ID: 948953203

View in Genome Browser
Species Human (GRCh38)
Location 2:241268523-241268545
Sequence GTCAGCCTGCCAGCTTTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953198_948953203 5 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953200_948953203 -8 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953199_948953203 -4 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
948953195_948953203 24 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953203 Original CRISPR GTCAGCCTGCCAGCTTTTGC TGG Exonic
900631733 1:3639951-3639973 GACAACCTGGCAGCGTTTGCAGG - Intronic
900659477 1:3775498-3775520 GGCAGCCTGCCAGCCATAGCAGG + Intronic
900876894 1:5349252-5349274 GTCACCCTGCCAGCTTCGGGAGG - Intergenic
901605043 1:10452710-10452732 GTCCTCCAGCCAGCCTTTGCTGG - Intergenic
901663954 1:10815966-10815988 GCCAGGCTGCCAGCCTTGGCAGG - Intergenic
902509396 1:16957908-16957930 ATTTGCGTGCCAGCTTTTGCTGG + Intronic
903933643 1:26879560-26879582 GCCAGCCCGCCAGCTCTGGCTGG + Exonic
905431542 1:37928117-37928139 GTCAGACTGCCAGCTCCTGAGGG + Intronic
906197678 1:43939058-43939080 CCCAGGCTGCCAGCTTTTGAGGG + Intergenic
906502302 1:46350279-46350301 CTCAGCCTCCTAGCTTGTGCTGG - Intronic
908092397 1:60699994-60700016 GTAATCCTTCCAGCTGTTGCTGG - Intergenic
911041324 1:93593199-93593221 GTCAGCATGCCTGGTCTTGCTGG - Intronic
912799923 1:112714381-112714403 TTCAGCCTGCCAACTCGTGCTGG - Intronic
913648591 1:120887162-120887184 GTCATGCTGCCACCTTTTGATGG + Intergenic
914078105 1:144376198-144376220 GTCATGCTGCCACCTTTTGATGG - Intergenic
914101074 1:144590303-144590325 GTCATGCTGCCACCTTTTGATGG + Intergenic
914297899 1:146347351-146347373 GTCATGCTGCCACCTTTTGATGG - Intergenic
914638727 1:149581193-149581215 GTCATGCTGCCACCTTTTGATGG + Intergenic
915277459 1:154799497-154799519 GTCAGCCTGCCCTCGTTTTCTGG - Intronic
915567122 1:156721400-156721422 GTCCTGCTGCCAGCTTTTGGTGG - Intergenic
917368680 1:174263167-174263189 ACCTGCCTGCCAGCCTTTGCTGG + Intronic
919711711 1:200735834-200735856 GTCTGCCTGCAAGCTTTTTTTGG + Intergenic
920219340 1:204385105-204385127 GTCAGCCAGCCATCTTGGGCTGG - Intergenic
922571790 1:226638711-226638733 GACAGCTCGCCAGCTCTTGCTGG + Intronic
924267346 1:242296678-242296700 GTTAGCCAGCCAGCTCTTGCTGG - Intronic
924957484 1:248943837-248943859 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
1063634045 10:7764219-7764241 CTGAGCCTGCAAGCTTATGCAGG + Intronic
1064851557 10:19714367-19714389 GTCAGCCTGCCAGCGTCTACCGG + Intronic
1066717480 10:38301828-38301850 GTTAGCCAGCCAGCTCTTGCTGG + Intergenic
1067282292 10:44881556-44881578 CTCAGCCTGCCAGCCTTGGAAGG - Intergenic
1067456326 10:46421779-46421801 GTCAGCCTTCCAGCTTCCCCAGG + Intergenic
1067630873 10:47962860-47962882 GTCAGCCTTCCAGCTTCCCCAGG - Intergenic
1069373133 10:67767930-67767952 ATCAGCCTGGGAGATTTTGCAGG - Intergenic
1075811968 10:125230996-125231018 GGCAGCCTGGCAGCTATGGCTGG - Intergenic
1076265207 10:129104161-129104183 TTCCTCCTGCCAGCATTTGCTGG - Intergenic
1076963326 10:133785355-133785377 GTCAGCCTGCCTGGTATGGCAGG + Intergenic
1077119071 11:898555-898577 GTCCCCCTGCTATCTTTTGCGGG + Intronic
1077431907 11:2520008-2520030 TTCAGCCTTCCAGCCTCTGCGGG - Intronic
1079228285 11:18627312-18627334 CTCAGCCTTCCAGTCTTTGCTGG - Intronic
1081742986 11:45453963-45453985 GTCAGCCTGCTGGCTCTTCCAGG + Intergenic
1083054701 11:59808805-59808827 GTCAGTGTGCCAGGTTTTGGTGG + Intronic
1090402622 11:126458722-126458744 GTCAGCCTGCCTGCCTTTCGTGG + Intronic
1090615650 11:128512394-128512416 TTCAGCATGCCAGTTTTTGGGGG - Intronic
1101352699 12:103946960-103946982 GAAAGCCAGCCAGCCTTTGCGGG - Intronic
1101736748 12:107469005-107469027 GTCTTCCTGCCTACTTTTGCGGG - Intronic
1106016313 13:25872324-25872346 CTCAGCCAGCCACCTTCTGCAGG - Intronic
1113989755 13:114352191-114352213 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
1114450600 14:22822650-22822672 GTCTGGCCGCCAGCTTATGCAGG - Intronic
1115377763 14:32696829-32696851 CTCCCCCTGACAGCTTTTGCAGG - Intronic
1121776587 14:96594821-96594843 GTCAGCAGGCCACCTTGTGCTGG - Intergenic
1122880962 14:104690227-104690249 CTAAGCCTGCCAGCGGTTGCGGG - Intronic
1126511836 15:49485607-49485629 GTCTGCCTTCCAGGATTTGCTGG - Exonic
1127667618 15:61164288-61164310 TTCAGCCTGCCAGCCGCTGCTGG - Intronic
1129936941 15:79458559-79458581 GTCATCCTTCCAGGTTTGGCAGG + Intronic
1130403244 15:83576588-83576610 GGCGGCCTTCCAGCTTTTTCAGG - Exonic
1131194311 15:90342878-90342900 GTCAGCATGCCCACATTTGCAGG - Intergenic
1132461789 16:59054-59076 GCCAGCCTGCCAGCTTCTCCAGG + Exonic
1133971311 16:10570115-10570137 CTGTGCCTGCCAGCTCTTGCTGG + Intronic
1138207980 16:55138963-55138985 GTCAGGCTGCCAGCTCTTCAGGG + Intergenic
1141513630 16:84528444-84528466 GTGAGCTTGGCAGCTTCTGCAGG - Intronic
1142610064 17:1104221-1104243 GTCAGCCTAGCAGATTGTGCAGG - Intronic
1144383395 17:14725622-14725644 GCCAGCCTGCCAGCTGGTCCAGG - Intergenic
1147660839 17:42116163-42116185 GTCAGGCTGCCAGCCGTGGCAGG + Intronic
1148148883 17:45384448-45384470 GGCGGCCTGCCAGCATTTACAGG + Intergenic
1150127154 17:62644807-62644829 GTCAGCCTCCGAGATTCTGCGGG + Intronic
1151816224 17:76472766-76472788 GCCAGCCGGCCAGCTTCTCCAGG + Exonic
1151963938 17:77421508-77421530 GTGAGCCTCCCTGCTCTTGCCGG - Intronic
1152111097 17:78358244-78358266 GTCCGCCTGCCACATTCTGCAGG + Exonic
1152409475 17:80115870-80115892 GTGAGTCTCCCAGCCTTTGCTGG + Intergenic
1152554762 17:81047264-81047286 GCCAGCCTGTCAGCTCTTGGTGG - Intronic
1154487622 18:14887584-14887606 GTCTGCCTTCCAGGATTTGCTGG + Intergenic
1157182708 18:45511630-45511652 CTCATCCTGCAAGCTTTTCCTGG - Intronic
1159894033 18:73979898-73979920 GGAAGCCTGCCAGCTTCTACAGG - Intergenic
1162705713 19:12553323-12553345 GGCAGCCTGCCCGCCCTTGCAGG - Intronic
1164833500 19:31340861-31340883 GTCTTGCTGCCAGCTTTAGCTGG - Intronic
1168728462 19:58605804-58605826 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
925755932 2:7132737-7132759 GTCTACCTGACAGCTTTTGTTGG + Intergenic
926591916 2:14749540-14749562 GTCATTCTGCTGGCTTTTGCAGG - Intergenic
927635611 2:24813946-24813968 GTCAGCCTGGTACCTTCTGCTGG + Intronic
928178762 2:29053075-29053097 GGCAGCATCCCAGCTCTTGCAGG + Exonic
929791421 2:45025676-45025698 CTCAGACTGACAGCTTTTCCTGG - Intergenic
931845845 2:66203243-66203265 CTCAGTTTGCCAGCTTCTGCTGG + Intergenic
934117897 2:88813245-88813267 GTCAGCCTGGCAGCTCTTGCAGG - Intergenic
934900783 2:98158367-98158389 CCCAGCCTGCCAGCTGTTGTGGG - Intronic
935633462 2:105231653-105231675 CACAGCATGCCAGCTTTTGGGGG - Intergenic
939993260 2:148896335-148896357 AGCAGCATGCCAGCTTTTCCTGG + Intronic
948687511 2:239678133-239678155 TTCAGCCTGGCAGCTCTTCCGGG + Intergenic
948953203 2:241268523-241268545 GTCAGCCTGCCAGCTTTTGCTGG + Exonic
949088719 2:242181446-242181468 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
1172855272 20:37996869-37996891 GGGAGCCAGCCAGCTTTGGCAGG + Exonic
1176793659 21:13351749-13351771 GTCTGCCTTCCAGGATTTGCTGG - Intergenic
1177007002 21:15685956-15685978 CACAGCCTGCCACCATTTGCAGG - Intergenic
1179379103 21:40881774-40881796 GTCATCCTGCCAGCTCCTGTAGG - Intergenic
1180263944 21:46697728-46697750 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
1181030233 22:20145986-20146008 GCCAGCCAGCCAGCTGTGGCCGG + Intronic
1183220196 22:36507139-36507161 GGCAGCCTGCCAGCTGGTCCCGG - Intergenic
1184387269 22:44183176-44183198 GTCAGCATGCCAGCCTAGGCAGG - Intronic
1184788111 22:46681613-46681635 GCCAGAGTGCCAGCTTCTGCTGG - Intergenic
1185138143 22:49085331-49085353 CTCAGCCTCCCTGCTTCTGCTGG + Intergenic
1185430177 22:50806085-50806107 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
950679178 3:14573349-14573371 GCCACCCTGCCAGCTTCTCCAGG + Intergenic
955161585 3:56468796-56468818 GTGTGCCTGGCAGCTTTTGGAGG - Intergenic
955521719 3:59781704-59781726 GTCAGCCTGGATGCATTTGCTGG + Intronic
956667223 3:71653589-71653611 GTCTGCCTGCCAATTTTTGGAGG + Intergenic
960739369 3:120816236-120816258 GTCATGCAGCCACCTTTTGCTGG + Intergenic
961393055 3:126568083-126568105 GGCAGCCTGCAAGCATCTGCAGG + Intergenic
961632791 3:128313495-128313517 GTCAGCCAGCCAGGTCTGGCAGG + Intronic
961803346 3:129469877-129469899 GCCAGCCTGTGAGCTCTTGCAGG - Intronic
961913400 3:130345118-130345140 TTCAGCCTGCTAGCTTCTTCAGG - Intergenic
962952368 3:140230958-140230980 GTCAGCCTGGCAGTTTCTGAAGG + Intronic
965834863 3:172839960-172839982 TTCAGTCTGCCAGCTTTAGTTGG - Intergenic
968626135 4:1627527-1627549 GTCAGCCTGGCAGGGTCTGCTGG - Intronic
969607332 4:8209093-8209115 CTCAGCCTCACAGCTTGTGCAGG - Intronic
975924000 4:79426968-79426990 GGCTGCTTGCCAGCTTGTGCTGG + Intergenic
976085475 4:81403135-81403157 GTTTGAATGCCAGCTTTTGCTGG + Intergenic
979121249 4:116904864-116904886 CTCAGCTTCCCAGGTTTTGCTGG + Intergenic
980330799 4:131408712-131408734 GTCAGCCTGCCAGAATCTGCTGG + Intergenic
981295122 4:143122991-143123013 GTCAACTTGCCAGCTTATGGTGG - Intergenic
982739805 4:159045618-159045640 TTCAGCCTTCCAGCTTCTTCAGG - Intergenic
984446935 4:179849103-179849125 GTCAGTCAGCCAGCTTTTCTGGG - Intergenic
985466550 4:190202653-190202675 GTCAGCCTGCCTGGTATGGCGGG + Intergenic
987259197 5:16186778-16186800 GCCAGCCTGCCAGAGTGTGCAGG - Intergenic
989979851 5:50630547-50630569 GTCATGCTGCCATCTTTTGATGG + Intergenic
996230743 5:121060742-121060764 GTCAGCCTCTCAGGCTTTGCTGG - Intergenic
998105825 5:139468587-139468609 CTCAGCCTGCCTGCCTTTGGTGG + Intergenic
1001154982 5:169264952-169264974 GGCTGGCTGCAAGCTTTTGCAGG - Intronic
1001232559 5:170001201-170001223 GTCAGCCTGCCCTCCTCTGCAGG - Intronic
1002081966 5:176742743-176742765 GGCAGCCTGGCAGATCTTGCAGG + Intergenic
1004570608 6:16841011-16841033 GTCAGCATGGCAGATTTTGCCGG + Intergenic
1006208905 6:32375921-32375943 GCCAGCATGCCAGCATCTGCTGG - Intergenic
1006757408 6:36428487-36428509 GTCAGCCGGCCAGCTCTTTCAGG - Intronic
1006771306 6:36555008-36555030 GCCAGCCAGACAGCTGTTGCAGG - Intergenic
1009572657 6:65407875-65407897 GTCAGGCTGACAGCTTTTCTTGG - Intronic
1009914785 6:69980831-69980853 ATTAGCCTGCCACCTGTTGCTGG + Intronic
1011000981 6:82588493-82588515 GTTAGCCTGCCAGAGTTTGGTGG - Intergenic
1011873532 6:91926998-91927020 GCCAGCCTGCCAGCATCCGCCGG + Intergenic
1014248747 6:119094876-119094898 TTCAGCCTCCCCTCTTTTGCAGG - Intronic
1014437590 6:121437635-121437657 GTGACCCAGCCAGCCTTTGCTGG + Intronic
1015187247 6:130431785-130431807 GTCAGGCTGGCAGGTTTTGAAGG + Intronic
1017046274 6:150349787-150349809 GTGTGCCTGCCAGCTTGTGGTGG + Intergenic
1017813084 6:157998151-157998173 GTCTTCCTGGCAGTTTTTGCAGG + Intronic
1018430719 6:163719574-163719596 GTCAGCCTGCAAGCTGAGGCTGG - Intergenic
1018769755 6:166960076-166960098 GTTTCCATGCCAGCTTTTGCTGG + Intergenic
1019898068 7:3998284-3998306 GCCATCATGCCAGCTGTTGCAGG - Intronic
1021555248 7:21912450-21912472 GTCTGGTTGCCAGCTTTGGCAGG - Intronic
1032613582 7:133442449-133442471 GTCAGACTGCCCGCTCTTGGGGG - Intronic
1038106671 8:24442811-24442833 GTCAGCCTGAAAGCTGTTGGTGG - Intronic
1038446799 8:27610255-27610277 ATCAGACTGCCGGCATTTGCAGG - Intronic
1043937641 8:86160220-86160242 GGCAGCAGGGCAGCTTTTGCTGG + Intergenic
1044354303 8:91203112-91203134 CTCAGGCTCCCAGATTTTGCAGG - Intronic
1044411545 8:91889648-91889670 GTCCGCCTGCCTGTTCTTGCCGG - Intergenic
1045204422 8:100023276-100023298 GTCAGCCTGAAAGATTTTGATGG - Intronic
1047861849 8:128975851-128975873 CCCAGCCTGCCAGCATTTCCTGG + Intergenic
1049863952 8:144921240-144921262 TTCAGCCTCTCAGCTTTTGGGGG - Intergenic
1053356913 9:37453792-37453814 GTCTGCCTGTGGGCTTTTGCTGG + Intronic
1053620976 9:39816409-39816431 GTCTGCCTTCCAGGATTTGCTGG + Intergenic
1053715766 9:40885531-40885553 TTCAGCTTTCCTGCTTTTGCAGG + Intergenic
1053884122 9:42627921-42627943 GTCTGCCTTCCAGGATTTGCTGG - Intergenic
1053888546 9:42666373-42666395 GTCTGCCTTCCAGGATTTGCTGG + Intergenic
1054223142 9:62435367-62435389 GTCTGCCTTCCAGGATTTGCTGG - Intergenic
1054227568 9:62473820-62473842 GTCTGCCTTCCAGGATTTGCTGG + Intergenic
1054263188 9:62891033-62891055 GTCTGCCTTCCAGGATTTGCTGG - Intergenic
1055086049 9:72315253-72315275 GTCACACTGCCAGCTTTTCTTGG - Intergenic
1055759751 9:79594590-79594612 GACAGCCTGACAGCTCTAGCTGG + Intronic
1060095368 9:120784495-120784517 GTCAGCCTCCCGGGTTTAGCTGG - Intronic
1186503870 X:10074469-10074491 GTCAGCAAGCCAGATTTTGGAGG + Intronic
1187213715 X:17254446-17254468 GCCAGCCTGCAAGCTTTTTAAGG + Intergenic
1190318747 X:49167059-49167081 CCTAGTCTGCCAGCTTTTGCTGG + Intronic
1191024370 X:55897263-55897285 GTCAGTCTGCTAGAGTTTGCTGG - Intergenic
1191605706 X:63060197-63060219 GACAGTCTGACAGCTTTTCCTGG + Intergenic
1199544722 X:148995856-148995878 GCCTGCCTGCCAGCAGTTGCTGG + Exonic
1200055947 X:153461004-153461026 GTCAGCCTGGGAGACTTTGCTGG - Intronic
1200411385 Y:2865487-2865509 CTCAGCCTTGCAACTTTTGCAGG + Intronic