-1426576 TGAAAGATGGGGCCTCAGGCCGG + Intronic
1186522524 X:10218882-10218904 TCACATAGGAGGCATCAGGAAGG - Intronic
1187843671 X:23514541-23514563 TCACAGAGACTGCATCAGGAGGG - Intergenic
1189489060 X:41455561-41455583 TGACAGAGGCTGGCTGAGTAGGG + Intronic
1189536384 X:41939435-41939457 TCACAGAGGGGGCGTGAGGAAGG + Intergenic
1189615671 X:42780496-42780518 AGACAGAGCTGGCCTCAGCATGG - Intergenic
1189972100 X:46428419-46428441 TGACATAGGCAGCATCATGAAGG - Intergenic
1192053787 X:67751173-67751195 TGACAGAGGTGGCATCAGCAGGG + Intergenic
1194577674 X:95633925-95633947 TGACAGAGATGGACACAGGAAGG - Intergenic
1195386673 X:104320165-104320187 TGACAGAGGTGGCCTGAGAGAGG - Intergenic
1195968772 X:110452590-110452612 TGACAGACACAGCCTCTGGAGGG + Exonic
1196795696 X:119500611-119500633 TGTCAGAGGCGGCCACAGAAGGG + Intergenic
1199980043 X:152915899-152915921 AGGCAGTGGCGGCCTCTGGAAGG + Intronic
1200033082 X:153312051-153312073 TGTCAGAGGAGCCCTCGGGAGGG - Intergenic
1201291063 Y:12421162-12421184 AGACGGAGGCTGCCTCAGTATGG - Intergenic