ID: 948953200

View in Genome Browser
Species Human (GRCh38)
Location 2:241268508-241268530
Sequence AGGCTGACAGAGGCGGCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953200_948953205 -3 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953200_948953212 15 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953212 2:241268546-241268568 TATGGGATGGGAAGTGGGAGAGG 0: 1
1: 0
2: 8
3: 90
4: 822
948953200_948953210 9 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953210 2:241268540-241268562 TGCTGGTATGGGATGGGAAGTGG 0: 1
1: 0
2: 3
3: 49
4: 399
948953200_948953203 -8 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953200_948953213 24 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953213 2:241268555-241268577 GGAAGTGGGAGAGGAGAGAGAGG 0: 2
1: 5
2: 41
3: 558
4: 3195
948953200_948953209 3 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953209 2:241268534-241268556 AGCTTTTGCTGGTATGGGATGGG 0: 1
1: 0
2: 3
3: 9
4: 184
948953200_948953206 -2 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953200_948953211 10 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953211 2:241268541-241268563 GCTGGTATGGGATGGGAAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 353
948953200_948953208 2 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953208 2:241268533-241268555 CAGCTTTTGCTGGTATGGGATGG 0: 1
1: 0
2: 13
3: 88
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953200 Original CRISPR AGGCTGACAGAGGCGGCCTC AGG (reversed) Exonic
900372721 1:2339407-2339429 AGGCTGACCGCAGCGGCCCCTGG + Intronic
900723195 1:4193899-4193921 AGGATGACTGGGGAGGCCTCAGG - Intergenic
901337513 1:8463849-8463871 AGCCTGGCCTAGGCGGCCTCAGG - Intronic
901425682 1:9181321-9181343 AACCTGAGAGAGGGGGCCTCAGG + Intergenic
901872283 1:12145120-12145142 AGACAGTCAGAGGAGGCCTCAGG - Intergenic
902505670 1:16938052-16938074 AGGTTGCCAGAGGCCGCATCTGG - Intronic
903808705 1:26022673-26022695 AGGCTGACAGTGCCAGCCACAGG - Exonic
905003008 1:34688228-34688250 AGGCTGTCAGATGCAGTCTCTGG - Intergenic
905651010 1:39657004-39657026 TGGCTAACAGAGGAGGCCTTGGG - Intergenic
906074435 1:43041765-43041787 AGGCTGGCAGAGGCTGCCCTTGG + Intergenic
908401426 1:63775128-63775150 GTGCTGTCAGAGGCGGCCTGCGG + Intronic
909517624 1:76530334-76530356 AGTATGTCAGAGGGGGCCTCAGG - Intronic
909523028 1:76591296-76591318 AGGCTAACAGTGGTTGCCTCAGG - Intronic
918322914 1:183382101-183382123 AGCCTGACTGAGGAAGCCTCAGG + Intronic
920360898 1:205415395-205415417 AGGCTGAAGGAGGAGGTCTCAGG + Intronic
920805761 1:209231976-209231998 AGGCTTGCAGAGGCGGCCGAAGG + Intergenic
920963092 1:210681398-210681420 AGGCTTACAGGGGCTGCCCCTGG - Exonic
921621555 1:217331168-217331190 TGGCTGGCAGAGGTGGGCTCAGG + Intergenic
922051295 1:221993081-221993103 AGGCAGACACAGGCAGTCTCAGG + Intergenic
922794896 1:228335116-228335138 AGGCTGAGAGAGGCGTGCTGTGG + Exonic
924038751 1:239962799-239962821 AAGCTGACAGAGGAGGCTTCTGG - Intergenic
924045343 1:240024048-240024070 AAGCTGACAGAGGAGGGTTCTGG - Intronic
1064990834 10:21255345-21255367 AGGCTGAGAGATGCTGACTCGGG + Intergenic
1065047284 10:21755658-21755680 GAGGTGACAGAGGCTGCCTCAGG - Intergenic
1067296926 10:44979965-44979987 AGGATGAGAGAGGCAGCCCCTGG + Intronic
1069631900 10:69902367-69902389 AGGGTGACAGAGGCAGGCCCAGG + Intronic
1069883053 10:71605979-71606001 AGCCTCAGAGAGGCGGCCCCTGG - Intronic
1070813972 10:79311925-79311947 AGGCTGACAGAGCAGGGCTGGGG - Intronic
1073180038 10:101578055-101578077 AGGCAGACAAAGGCTGGCTCCGG + Intronic
1073305987 10:102503954-102503976 AGTCTGCCAGAGGGTGCCTCGGG - Intergenic
1075593437 10:123709325-123709347 AGGCTGGAAGAAGAGGCCTCCGG - Intronic
1075717897 10:124567398-124567420 AGGCTGAGAGAGGCAGCCAGGGG - Intronic
1076413785 10:130270763-130270785 AGGCTGGCACAGGCTGCCACTGG - Intergenic
1077524829 11:3057711-3057733 TGGAGGTCAGAGGCGGCCTCGGG + Intergenic
1078036209 11:7807822-7807844 AGGCTAGCTGAGGAGGCCTCAGG + Intergenic
1078063180 11:8061378-8061400 AGGATGAGAGAGCTGGCCTCAGG + Intronic
1078328877 11:10402369-10402391 AGGCTCAGAGAGGTAGCCTCTGG + Intronic
1078507888 11:11965814-11965836 GGGCTGGCAGAGGAGGCCACTGG + Exonic
1083203771 11:61135223-61135245 ATTCTGGAAGAGGCGGCCTCGGG + Intronic
1083651546 11:64207443-64207465 AGGGTGACCGACTCGGCCTCTGG - Exonic
1083935073 11:65865762-65865784 AGGCTGACAGTGGCCCACTCTGG - Intronic
1083944946 11:65918652-65918674 GGCCTTACAGAGCCGGCCTCGGG - Intronic
1085810073 11:79671974-79671996 ATCCTGACAGTGGCAGCCTCGGG - Intergenic
1091372674 11:135073921-135073943 AGGCAGGCAGAGGCAGCTTCAGG - Intergenic
1091582216 12:1796913-1796935 AGCCTGACAGAGGCTGCCCGCGG + Intronic
1092444307 12:8539589-8539611 AGGCTGAAAGAGGAGGATTCAGG + Intronic
1093065269 12:14651856-14651878 AGGCTGACAGAAAAGCCCTCAGG - Intronic
1096195333 12:49645887-49645909 AGGCTGGCAGTGGAGGCCTGTGG + Exonic
1101014632 12:100487433-100487455 AGGCTAACAGAGGGGGCAGCTGG + Intronic
1102611705 12:114117989-114118011 AGGCAGGCAGAGGAGGCCTATGG - Intergenic
1102662569 12:114542678-114542700 AGCATGACTGAGGAGGCCTCAGG + Intergenic
1102834441 12:116041335-116041357 AGCATGACAGAGGAGTCCTCAGG - Intronic
1104891097 12:132140578-132140600 GGGGTGGCAGAGGTGGCCTCTGG - Intronic
1105853815 13:24358629-24358651 AAGGGGACAGAGGGGGCCTCTGG + Intergenic
1109220390 13:59635746-59635768 AGGCTGTGAAGGGCGGCCTCAGG - Intergenic
1112701806 13:102018648-102018670 GGGCTGGAAGAGGAGGCCTCAGG - Intronic
1112991427 13:105518269-105518291 AGCATGACTGAGGAGGCCTCAGG + Intergenic
1113444482 13:110355218-110355240 AGGCTGGCAGAGGCTGGCTGAGG + Intronic
1114935588 14:27532860-27532882 AGCATGGCTGAGGCGGCCTCAGG - Intergenic
1115943136 14:38630381-38630403 AGCATGACTGAGGAGGCCTCAGG + Intergenic
1118150050 14:63179469-63179491 AAGCTGACAGTGCAGGCCTCAGG - Intergenic
1119807001 14:77488727-77488749 AGGCAGACAGAGGAGCCATCAGG + Intronic
1120092446 14:80348498-80348520 AGCATGACTGAGGAGGCCTCAGG + Intronic
1122820889 14:104344240-104344262 AGCCTGACAGAGGAGGCCTCTGG - Intergenic
1122839726 14:104451298-104451320 AGGCTGCCAGCGGGGGCCTAGGG + Intergenic
1123126866 14:105953031-105953053 AGGTGGACAGAGGCAGCCACAGG + Intergenic
1123402859 15:20004154-20004176 AGGCTGACAGGAGCGGACGCTGG - Intergenic
1123469808 15:20541499-20541521 CGGCTGTCAGAGGGGGCCTCGGG + Intronic
1123512198 15:21010808-21010830 AGGCTGACAGGAGCGGACGCTGG - Intergenic
1123648255 15:22459200-22459222 CGGCTGTCAGAGGGGGCCTCGGG - Intronic
1123730086 15:23136485-23136507 CGGCTGTCAGAGGGGGCCTCGGG + Intronic
1123748256 15:23333967-23333989 CGGCTGTCAGAGGGGGCCTCGGG + Intergenic
1124280619 15:28357819-28357841 CGGCTGTCAGAGGGGGCCTCGGG + Intergenic
1124302078 15:28553793-28553815 CGGCTGTCAGAGGGGGCCTCGGG - Intergenic
1124662739 15:31563499-31563521 AGGCCGACAGAGAGGGCCTGGGG + Intronic
1125689331 15:41583933-41583955 TGGGTGAGAGAGGAGGCCTCAGG - Intergenic
1128087089 15:64894027-64894049 AGGCTGACACAGGCAGCTTGTGG + Intronic
1128557021 15:68638824-68638846 GGGCTGACAGAGGTGGTGTCTGG + Intronic
1129516327 15:76159823-76159845 GAGCTGAGAGAGGCGGCCTGTGG + Intronic
1130297917 15:82660160-82660182 AGGCTGACAAAGGCTTCCTGAGG - Intronic
1130738354 15:86572505-86572527 AGGCTCCCAGAGGCAGGCTCTGG + Intronic
1131013425 15:89038332-89038354 AGGGTGACAGTGGCGGCCAGAGG + Intergenic
1132163822 15:99566013-99566035 GGGCTGAAAGAGGCGGCTCCGGG + Exonic
1133244608 16:4439766-4439788 AGGCTGGCAGAGGAGGAGTCAGG - Intronic
1133848607 16:9480446-9480468 AGCATGGCAGAGGAGGCCTCTGG - Intergenic
1136288366 16:29257524-29257546 AGGATTGCTGAGGCGGCCTCTGG + Intergenic
1137277179 16:46943348-46943370 ATGGTGACAGAAGTGGCCTCTGG - Intergenic
1139594836 16:67951520-67951542 AGGCGGGCAGTGGCGGGCTCTGG - Intronic
1140409314 16:74732323-74732345 AGGCTGAGAGAGGGGCCCCCTGG - Intronic
1140477322 16:75245428-75245450 AGGCTGGCAGAGGCCCCATCAGG + Intronic
1141999509 16:87656143-87656165 AGGCGGGCAGAGACGCCCTCAGG - Intronic
1142094047 16:88230307-88230329 AGGATTGCTGAGGCGGCCTCTGG + Intergenic
1144438135 17:15259492-15259514 AGACTGAGAGAGGCGGGCTTGGG - Intronic
1144712729 17:17412976-17412998 AGGCTGGCACAGGAGGCCCCAGG + Intergenic
1144890109 17:18489591-18489613 AGGCTGGCAGAGGGTGCTTCCGG - Intronic
1145142107 17:20454726-20454748 AGGCTGGCAGAGGGTGCTTCCGG + Intronic
1145793801 17:27644175-27644197 AGGCTGGCAGAGGGTGCTTCCGG - Intronic
1145808613 17:27751751-27751773 AGGCTGGCAGAGGATGCTTCCGG - Intergenic
1146288519 17:31591531-31591553 AGGCCCACAGAGGTGGCCTGGGG - Intergenic
1146523902 17:33549589-33549611 TGGCTGACAGATGCTGCCTATGG + Intronic
1148194311 17:45702292-45702314 AGGCTGGCAGCTGAGGCCTCAGG - Intergenic
1148451520 17:47781151-47781173 AGGAGGGCAGAGGAGGCCTCTGG - Intergenic
1150311256 17:64130601-64130623 AGGTTTACCGAGGCGACCTCCGG + Intronic
1151202304 17:72477628-72477650 AGGCTGAGAGAGCCAGCCCCAGG + Intergenic
1152487011 17:80601108-80601130 AGGCTGCCAGAGGAGGCCATGGG + Intronic
1152576666 17:81144151-81144173 AAGGTGAAAGAGGCTGCCTCGGG - Intronic
1153915571 18:9741617-9741639 AGGCTGAGAGAGGCTGGCACTGG - Intronic
1161231644 19:3177617-3177639 AGGCCCACAAAGGCGGCCTGAGG - Intronic
1163311988 19:16520343-16520365 AGGTAGGCAGAGGCTGCCTCAGG - Exonic
1164558262 19:29269863-29269885 AGCCTGACAGAGGGAGCCGCTGG - Intergenic
1165177196 19:33939081-33939103 AGGGTGTCAGAGCCGGGCTCTGG - Intergenic
1165423867 19:35735136-35735158 AAGTTGACAGAGGTGGACTCTGG + Intronic
1166126366 19:40717344-40717366 AGCCTGAGAGGGCCGGCCTCGGG + Exonic
1166915647 19:46194375-46194397 AGGCACCCAGAGGCTGCCTCTGG + Intergenic
1167616049 19:50534478-50534500 TGGCTGTCAGAGGTGGCCCCAGG - Intronic
1168636737 19:58002695-58002717 CGGCTGGGAGAGGCGGCGTCAGG - Exonic
925376610 2:3390161-3390183 AGGCAGACAGGGGCGGTCCCCGG - Intronic
928363351 2:30683331-30683353 AGCATGACTGAGGAGGCCTCAGG + Intergenic
928495613 2:31828875-31828897 AAGCTGACAGAGGAGCCCTTGGG - Intergenic
929425702 2:41842553-41842575 TGGATGACAGTGGCTGCCTCTGG - Intergenic
930700804 2:54456622-54456644 AGGCGGGCAGCGGCGTCCTCCGG - Intronic
931230641 2:60371789-60371811 AGGTTGGCAGAGGGGGCTTCTGG + Intergenic
932700095 2:73985793-73985815 TGTCTGAGGGAGGCGGCCTCGGG - Intergenic
934601720 2:95663240-95663262 GGGCTGACACGGGCAGCCTCGGG + Intergenic
934926928 2:98388633-98388655 AGGCTCACAGGGGCAGCCCCCGG - Intronic
936053874 2:109246155-109246177 AGGTTGACAGAGGCTGCCTTAGG + Intronic
936348252 2:111691547-111691569 AGCCTGGGAGAGGGGGCCTCAGG - Intergenic
937004743 2:118501185-118501207 AAGCAGACAGAAGTGGCCTCGGG + Intergenic
937465663 2:122131201-122131223 AGGCTGACAGACTTGTCCTCAGG + Intergenic
937878504 2:126846901-126846923 AGCATGACAGGGGAGGCCTCAGG + Intergenic
944172991 2:196799823-196799845 GGGCTGAAAGACGCGGCCTAGGG - Intergenic
944616361 2:201464928-201464950 AAGCTGACAGAAGAGCCCTCGGG - Intronic
945062370 2:205920372-205920394 AGGATGACGGAGGAGGCGTCAGG + Intergenic
945891430 2:215435617-215435639 GGGCTGAAACAGGCTGCCTCAGG - Intronic
946292200 2:218753873-218753895 TGGCTGACAGTGGCTGCTTCAGG - Intronic
947602746 2:231464632-231464654 AGGCGGGCCGAGGCGGCCACGGG + Intronic
948704654 2:239781353-239781375 AGGCTGGCAGAGGCTGTCGCTGG + Intronic
948953200 2:241268508-241268530 AGGCTGACAGAGGCGGCCTCAGG - Exonic
1171892418 20:30728478-30728500 AGGCTGACAGGGGCAGCTCCTGG + Intergenic
1171992968 20:31710595-31710617 AGGCTGAGGGTGGAGGCCTCTGG + Intronic
1172203546 20:33145693-33145715 AAGCTGACTGAGGCGCCCTTGGG - Intergenic
1173669453 20:44788035-44788057 AGGCTCACAGAGGTGGTATCTGG + Intronic
1173813741 20:45971865-45971887 CGGCTGACAGCGACGGTCTCGGG + Intronic
1175777749 20:61663731-61663753 GGGCTGACAGACGCGGGGTCGGG + Intronic
1175861126 20:62151065-62151087 AGCCAGACAGAGGAGGCCTGGGG - Intronic
1175917542 20:62433655-62433677 AGGCTGGCAGGGGCTGCCACGGG + Intergenic
1176099374 20:63358019-63358041 TAGCTGGCAGAGGCGGCCGCTGG - Intronic
1176286034 21:5020255-5020277 AGGCAGGCCGAGGCGGCCGCGGG - Intergenic
1176624778 21:9083547-9083569 AGGCGGACAGGGGCGGCTCCTGG - Intergenic
1177740584 21:25148513-25148535 AGGCTGACAGAAGAGCCCTTGGG - Intergenic
1179476475 21:41649709-41649731 AGGCTGACGGACTCGGCCTGGGG - Intergenic
1179871147 21:44243220-44243242 AGGCAGGCCGAGGCGGCCGCGGG + Intergenic
1179985950 21:44920442-44920464 AGGTTCACAGAGGAGGCCCCGGG + Intronic
1180714571 22:17862968-17862990 ACGCGGACAGAGACGTCCTCAGG + Intronic
1181457854 22:23070019-23070041 GGGCTGCCAGAGGTGGCCCCTGG + Intronic
1182975746 22:34622469-34622491 TGGGTGACAGAGGCAGACTCTGG - Intergenic
1183165757 22:36146073-36146095 TGGCTTACAGAGGCTGCCTCAGG - Intronic
1183172076 22:36195846-36195868 TGGCTTACAGAGGCTGCCTCAGG - Intronic
1183225492 22:36547051-36547073 AGGCTGAGAGAGGTGGCTTCTGG + Intergenic
1184301460 22:43563165-43563187 AGGCTGGAAGAGGCGGGCTTGGG + Intronic
949325654 3:2860753-2860775 ATTCTGAGAGAGGGGGCCTCTGG - Intronic
951889405 3:27554448-27554470 TGGCTGACAGAGGAGGTCTTTGG - Intergenic
953436403 3:42881017-42881039 AGACACACGGAGGCGGCCTCCGG + Intronic
955404501 3:58617456-58617478 AAGATGACAGAGGCTGCCACAGG - Intronic
957018818 3:75101002-75101024 AGCCTGACTGGGGCAGCCTCAGG - Intergenic
958025656 3:88045851-88045873 AGGCTGGGACAGGGGGCCTCAGG + Intergenic
960563700 3:119112900-119112922 AGCATGGCAGAGGAGGCCTCAGG + Intronic
961332680 3:126152189-126152211 AGGCTGACAGAGGTGGGGACAGG + Intronic
961333474 3:126156530-126156552 AGGCTGGCAGGGACGGCCACAGG - Intronic
964544252 3:157816032-157816054 AGGCTGGCAGAGACTGCATCTGG + Intergenic
968008712 3:195259718-195259740 AGGCCGCCAGAGGCCGGCTCCGG - Intronic
968570394 4:1337379-1337401 AGGCAGACAGAGTCGGTCACAGG - Intronic
968891660 4:3372536-3372558 CAGCTGTCAGAGGCCGCCTCGGG + Intronic
969225933 4:5798442-5798464 GGGCAGAAAGAGGTGGCCTCTGG - Intronic
969226706 4:5803313-5803335 GGGAAGACAGAGGTGGCCTCTGG - Intronic
969270366 4:6095446-6095468 AGGTTGGCAGGGGCTGCCTCTGG - Intronic
969641174 4:8399563-8399585 GGGCTGACATAGGTGCCCTCGGG + Exonic
969709241 4:8833185-8833207 AGGCTGACAGAGGCGGGGCTTGG - Intergenic
970495316 4:16619026-16619048 AGCATGACTGAGGAGGCCTCAGG - Intronic
971561649 4:28085327-28085349 AGCATGACAGGGGAGGCCTCAGG + Intergenic
975420675 4:74160083-74160105 AGGCAGACAGTGGCAACCTCTGG - Intronic
977754195 4:100647148-100647170 ATGTTGACAGAAGCTGCCTCTGG - Intronic
980627375 4:135391004-135391026 AGGATGGCTGAGGAGGCCTCAGG + Intergenic
981049209 4:140294136-140294158 ATGCTGAGAGTGGCAGCCTCAGG + Intronic
984505047 4:180606991-180607013 AGGCTGACAAAGCCAGCCTGAGG + Intergenic
986249918 5:6046096-6046118 AGGCTGTCAGCGGCAGCCCCTGG + Intergenic
989178821 5:38556512-38556534 AGGCTGCTTGAGGCGGCCACGGG + Intronic
989415425 5:41169603-41169625 AGCCTGGCAGGGGAGGCCTCGGG + Intronic
990215029 5:53521384-53521406 AGCATGACTGAGGAGGCCTCAGG + Intergenic
990301057 5:54449918-54449940 AGGCTGACAGAGTGGGCCACAGG - Intergenic
990540708 5:56770353-56770375 TGACTGACAGAGGGGGCCTCTGG - Intergenic
991476427 5:67025575-67025597 AGGCTGACCCAGGTGGCCTCTGG + Intronic
993789363 5:92188661-92188683 AGGCAGAAAGAGGCAGCCACAGG - Intergenic
995185511 5:109267100-109267122 AGGCTGACCTTGGCAGCCTCAGG + Intergenic
995716295 5:115084585-115084607 AGGCTGTCAGAGGCTGGGTCCGG + Intergenic
1001645446 5:173278354-173278376 AGGCTGGCACAGGAGGCCCCTGG + Intergenic
1001924452 5:175626225-175626247 AGCATGACTGAGGAGGCCTCAGG + Intergenic
1002493909 5:179599178-179599200 AGGAGCAAAGAGGCGGCCTCAGG + Intronic
1004217791 6:13718350-13718372 AGCATGGCTGAGGCGGCCTCAGG - Intergenic
1005682920 6:28224903-28224925 ACGGTGACAGTGGCTGCCTCGGG + Intronic
1006292806 6:33153170-33153192 TGGCTGTCTGAGGAGGCCTCTGG - Intergenic
1007244204 6:40448324-40448346 AGGCTGCCAGAGGTGGGGTCTGG - Intronic
1010553026 6:77246136-77246158 AGCCTTACAGATGCGCCCTCTGG - Intergenic
1012635762 6:101538869-101538891 AAGCTGACAAAGGAGGTCTCTGG - Intronic
1015107851 6:129557666-129557688 GGGCTGACAGTGGTGGCCTGAGG - Intergenic
1016939281 6:149471156-149471178 AGGTTGACAGAGTGGGCCACTGG - Intronic
1017223237 6:151990629-151990651 AGGCTGAGAAATGCAGCCTCTGG + Intronic
1017890133 6:158631088-158631110 AGGCTGAGGGAGGCGGCCTGTGG - Intronic
1018373093 6:163186586-163186608 AGGCTGCCAGAAGCGGCCAGAGG - Intronic
1018434656 6:163749356-163749378 AGGCAGACAGAGGGGCCCTGTGG + Intergenic
1019021150 6:168918774-168918796 GGGCAGACAGTGGGGGCCTCTGG - Intergenic
1019271026 7:149361-149383 CGGCTCACAGAGGCCGCCTCAGG + Intergenic
1019676149 7:2314016-2314038 GGGCTCTCAGAGGCGTCCTCGGG - Intronic
1025752776 7:64307653-64307675 AGGCTGGAAGAGGCTTCCTCAGG - Intronic
1026229313 7:68469529-68469551 AGGATGACAGAGGCAGCAACTGG + Intergenic
1026735243 7:72945098-72945120 GGGCTGCCAGAGAGGGCCTCGGG + Intronic
1026785585 7:73300027-73300049 GGGCTGCCAGAGAGGGCCTCGGG + Intergenic
1029339903 7:99934243-99934265 AGGCCGAGAGAGGAGTCCTCAGG + Intergenic
1031222809 7:118993606-118993628 AGGCGGACACAGGCAGTCTCTGG + Intergenic
1031558960 7:123214704-123214726 AGCATGACTGAGGAGGCCTCAGG - Intergenic
1031661851 7:124435638-124435660 AGCATGACTGAGGAGGCCTCAGG + Intergenic
1032240313 7:130154483-130154505 AGGCTGACACAAGCCGGCTCTGG + Intergenic
1032800522 7:135314035-135314057 AGGCTGGGAGAGGCGACGTCAGG - Intergenic
1035378382 7:158422726-158422748 AGGCTGACACTGCCGGCTTCTGG + Intronic
1043750628 8:83929375-83929397 AGGCTGACAGAAGAGCCCTTGGG - Intergenic
1043890008 8:85644154-85644176 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043891548 8:85656068-85656090 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043892620 8:85662905-85662927 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043892937 8:85714430-85714452 AGGCTGACAGAGAGGCCCTCGGG + Intergenic
1043895624 8:85735884-85735906 AGGCTGACAGAGAGGCCCTCGGG + Intergenic
1043897055 8:85745924-85745946 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043899381 8:85764292-85764314 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043900989 8:85776485-85776507 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043902953 8:85791760-85791782 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043904563 8:85803953-85803975 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043906175 8:85816144-85816166 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1043907783 8:85828334-85828356 AGGCTGACAGAGAGGCCCTCGGG - Intergenic
1045438491 8:102187645-102187667 AGGCTGGGAGAGGCTGCCTCAGG - Intergenic
1047124307 8:121943571-121943593 AGCATAACTGAGGCGGCCTCAGG - Intergenic
1047395612 8:124496029-124496051 TGGCTGATAGAGGCTGCCACAGG - Intronic
1047801904 8:128318840-128318862 CTGCAGACAGAGGAGGCCTCTGG - Intergenic
1049232103 8:141489786-141489808 AGGATGACAGAGGAGGTCCCAGG - Intergenic
1049685173 8:143936466-143936488 AGGCTGGCAGGTGGGGCCTCTGG + Intronic
1050915947 9:11132815-11132837 AGGATGGCAGGGGAGGCCTCAGG - Intergenic
1052428771 9:28338790-28338812 AGGGTGGCTGAGGAGGCCTCAGG - Intronic
1053148554 9:35728410-35728432 AGACTGACATATCCGGCCTCAGG + Intronic
1055836890 9:80454532-80454554 AGCCTGGCTGAGGAGGCCTCAGG - Intergenic
1056724632 9:89103883-89103905 CTCCTGACAGAGGCAGCCTCTGG - Intronic
1057142639 9:92736917-92736939 AGGCTGGCAGAATAGGCCTCAGG + Intronic
1058923298 9:109638839-109638861 AGGCTCCCAGAAGCTGCCTCAGG - Intergenic
1059419941 9:114184542-114184564 AGGCAGGCAGTGGAGGCCTCAGG + Intronic
1062117636 9:134817930-134817952 AGGCTGAGAGTGGCTGCCCCAGG + Intronic
1203747941 Un_GL000218v1:53975-53997 AGGCGGACAGGGGCGGCTCCTGG - Intergenic
1189238474 X:39507208-39507230 AGCTTGAGAGAGGCAGCCTCAGG - Intergenic
1189239369 X:39513956-39513978 AGGCTGAGAGATGCTGGCTCAGG - Intergenic
1191054963 X:56232242-56232264 AGGCTGAGGGAGGCGGCCGCCGG + Intergenic
1194558642 X:95393845-95393867 AGGCTGACAGAGGAGCCCTTGGG + Intergenic
1198533633 X:137567067-137567089 GGGCTCAGTGAGGCGGCCTCGGG + Exonic
1199162684 X:144632681-144632703 AGCATGGCAGAGGAGGCCTCTGG + Intergenic
1199201013 X:145088759-145088781 AGGATGGCTGAGGAGGCCTCAGG - Intergenic
1199677414 X:150199897-150199919 AGGCTGGCAGAGGCAGCTACAGG - Intergenic
1200033084 X:153312055-153312077 AAGCTGTCAGAGGAGCCCTCGGG - Intergenic
1201624160 Y:15995634-15995656 AGCATGACTGAGGAGGCCTCAGG + Intergenic